Antibacterial Agents & Methods Patent Application (2025)

U.S. patent application number 17/595190 was filed with the patent office on 2022-07-21 for antibacterial agents & methods. The applicant listed for this patent is FOLIUM FOOD SCIENCE LIMTED. Invention is credited to Jasper CLUBE, Tristan COGAN, Edward FUCHS, Christian GRONDAHL, Holger KNEUPER, Alessandro RICCIO, Martin WOODWARD.

ANTIBACTERIAL AGENTS & METHODS

Abstract

The invention relates to means for carrying out conjugationbetween bacteria, and in particular the invention relates tocarrier bacteria comprising antimicrobial agents and methods ofuse. The carrier bacteria are capable of conjugative transfer ofDNA encoding the agent to a target cells. The invention furtherrelates to growth or feed conversion ratio promotion in animals.The invention further relates to killing Salmonella or inhibitingthe growth or proliferation of Salmonella.

Foreign Application Data

Claims

1. A non-medical method for enhancing the growth or weight of ananimal (optionally a livestock animal), wherein the methodcomprises the administration of a plurality of carrier cells to theanimal, wherein the animal comprises bacterial target cells andeach carrier cell is a bacterial cell comprising a first episomalDNA encoding an antibacterial agent that is toxic to a target cellbut is not toxic to the carrier cell, the carrier cell beingcapable of conjugative transfer of the DNA into a target cell forexpression therein of the agent, wherein first DNA is transferredfrom carrier cells into target cells for expression therein toproduce the antibacterial agent, thereby killing target cells inthe animal or reducing the growth or proliferation of target cellsand enhancing growth or weight of the animal.

2. The method of claim 1, wherein the method improves feedconversion ratio (FCR) in the animal.

3. The method of claim 1 or 2, wherein the target cells areSalmonella cells.

4. The method of claim 3, wherein the target cells comprise S.enterica and/or S. typhimurium cells; optionally wherein the S.enterica is S. enterica subspecies enterica.

5. The method of any preceding claim, wherein the method kills aplurality of different S. enterica subspecies enterica serovars;optionally wherein each serovar is selected from the groupconsisting of Typhimurium, Enteritidis, Virchow, Montevideo,Heidelberg, Hadar, Binza, Bredeney, Infantis, Kentucky, Seftenberg,Mbandaka, Anatum, Agona and Dublin.

6. The method of any preceding claim, wherein the carrier cells areEnterobacteriaceae cells, optionally E. coli cells (such as F18,Nissle or S17 E. coli cells).

7. The method of any preceding claim, wherein the method reducestarget cells in the gastrointestinal tract of the animal;optionally wherein the animal is a bird and the method reducestarget cells in the caecum, crop, liver, spleen and/or ileum of thebird.

8. The method of any preceding claim, wherein the first DNA iscomprised by a plasmid, wherein the plasmid comprises a RP4 originof transfer (oriT) and/or a p15A ori.

9. The method of any preceding claim, wherein the agent comprisesone or more components of a CRISPR/Cas system that is operable in atarget cell to cut a protospacer sequence comprised by the targetcell, optionally wherein the target cells comprise first and secondstrains of a bacterial species and each strain comprises theprotospacer sequence, wherein cells of the strains are killed.

10. The method of claim 9, wherein the system is operable to cut atleast 3 different protospacer sequences comprised by the targetcell genome.

11. The method of claim 9 or 10, wherein each or some of saidprotospacer sequences is comprised by a pathogenicity island thatis comprised by the target cell.

12. The method of any preceding claim, wherein the agent (a)comprises a guided nuclease that is capable of recognising andmodifying a target nucleic acid sequence, wherein the targetsequence is comprised by an endogenous chromosome or episome of thetarget cells but is not comprised by the carrier cells, wherein thenuclease modifies the chromosome or episome to kill the targetcells or inhibit the growth or proliferation of the target cells;and/or (b) encodes a guide RNA or crRNA of a CRISPR/Cas system thatoperates with a Cas nuclease in the target cells to cut aprotospacer sequence comprised by the target cells.

13. A carrier cell for use in the method of any preceding claim,wherein the cell is a bacterial cell comprising a first episomalDNA encoding an antibacterial agent that is toxic to a bacterialtarget cell but is not toxic to the carrier cell, the carrier cellbeing capable of conjugative transfer of the DNA into a target cellfor expression therein of the antibacterial agent, hereby killingthe target cell, wherein the target cell is a Salmonella cell andthe carrier cell is an Enterobacteriaceae cell.

14. A composition comprising a plurality of carrier cells for usein a method comprising administration of the cells to a subject totreat an infection by pathogenic bacterial target cells, whereineach carrier cell is a bacterial cell comprising a first episomalDNA encoding an antibacterial agent that is toxic to a target cellbut is not toxic to the carrier cell, the carrier cell beingcapable of conjugative transfer of the DNA into a target cell forexpression therein of the agent, wherein first DNA is transferredfrom carrier cells into target cells for expression therein toproduce the antibacterial agent, thereby killing target cells inthe subject or reducing the growth or proliferation of targetcells, wherein the target cells are Salmonella cells and thecarrier cells are Enterobacteriaceae cells.

15. A non-medical method of killing zoonotic bacterial target cellsin an animal (optionally a livestock animal), the method comprisingadministering to the animal a plurality of carrier cells, whereineach carrier cell is a bacterial cell comprising a first episomalDNA encoding an antibacterial agent that is toxic to a target cellbut is not toxic to the carrier cell, the carrier cell beingcapable of conjugative transfer of the DNA into a target cell forexpression therein of the agent, wherein first DNA is transferredfrom carrier cells into target cells for expression therein toproduce the antibacterial agent, thereby killing target cells inthe subject or reducing the growth or proliferation of targetcells, wherein the target cells are Salmonella cells and optionallythe carrier cells are Enterobacteriaceae cells.

16. The composition of claim 14 or the method of claim 15, whereinthe method reduces Salmonella in the gastrointestinal tract of thesubject.

17. The method of claim 14 or 16, wherein the method is carried outon a group (optionally a flock or herd) of animals, wherein some orall of the animals comprise target cells, wherein spread of cellsof the target species is reduced in the group; or wherein spread isreduced from the group to a second group of animals.

18. The composition or method of any one of claims 14 to 17,wherein the target cells comprise different Salmonella spp. typesthat are killed.

19. The cell, composition or method of any one of claims 13 to 18,wherein the carrier cell, target cell(s) or DNA is respectively acarrier cell, target cell(s) or DNA as defined in any one of claims1 to 12.

20. A DNA for use in the method of claim 12, wherein the DNA iscapable of being introduced into a target cell, wherein the DNAencodes a plurality of guide RNAs or crRNAs of a CRISPR/Cas systemwherein the guide RNAs or crRNAs are operable with Cas nuclease inthe target cell to recognise a plurality of protospacer sequencescomprised by the target cell genome, wherein the target cell is aSalmonella cell and (a) the protospacer sequences comprise one ormore pathogenic island nucleotide sequences of the target cellgenome; (b) the protospacer sequences comprise one or more invasiongene sequences of the target cell genome; (c) the protospacersequences comprise one or more secretion system gene sequences ofthe target cell genome; and/or (d) the protospacer sequencescomprise one or more nucleotide sequences of genes selected from Agene selected from avrA, sptP, sicP, sipA, sipD, sipC, sipB, sicA,invB, ssaE, sseA, sseB, sscA, sseC, sseD, sseE, sscB, sseF, sseG,mgtC, cigR, pipA, pipB, pipC, sopB and pipD (optionally selectedfrom invB, sicP, sseE, pipA, pipB, pipC, hilA, marT and sopB).

21. The DNA of claim 20, wherein the DNA is comprised by a plasmidwhich comprises an origin of transfer (oriT) and an origin ofreplication (oriV) that is operable for replication of the DNA in abacterial host cell.

22. The DNA of claim 20 or 21, wherein the DNA comprises SEQ ID NO:15, optionally wherein the DNA is comprised by a plasmid in acarrier bacterial cell for conjugation to a Salmonella targetcell.

23. The DNA of claim 20 or 21, wherein the DNA comprises CRISPRrepeat and spacer sequences, wherein (a) the repeat sequences eachcomprise SEQ ID NO: 16; and/or (b) the spacer sequences compriseone, two or three sequences selected from SEQ ID NOs: 17-19 andcomplement sequences thereof; optionally wherein the DNA iscomprised by a plasmid in a carrier bacterial cell for conjugationto a Salmonella target cell.

24. The DNA of claim 23, wherein the DNA comprises (optionally in5' to 3' order) SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19.

25. The method, cell, composition or DNA of any preceding claim,wherein the target cell is an Enterobacteriaceae cell (optionally aSalmonella cell) and said DNA is comprised by a plasmid, whereinthe plasmid is selected from an IncFI, IncFII, IncFIII, IncFIV,IncFV, IncM, Inc9, InclO, Incl, IncA, IncB, IncC, IncH, Incla,InclIc, IncI2, Incly, IncJ, IncL, IncN, Inc2e, IncO, IncP, IncS,IncT and IncW plasmid.

Description

TECHNICAL FIELD

[0001] The invention relates to means for carrying out conjugationbetween bacteria, and in particular the invention relates tocarrier bacteria comprising antimicrobial agents and methods ofuse. A carrier bacterium is capable of conjugative transfer of DNAencoding the agent to a target cell.

[0002] The invention further relates to growth or feed conversionratio (FCR) promotion in animals. The invention further relates tokilling Salmonella or inhibiting the growth or proliferation ofSalmonella. The invention further relates to killing Pseudomonas orinhibiting the growth or proliferation of Pseudomonas, such asuseful for promoting growth, dry weight, wet weight or cropproduction of plants.

BACKGROUND

[0003] DNA sequences controlling extra-chromosomal replication(ori) and transfer (tra) are distinct from one another; i.e., areplication sequence generally does not control plasmid transfer,or vice-versa. Replication and transfer are both complex molecularprocesses that make use of both plasmid- and host-encodedfunctions. Bacterial conjugation is the unidirectional andhorizontal transmission of genetic information from one bacteriumto another. The genetic material transferred may be a plasmid or itmay be part of a chromosome. Bacterial cells possessing aconjugative plasmid contain a surface structure (the sex pilus)that is involved in the coupling of donor and recipient cells, andthe transfer of the genetic information. Conjugation involvescontact between cells, and the transfer of genetic traits can bemediated by many plasmids. Among all natural transfer mechanisms,conjugation is the most efficient. For example, F plasmid of E.coli, pCFlO plasmid of Enterococcus faecalis and pXO16 plasmid ofBacillus thuringiensis employ different mechanisms for theestablishment of mating pairs, the sizes of mating aggregates aredifferent, and they have different host ranges within gram-negative(F) as well as gram-positive (pCFlO and pXO16) bacteria. Theirplasmid sizes are also different; 54, 100 and 200 kb, respectively.Remarkably, however, those conjugation systems have very importantcharacteristics in common: they are able to sustain conjugativetransfer in liquid medium and transfer efficiencies close to 100%are often reached in a very short time. Thus, the conjugativeprocess permits the protection of plasmid DNA against environmentalnucleases, and the very efficient delivery of plasmid DNA into arecipient cell. Conjugation functions are naturally plasmidencoded. Numerous conjugative plasmids (and transposons) are known,which can transfer associated genes within one species (narrow hostrange) or between many species (broad host range). Transmissibleplasmids have been reported in numerous Gram-positive genera,including but not limited to pathogenic strains of Streptococcus,Staphylococcus, Bacillus, Clostridium and Nocardia. The earlystages of conjugation generally differ in Gram-negative andGram-positive bacteria. The role of some of the transfer genes inconjugative plasmids from Gram-negative bacteria are to providepilus-mediated cell-to-cell contact, formation of a conjugationpore and related morphological functions. The pili do not appear tobe involved in initiating conjugation in Gram-positivebacteria.

SUMMARY OF THE INVENTION

[0004] The invention provides:

[0005] A method (eg, a non-medical or a medical) for enhancing thegrowth or weight of a subject, wherein the subject comprisesbacterial target cells, the method comprising administering to thesubject a first episomal DNA encoding an antibacterial agent thatis toxic to the target cells, wherein first DNA is transferred intotarget cells and the agent is expressed, thereby killing targetcells in the subject or reducing the growth or proliferation oftarget cells and enhancing growth or weight of the subject.

[0006] In an embodiment, there is provided:

[0007] A method (eg, a non-medical or a medical) for enhancing thegrowth or weight of a subject, wherein the method comprises theadministration of a plurality of carrier cells to the subject,wherein the subject comprises bacterial target cells and eachcarrier cell is a bacterial cell comprising a first episomal DNAencoding an antibacterial agent that is toxic to a target cell butis not toxic to the carrier cell, the carrier cell being capable ofconjugative transfer of the DNA into a target cell for expressiontherein of the agent, wherein first DNA is transferred from carriercells into target cells for expression therein to produce theantibacterial agent, thereby killing target cells in the subject orreducing the growth or proliferation of target cells and enhancinggrowth or weight of the subject.

[0008] Advantageously, the FCR is improved (ie, enhanced), ie, theFCR number is lowered, in the subject. When the method of theinvention is carried out on a group of subjects (eg, a group ofanimals, such as livestock animals) the FCR is lowered in anindividual in the group or the average FCR is lowered in the group.Lowering may be assessed as a comparison with FCR prior toadministration of the carrier cell(s) or compared to an average foranimals of the same species, age group and when fed on comparableor the same diet. The skilled addressee will be familiar withstandard FCRs, such as for livestock animals, eg, piglets, pigs,sheep, cattle (dairy or meat cattle), fish, shellfish, poultry (eg,chickens (broiler or egg-layer hens), geese, ducks or turkeys).

[0009] The invention also provides:

[0010] A carrier cell, wherein the cell is a bacterial cellcomprising a first episomal DNA encoding an antibacterial agentthat is toxic to a bacterial target cell but is not toxic to thecarrier cell, the carrier cell being capable of conjugativetransfer of the DNA into a target cell for expression therein ofthe antibacterial agent, hereby killing the target cell, whereinthe target cell is a Salmonella cell and the carrier cell is anEnterobacteriaceae cell.

[0011] A composition comprising a plurality of carrier cells foruse in a method comprising administration of the cells to a subjectto treat an infection by pathogenic bacterial target cells, whereineach carrier cell is a bacterial cell comprising a first episomalDNA encoding an antibacterial agent that is toxic to a target cellbut is not toxic to the carrier cell, the carrier cell beingcapable of conjugative transfer of the DNA into a target cell forexpression therein of the agent, wherein first DNA is transferredfrom carrier cells into target cells for expression therein toproduce the antibacterial agent, thereby killing target cells inthe subject or reducing the growth or proliferation of targetcells, wherein the target cells are Salmonella cells and thecarrier cells are Enterobacteriaceae cells.

[0012] A non-medical method of killing zoonotic bacterial targetcells in an animal (optionally a livestock animal), the methodcomprising administering to the animal a plurality of carriercells, wherein each carrier cell is a bacterial cell comprising afirst episomal DNA encoding an antibacterial agent that is toxic toa target cell but is not toxic to the carrier cell, the carriercell being capable of conjugative transfer of the DNA into a targetcell for expression therein of the agent, wherein first DNA istransferred from carrier cells into target cells for expressiontherein to produce the antibacterial agent, thereby killing targetcells in the subject or reducing the growth or proliferation oftarget cells, wherein the target cells are Salmonella cells andoptionally the carrier cells are Enterobacteriaceae cells.

[0013] A DNA (optionally for use in the method of the invention),wherein the DNA is capable of being introduced into a target cell,wherein the DNA encodes a plurality of guide RNAs or crRNAs of aCRISPR/Cas system wherein the guide RNAs or crRNAs are operablewith Cas nuclease in the target cell to recognise a plurality ofprotospacer sequences comprised by the target cell genome; wherein[0014] (a) the protospacer sequences comprise one or morepathogenic island nucleotide sequences of the target cell genome;[0015] (b) the protospacer sequences comprise one or more invasiongene sequences of the target cell genome; [0016] (c) theprotospacer sequences comprise one or more secretion system genesequences of the target cell genome; and/or [0017] (d) theprotospacer sequences comprise one or more nucleotide sequences ofgenes selected from A gene selected from avrA, sptP, sicP, sipA,sipD, sipC, sipB, sicA, invB, ssaE, sseA, sseB, sscA, sseC, sseD,sseE, sscB, sseF, sseG, mgtC, cigR, pipA, pipB, pipC, sopB and pipD(optionally selected from invB, sicP, sseE, pipA, pipB, pipC, hilA,marT and sopB of Salmonella, and orthologues or homologuesthereof.

[0018] The also invention provides the followingconfigurations:--

In a First Configuration

[0019] A carrier bacterial cell comprising a first episomal DNA,the DNA encoding a nucleic acid sequence of interest (NSI) orencoding an antibacterial agent that is toxic to a target bacterialcell but is not toxic to the carrier cell, the carrier cell beingcapable of conjugative transfer of the DNA into the target cell forexpression therein of the agent, optionally wherein [0020] (a) thecarrier cell comprises a second DNA which is different from thefirst DNA, wherein the second DNA comprises or encodes a firstfactor required for replication of the first DNA; [0021] (b) thefirst DNA does not comprise or encode said first factor, whereinthe first DNA is non-self-replicative in the absence of the firstfactor, but is able to replicate in the carrier cell in thepresence of the first factor provided by the second DNA; [0022] (c)wherein the cell comprises genes encoding one or more conjugationfactors sufficient to carry out conjugative transfer of the firstDNA into a target bacterial cell.

[0023] In embodiments, the invention usefully recognizes thebenefit of using antibacterial agents that act by target sequencerecognition in the target cell genome but not in the carrier cell,which frees up the ability for the first DNA to be freelyreplicated in the carrier cell without toxicity to the carriercell.

In a Second Configuration

[0024] A DNA encoding an NSI or encoding an antibacterial agentthat is toxic to a target bacterial cell but is not toxic to acarrier cell that is capable of carrying the DNA for conjugativetransfer into the target cell, wherein the first DNA does notcomprise or encode a first factor required for replication of thefirst DNA, and wherein the first DNA is devoid of a componentrequired for conjugative transfer of the first DNA into a targetbacterial cell.

In a Third Configuration

[0025] A method for enhancing growth or weight of a human or animalsubject, wherein the method comprises the administration of aplurality of carrier cells according to the invention to amicrobiota of the subject, wherein the microbiota comprises targetcells and first DNA is transferred from carrier cells into targetcells for expression therein to produce the antibacterial agent,thereby killing target cells (eg, Salmonella cells) in the subjector reducing the growth or proliferation of target cells.

In a Fourth Configuration

[0026] A method for enhancing growth or weight of a plant, whereinthe method comprises the administration of a plurality of carriercells according to the invention to a microbiota of the plant,wherein the microbiota comprises target cells and first DNA istransferred from carrier cells into target cells for expressiontherein to produce the antibacterial agent, thereby killing targetcells (eg, Pseudomonas cells) in the plant or reducing the growthor proliferation of target cells.

In a Fifth Configuration

[0027] A method for reducing a biofilm comprised by a subject orcomprised on a surface, wherein the biofilm comprises target cells(eg, Pseudomonas cells), wherein the method comprises theadministration of a plurality of carrier cells according to theinvention to the biofilm, wherein first DNA is transferred fromcarrier cells into target cells for expression therein to producethe antibacterial agent, thereby killing target cells in thebiofilm or reducing the growth or proliferation of targetcells.

In a Sixth Configuration

[0028] A method of replicating a first DNA (eg, comprised byconjugative plasmids) to produce a plurality of copies of said DNA,the method comprising culturing a plurality of carrier bacterialcells according to the invention, wherein the first DNA isreplicated in the cells; and optionally isolating a plurality ofcopies of the first DNA from carrier cells.

In a Seventh Configuration

[0029] A method of killing a plurality of target bacterial cells orreducing the growth or proliferation thereof, the method comprising[0030] (a) obtaining a sample of the carrier cells according to theinvention or obtainable by the method of the sixth configuration;[0031] (b) contacting the sample of carrier cells with theplurality of target bacterial cells to allow conjugation betweencarrier cells and target cells; and [0032] (c) allowing copies offirst DNA to be transferred by conjugative transfer from carriercells to target cells, wherein the antibacterial agent is providedin target cells and target cells are killed or the growth orproliferation of target cells is reduced; [0033] (d) wherein thefirst DNA is not (or not substantially) replicable in the targetcells.

In an Eighth Configuration

[0034] A pharmaceutical composition, livestock growth promotingcomposition, zoonosis control agent, biocidal agent foradministration to livestock, soil improver, herbicide, plantfertilizer, food or food ingredient sterilizing composition, dentalcomposition, personal hygiene composition or disinfectantcomposition (eg, for domestic or industrial use) comprising aplurality of carrier cells according to the invention.

In an Ninth Configuration

[0035] In a first aspect:--

[0036] A method of promoting the growth of an animal (eg, alivestock animal, eg, a poultry animal), the method comprisingadministering to the animal a guided nuclease system or a componentthereof, and introducing the system or component into targetbacteria comprised by the animal, wherein the guided nuclease iscapable of recognising and modifying (eg, cutting) a targetnucleotide sequence comprised by the target bacteria, wherebytarget bacteria are killed or the growth or proliferation of targetbacteria are inhibited and the growth of the animal ispromoted.

[0037] The method is a non-medical method and the presence oftarget bacteria in the animal is capable of inhibiting the growthof the animal. Thus, the method reduces the burden of such bacteriain the animal and promotes growth.

[0038] In a second aspect:--

[0039] A method of enhancing feed conversion ratio (FCR) in ananimal (eg, a livestock animal, eg, a poultry animal), the methodcomprising administering to the animal a guided nuclease system ora component thereof, and introducing the system or component intotarget bacteria comprised by the animal, wherein the guidednuclease is capable of recognising and modifying (eg, cutting) atarget nucleotide sequence comprised by the target bacteria,whereby target bacteria are killed or the growth or proliferationof target bacteria are inhibited and the FCR of the animal isincreased.

[0040] The method is a non-medical method and the presence oftarget bacteria in the animal is capable of increasing the FCR ofthe animal. Thus, the method reduces the burden of such bacteria inthe animal and enhances FCR (ie, reduces FCR number).

[0041] In a third aspect:--

[0042] A method of promoting the growth of an animal (eg, alivestock animal, eg, a poultry animal), the method comprisingadministering to the animal an antibacterial agent that is toxic toSalmonella bacteria, wherein Salmonella target bacteria comprisedby the animal are exposed to the agent and are killed or the growthor proliferation of target bacteria are inhibited and the growth ofthe animal is promoted.

[0043] The method is a non-medical method and the presence oftarget bacteria in the animal is capable of inhibiting the growthof the animal. Thus, the method reduces the burden of such bacteriain the animal and promotes growth.

[0044] In a fourth aspect:--

[0045] A method of enhancing feed conversion ratio (FCR) in ananimal (eg, a livestock animal, eg, a poultry animal), the methodcomprising administering to the animal an antibacterial agent thatis toxic to Salmonella bacteria, wherein Salmonella target bacteriacomprised by the animal are exposed to the agent and are killed orthe growth or proliferation of target bacteria are inhibited andthe FCR of the animal is enhanced.

[0046] The method is a non-medical method and the presence oftarget bacteria in the animal is capable of increasing the FCR ofthe animal. Thus, the method reduces the burden of such bacteria inthe animal and enhances FCR (ie, reduces FCR number).

[0047] In an Tenth Configuration

[0048] In a first aspect:--

[0049] A method of promoting growth, dry weight, wet weight or cropproduction of a plant, the plant comprising a microbiota thatcomprises target bacteria, the method comprising contacting themicrobiota with an antibacterial agent that is toxic to the targetbacteria, wherein target bacteia are killed or the growth orproliferation of target bacteria is inhibited and the growth, dryweight, wet weight or crop production of the plant isincreased.

[0050] In a second aspect:--

[0051] Use of an antibacterial agent that is toxic to targetbacteria in a method wherein target bacteria comprised by amicrobiota of a plant are contacted with the agent, whereby targetbacteria are killed or the growth or proliferation of targetbacteria is inhibited, for promoting growth, dry weight, wet weightor crop production of the plant.

[0052] In a third aspect:--

[0053] A method of increasing crop yield of a plant, the plantcomprising a microbiota that comprises target bacteria, the methodcomprising contacting the microbiota with an antibacterial agentthat is toxic to the target bacteria, wherein target bacteia arekilled or the growth or proliferation of target bacteria isinhibited and the growth, dry weight, wet weight or crop productionof the plant is increased.

[0054] In a fourth aspect:--

[0055] Use of an antibacterial agent that is toxic to targetbacteria in a method wherein target bacteria comprised by amicrobiota of a plant are contacted with the agent, whereby targetbacteria are killed or the growth or proliferation of targetbacteria is inhibited, for increasing crop yield of the plant.

[0056] In a fifth aspect:--

[0057] A method of increasing leaf chlorophyll of a plant, theplant comprising a microbiota that comprises target bacteria, themethod comprising contacting the microbiota with an antibacterialagent that is toxic to the target bacteria, wherein target bacteiaare killed or the growth or proliferation of target bacteria isinhibited and the leaf chlorophyll of the plant is increased.

[0058] In a sixth aspect:--

[0059] Use of an antibacterial agent that is toxic to targetbacteria in a method wherein target bacteria comprised by amicrobiota of a plant are contacted with the agent, whereby targetbacteria are killed or the growth or proliferation of targetbacteria is inhibited, for increasing leaf chlorophyll of theplant.

[0060] In a seventh aspect:--

[0061] A method of increasing greening of a plant, the plantcomprising a microbiota that comprises target bacteria, the methodcomprising contacting the microbiota with an antibacterial agentthat is toxic to the target bacteria, wherein target bacteia arekilled or the growth or proliferation of target bacteria isinhibited and greening of the plant is increased.

[0062] In a eighth aspect:--

[0063] Use of an antibacterial agent that is toxic to targetbacteria in a method wherein target bacteria comprised by amicrobiota of a plant are contacted with the agent, whereby targetbacteria are killed or the growth or proliferation of targetbacteria is inhibited, for increasing greening of the plant.

[0064] In a ninth aspect:--

[0065] A method of decreasing a biofilm (eg, a leaf biofilm)comprised by a plant, the plant comprising a biofilm that comprisestarget bacteria, the method comprising contacting the microbiotawith an antibacterial agent that is toxic to the target bacteria,wherein target bacteia are killed or the growth or proliferation oftarget bacteria is inhibited and the biofilm of the plant isdecreased.

[0066] In a tenth aspect:--

[0067] Use of an antibacterial agent that is toxic to targetbacteria in a method wherein target bacteria comprised by a biofilm(eg, a leaf biofilm) of a plant are contacted with the agent,whereby target bacteria are killed or the growth or proliferationof target bacteria is inhibited, for inhibiting the biofilm of theplant.

[0068] Optionally, the target bacteria are Pseudomonas bacteria,such as P. syringae or P. aeruginosa bacteria or any otherPseudomonas bacteria disclosed herein.

[0069] Optionally, the agent is a guided nuclease system or acomponent thereof, eg, any such system or component disclosedherein for modifying (eg, cutting) a target nucleic acid sequencecomprised by target bacteria.

[0070] Optionally, the plant is any plant disclosed herein.

[0071] Optionally, the chlorophyll is a chlorophyll a and/orchlorophyll b.

[0072] Optionally, the agent is comprised by a carrier cell of thepresent invention and said contacting comprises contacting the cellwith the carrier cell.

BRIEF DESCRIPTION OF FIGURES

[0073] FIG. 1. PCRs performed on recipient colonies. From the leftto the right: 1) Plasmid pFSMobC* (control). 2) Plasmid pFSMobC* inS17 (control). 3) Colony from transconjugants plate (Cm30+Nal25).4) Colony n.degree. 2 from transconjugants plate (Cm30+ Nal25);

[0074] FIG. 2: Effect of viability of pFSMobSal7 delivered byconjugation on Salmonella enteritidis FS26;

[0075] FIG. 3. Numbers of Salmonella in the caecum at 7 days postinfection. N=15 birds per group;

[0076] FIG. 4. Frequency of detection of Salmonella in the caecumat 7 days post infection. N=15 birds per group; and

[0077] FIG. 5. Post mortem carcass weight of birds at 6 weeks ofage.

[0078] FIG. 6. Numbers (CFU/g) of Salmonella in crop digesta 7 dayspost-challenge; N=9 birds; P=0.03.

DETAILED DESCRIPTION

[0079] The invention relates to means for carrying out conjugationbetween bacteria, and in particular the invention relates tocarrier bacteria comprising antimicrobial agents and methods ofuse. A carrier bacterium is capable of conjugative transfer of DNAencoding the agent to a target cell.

[0080] The invention further relates to growth, weight or feedconversion ratio (FCR) promotion in animals.

[0081] The invention further relates to killing Salmonella orinhibiting the growth or proliferation of Salmonella.

[0082] Thus, there is provided:

[0083] A method (eg, a non-medical or a medical) for enhancing thegrowth or weight of a subject, wherein the subject comprisesbacterial target cells, the method comprising administering to thesubject a first episomal DNA encoding an antibacterial agent thatis toxic to the target cells, wherein first DNA is transferred intotarget cells and the agent is expressed, thereby killing targetcells in the subject or reducing the growth or proliferation oftarget cells and enhancing growth or weight of the subject.

[0084] Advantageously, the FCR is enhanced in the subject.Optionally, the FCR is enhanced (ie, lowered) by at least 1, 2, 3,4, 5, 6, 7, 8, 9 or 10%, eg from 2 to 6% or from 2 to 5% (such as2, 3, 4, 5 or 6%) compared to the FCR of the subject prior toadministration of the agent or carrier cells. Optionally, the FCRis enhanced by at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10%, eg from2-5% (such as 2, 3, 4, or 5%) compared to the FCR of a controlsubject of the same species and sex that has not receivedadministration of the agent or carrier cells. In an embodiment, thesubject is a bird, poultry bird, chicken, turkey, goose or duck(preferably a chicken) and the FCR number is lowered by an amountfrom 0.03 to 0.07, eg, from 0.04 to 0.06, eg, 0.04, 0.05 or 0.06.Thus, for example, compared to a control bird, the FCR of thecontrol bird is 1.7 (g feed/g bird) and after a subject bird thathas been treated using the invention has a FCR of 1.64 to 1.66. Thecontrol bird (eg, chicken) of the same species, sex and age as thesubject of the invention and fed on the same diet (feed), but doesnot receive the treatment of the invention. The birds may be fromthe same flock. In an embodiment, therefore, a bird (eg, chicken)has a FCR of 1.64 to 1.66, wherein the subject has been treated bythe method of the invention.

[0085] In an example, the method is carried out on a group ofsubjects (eg, subjects of the same species, such as a group oflivestock animals, eg, a poultry flock or herd of cattle or sheep).In this example, the average FCR of the group is enhanced by themethod (ie, the FCR number is lowered) compared to a control groupof animals of the same species, subspecies or type, or compared tothe average FCR of the group prior to treatment with the method. Acontrol group may be a group of animals of the same species, withthe same average age, same proportion of males and females and fedon the same diet as the group of the invention. For example, thegroup of the invention and control group are both poultry (eg,chicken) flocks, eg, with common ancestry one or two or threegenerations back. The flock may be a flock of broiler chickens orhen-layer hens. For example, the group of the invention and controlgroup are both beef cattle herds, or dairy herds, eg, with commonancestry one or two or three generations back.

FCR, FE & ECI

[0086] In animal husbandry, feed conversion ratio (FCR) is a ratiomeasuring the efficiency with which the bodies of livestock convertanimal feed into the desired output. For dairy cows, for example,the output is milk, whereas in animals raised for meat (such asbeef cows, pigs, chickens, and fish) the output is the flesh, thatis, the body mass gained by the animal, represented either in thefinal mass of the animal or the mass of the dressed output. FCR isthe mass of the input divided by the output (thus mass of feed permass of milk or meat). In some sectors, Feed Efficiency (FE), whichis the output divided by the input (i.e. the inverse of FCR), isused. These concepts are also closely related to efficiency ofconversion of ingested foods (ECI). FCR is widely used in swine andpoultry production, while FE is used more commonly with cattle.Being a ratio the FCR is dimensionless, that is, it is not affectedby the units of measurement used to determine the FCR. Animals thathave a low FCR are considered efficient users of feed.

[0087] Preferably, the enhancement produced by the invention is anincrease in body mass of the subject. Instead of enhancement ofFCR, the invention may be a method for enhancing Feed Efficiency(FE) in the subject, or enhancing the Efficiency of Conversion ofIngested Foods (ECI) in the subject.

[0088] FCR may be calculated using feed dry mass, or may becalculated on an as-fed wet mass basis.

[0089] In an embodiment, the FCR, FE or ECI number is changed by0.2, 0.5, 1, 1.5 or 2. For example, the FCR is reduced by 1, 1.5 or2.

Conversion Ratios for Livestock

Beef Cattle

[0090] As of 2013 in the US, an FCR calculated on live weight gainof 4.5-7.5 was in the normal range with an FCR above 6 beingtypical. Thus, in an example of the invention the or each animal isa beef cow and the FCR number in the animal (or average FCR of theanimals) is reduced by the method to below 6 (calculated using liveweight of the animal), eg, below 5.5, 5, 4.5, 4 or 3.5 (optionally,said FCR or average FCR is reduced to an FCR from 3.5 to 5.9, eg,from 4 to 5.5.

Dairy Cattle

[0091] In the US, the price of milk is based on the protein and fatcontent, so the FCR is often calculated to take that into account.Using an FCR calculated just on the weight of protein and fat inmilk obtained from the animal(s), as of 2011 an FCR of 13 was poor,and an FCR of 8 was very good. Thus, in an example of the inventionthe or each animal is a dairy cow and the FCR number in the animal(or average FCR of the animals) is reduced by the method to below11, 10, 9 or 8, (and optionally greater than 5 or 6) wherein theFCR is the FCR of milk obtained from the animal(s) that have beentreated by the method of the invention, the FCR being calculatedusing the combined weight of protein and fat in the milk.

[0092] Another method for dealing with pricing based on protein andfat, is using energy-corrected milk (ECM), which adds a factor tonormalize assuming certain amounts of fat and protein in a finalmilk product; that formula is (0.327.times.milkmass)+(12.95.times.fat mass)+(7.2.times.protein mass). In the dairyindustry, Feed Efficiency (ECM/intake) is often used instead of FCR(intake/ECM); an FE less than 1.3 is considered problematic. Thus,in an example of the invention the or each animal is a dairy cowand the FE number in the animal (or average FE of the animals) isincreased by the method to above 1.3, 1.5, 1.6, 1.7, 1.8, 1.9, 2,2.5 or 3, (and optionally no greater than 4 or 5). Optionally, theFE is increased above 1.3, 1.5, 1.6 and no greater than 1.7.

[0093] FE based simply on the weight of milk is also used; an FEbetween 1.30 and 1.70 is normal. Thus, in an example of theinvention the or each animal is a dairy cow and the FE number inthe animal (or average FE of the animals) is increased by themethod to above 1.3, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.5 or 3, (andoptionally no greater than 4 or 5). Optionally, the FE is increasedabove 1.3, 1.5, 1.6 and no greater than 1.7.

Pigs

[0094] As of 2011, pigs used commercially in the UK and Europe hadan FCR, calculated using weight gain, of about 1 as piglets andending about 3 at time of slaughter. As of 2012 in Australia andusing dressed weight for the output, a FCR calculated using weightof dressed meat of 4.5 was fair, 4.0 was considered "good", and3.8, "very good". In the US as of 2012, commercial pigs had FCRcalculated using weight gain, of 3.46 for while they weighedbetween 240 and 250 pounds, 3.65 between 250 and 260 pounds, 3.87between 260 and 270 lbs, and 4.09 between 280 and 270 lbs. Thus, inan example of the invention the or each animal is a piglet and theFCR number in the animal (or average FCR of the animals) is reducedby the method to 1 or less, the FCR being calculated using weightgain of the animal(s). Thus, in an example of the invention the oreach animal is a pig up to 3 months old and the FCR number in theanimal (or average FCR of the animals) is reduced by the method to1 or less, the FCR being calculated using weight gain of theanimal(s). Thus, in an example of the invention the or each animalis a pig greater than 3 months old, but up to 6 or 7 months' old,and the FCR number in the animal (or average FCR of the animals) isreduced by the method to 3 or less (eg, from 1 to 3), the FCR beingcalculated using weight gain of the animal(s). A piglet may be from1.5 to 3 months' of age; a pig for slaughter may be greater than 3,but up to 6 months' of age. Thus, in an example of the inventionthe or each animal is a pig whose weight is between 240 and 250pounds and the FCR number in the animal (or average FCR of theanimals) is reduced by the method to 3.5 or less (eg, 3.4 or less,but optionally no less than 3 or 2.5), the FCR being calculatedusing weight gain of the animal(s). Thus, in an example of theinvention the or each animal is a pig whose weight is between 250and 260 pounds and the FCR number in the animal (or average FCR ofthe animals) is reduced by the method to 3.7 or less (eg, 3.65 orless, but optionally no less than 3 or 3.5), the FCR beingcalculated using weight gain of the animal(s). Thus, in an exampleof the invention the or each animal is a pig whose weight isbetween 260 and 270 pounds and the FCR number in the animal (oraverage FCR of the animals) is reduced by the method to 3.9 or less(eg, 3.8 or less, but optionally no less than 3.7 or 3.5), the FCRbeing calculated using weight gain of the animal(s). Thus, in anexample of the invention the or each animal is a pig whose weightis between 280 and 270 pounds and the FCR number in the animal (oraverage FCR of the animals) is reduced by the method to 4.1 or less(eg, 4 or less, but optionally no less than 3.8 or 3.9), the FCRbeing calculated using weight gain of the animal(s).

Sheep

[0095] Some data for sheep illustrate variations in FCR. A FCR (kgfeed dry matter intake per kg live mass gain) for lambs is often inthe range of about 4 to 6. Thus, in an example of the invention theor each animal is a sheep and the FCR number in the animal (oraverage FCR of the animals) is reduced by the method to 6 or less(eg, from 4 to 6), the FCR being calculated using kg feed drymatter intake per kg live mass gain of the animal(s).

Poultry

[0096] As of 2011 in the US, broiler chickens typically have an FCRof 1.6 based on body weight gain, and mature in 39 days. At aroundthe same time the FCR based on weight gain for broilers in Brazilwas 1.8. Thus, in an example of the invention the or each animal isa poultry bird (eg, a broiler chicken) and the FCR number in theanimal (or average FCR of the animals) is reduced by the method to1.9, 1.8, 1.7, 1.6 or less (eg, from 1.9 to 1.5; or 1.8 to 1.6),the FCR being calculated based on body weight gain. Optionally, theFCR is calculated when each animal is 35-40, eg, 39 days old.

[0097] For hens used in egg production in the US, as of 2011 theFCR was about 2, with each hen laying about 330 eggs per year.Thus, in an example of the invention the or each animal is apoultry bird (eg, an egg-laying hen, eg, a chicken) and the FCRnumber in the animal (or average FCR of the animals) is reduced bythe method to 2 or less (eg, from 2 to 1.5), the FCR beingcalculated based on body weight gain. Thus, in an example of theinvention the or each animal is a poultry bird (eg, an egg-layinghen, eg, a chicken) and the number of eggs layed by the animal (oraverage number of eggs layed by the animals) is more than 330 eggsper year (or pro rated for a different period), eg, more than 340,350 or 400 eggs per year (or pro rated period).

Carnivorous Fish

[0098] The FIFO ratio (or Fish In-Fish Out ratio) is a conversionratio applied to aquaculture, where the first number is the mass ofharvested fish used to feed farmed fish, and the second number isthe mass of the resulting farmed fish. FIFO is a way of expressingthe contribution from harvested wild fish used in aquafeed comparedwith the amount of edible farmed fish, as a ratio. Fishmeal andfish oil inclusion rates in aquafeeds have shown a continualdecline over time as aquaculture grows and more feed is produced,but with a finite annual supply of fishmeal and fish oil.Calculations have shown that the overall fed aquaculture FIFOdeclined from 0.63 in 2000 to 0.33 in 2010, and 0.22 in 2015. In2015, approximately 4.55 kg of farmed fish was produced for every 1kg of wild fish harvested and used in feed. The fish used infishmeal and fish oil production are not used for humanconsumption, but with their use as fishmeal and fish oil inaquafeed they contribute to global food production. Thus, in anexample the method of the invention enhances (ie, increases) theFIFO ratio when the animal if a fish (eg, a salmon, tilapia orcatfish). For example, the FIFO is increased to 0.3, 0.4, 0.5, 0.6,0.7 or 0.8, 1, 1.5 or 2 or more. For example, the fish is a salmonor catfish and the FIFO is raised above 1, 1.5 or 2 (and optionallyno more than 2 or 2.5). For example, the fish is a talapia and theFIFO is raised above 1.5 or 2 (and optionally no more than 2 or2.5).

[0099] Enhancement of growth or weight may be an enhancement(increase) in milk production or yield, eg, an average increase fora group of the invention compared with a control group. A controlgroup may be a group of animals of the same species, with the sameaverage age, same proportion of males and females and fed on thesame diet as the group of the invention. For example, here thesubjects may be dairy cattle.

[0100] Enhancement of growth or weight may be an enhancement(increase) in egg production or yield, eg, an average increase fora group of the invention compared with a control group. A controlgroup may be a group of animals of the same species, with the sameaverage age, same proportion of males and females and fed on thesame diet as the group of the invention. For example, here thesubjects may be hen-layer chickens.

[0101] Enhancement of growth or weight may be an enhancement(increase) in meat production or yield, eg, an average increase fora group of the invention compared with a control group. A controlgroup may be a group of animals of the same species, with the sameaverage age, same proportion of males and females and fed on thesame diet as the group of the invention. For example, here thesubjects may be dairy cattle, poultry (eg, chickens), fish,shellfish, sheep or pigs.

[0102] Enhancement of growth or weight may be an enhancement(increase) in fat production or yield, eg, an average increase fora group of the invention compared with a control group. A controlgroup may be a group of animals of the same species, with the sameaverage age, same proportion of males and females and fed on thesame diet as the group of the invention. For example, here thesubjects may be dairy cattle, poultry (eg, chickens), fish (eg,salmon, talapia or catfish), shellfish, sheep or pigs.

[0103] Enhancement of growth or weight may be an enhancement(increase) in fur or hide production or yield, eg, an averageincrease for a group of the invention compared with a controlgroup. A control group may be a group of animals of the samespecies, with the same average age, same proportion of males andfemales and fed on the same diet as the group of the invention. Forexample, here the subjects may be cows.

[0104] In an example, the subject is a shellfish. The shellfish maybe selected from Shrimp, crayfish, crab, lobster, clam, scallop,oyster, prawn and mussel.

[0105] The subject may be any subject disclosed herein. The subjectmay be an animal, such as a livestock animal, eg, a bird (such as apoultry bird; or a chicken or a turkey) or swine. Alternatively,the subject may be a human, eg, a human suffering from an eatingdisorder (such as anorexia) or who is underweight, eg, wherein thehuman has a body mass index (BMI) less than 18.5, 18, 17, 16 or15.

[0106] For example, the human has mild anorexia (ie, the human hasa BMI<17.5), moderate anorexia (ie, the human has a BMI of from16 to 16.99), severe anorexia (ie, the human has a BMI of from 15to 15.99) or extreme anorexia (ie, the human has a BMI<15).

[0107] In an alternative, the subject is a plant, eg, and thetarget bacteria are plant pathogen bacteria. In an example, thetarget baceteria are Pseudomonas, eg, P. syringae or P.aeruginosa.

[0108] In an alternative, the target cells are archaeal cells. Forexample the target cells are methanobacterium cells.

[0109] For example the target cells are methanogen cells. Forexample, the target cells comprise one or more species of cellselected from: [0110] Methanobacterium bryantii [0111]Methanobacterium formicum [0112] Methanobrevibacter arboriphilicus[0113] Methanobrevibacter gottschalkii [0114] Methanobrevibacterruminantium [0115] Methanobrevibacter smithii [0116] Methanococcuschunghsingensis [0117] Methanococcus burtonii [0118] Methanococcusaeolicus [0119] Methanococcus deltae [0120] Methanococcusjannaschii [0121] Methanococcus maripaludis [0122] Methanococcusvannielii [0123] Methanocorpusculum labreanum [0124] Methanoculleusbourgensis (Methanogenium olentangyi & Methanogenium bourgense)[0125] Methanoculleus marisnigri [0126] Methanoflorensstordalenmirensis[34] [0127] Methanofollis liminatans [0128]Methanogenium cariaci [0129] Methanogenium frigidum [0130]Methanogenium organophilum [0131] Methanogenium wolfei [0132]Methanomicrobium mobile [0133] Methanopyrus kandleri [0134]Methanoregula boonei [0135] Methanosaeta concilii [0136]Methanosaeta thermophila [0137] Methanosarcina acetivorans [0138]Methanosarcina barkeri [0139] Methanosarcina mazei [0140]Methanosphaera stadtmanae [0141] Methanospirillium hungatei [0142]Methanothermobacter defluvii (Methanobacterium defluvii) [0143]Methanothermobacter thermautotrophicus (Methanobacteriumthermoautotrophicum) [0144] Methanothermobacter thermoflexus(Methanobacterium thermoflexum) [0145] Methanothermobacter wolfei(Methanobacterium wolfei) [0146] Methanothrix sochngenii

[0147] Optionally, the target cells are not pathogenic to thesubject, for example when the method is a non-medical method. In anexample, the method is a cosmetic method.

[0148] For example the target cells are methane-producing cells,and optionally the subject is a livestock animal, preferably aruminant, or a cow (eg, a beef or dairy cattle). By reducingmethane-producing cells in such animal, the invention may in oneembodiment enhance the weight of the animal (eg, enhance the yieldof meat from the animal) and/or enhance the yield of milk oranother product of the animal, such as fur or fat.

[0149] In an example, the target cells are selected from E. coli,Salmonella and Campylobacter cells. In an example, the target cellsare E. coli, Salmonella or Campylobacter cells. In an example, eachanimal is a chicken (eg, a broiler or hen-layer) and the targetcells are Salmonella or Campylobacter cells. In an example, eachanimal is a cow (eg, a beef or dairy cow) and the target cells aremehanogen cells.

[0150] In an example, the target cells are selected from Mycoplasma(eg, Mycoplasma mycoides (eg, Mycoplasma mycoides subsp. Mycoides),Mycoplasma leachii or Mycoplasma bovis), Brucella abortus, Listeriamonocytogenes, Clostridium (eg, Clostridium chauvoei or Clostridiumsepticum), Leptospira (eg, L. canicola, L. icterohaemorrhagiae, L.grippotyphosa, L. hardjo or L. Pomona), Mannheimia haemolytica,Trueperella pyogenes, Mycobacterium bovis, Campylobacter spp. (eg,Campylobacter jejuni or Campylobacter coli), Bacillus anthracis, E.coli (eg, E. coli O157:H7) or Pasteurella multocida (eg,Pasteurella multocida B:2, E:2, A:1 or A:3). In the example,optionally the subject or animal is a livestock animal, such as acow, sheep, goat or chicken (preferably a cow).

[0151] Optionally, eg, wherein the subject is an animal (eg, alivestock animal or a wild animal), the target cells are zoonoticbacterial cells, such as cells of a species selected from Bacillusanthracis, Mycobacterium bovis (eg, wherein the animal is a cow),Campylobacter spp (eg, wherein the animal is a poultry animal),Mycobacterium marinum (eg, wherein the animal is a fish), Shigatoxin-producing E. Coli (eg, wherein the animal is a ruminant),Listeria spp (eg, wherein the animal is a cow or sheep), Chlamydiaabortus (eg, wherein the animal is a sheep), Coxiella burnetii (eg,wherein the animal is a cow, sheep or goat), Salmonella spp (eg,wherein the animal is a poultry animal), Streptococcus suis (eg,wherein the animal is a pig) and Corynebacterium (eg, C. ulcerans)(eg, wherein the animal is a cow).

[0152] In an example, a plurality of carrier cells as describedherein (eg, carrier cells of any configuration, aspect, example orembodiment described herein) is administered to the subject,wherein the carrier cells comprise the DNA encoding the agent.

[0153] In an example, each animal is a chicken (eg, a broiler orhen-layer) and the target cells are Salmonella or Campylobactercells. In an example, each animal is a cow (eg, a beef or dairycow) and the target cells are mehanogen cells.

[0154] In an embodiment, therefore, there is provided:

[0155] A method (eg, a non-medical or a medical) for enhancing thegrowth or weight of a subject, wherein the method comprises theadministration of a plurality of carrier cells to the subject,wherein the subject comprises bacterial target cells and eachcarrier cell is a bacterial cell comprising a first episomal DNAencoding an antibacterial agent that is toxic to a target cell butis not toxic to the carrier cell, the carrier cell being capable ofconjugative transfer of the DNA into a target cell for expressiontherein of the agent, wherein first DNA is transferred from carriercells into target cells for expression therein to produce theantibacterial agent, thereby killing target cells in the subject orreducing the growth or proliferation of target cells and enhancinggrowth or weight of the subject.

[0156] Optionally, the target cells are Salmonella cells. In anexample, the target cells comprise S. enterica and/or S.typhimurium cells; optionally wherein the S. enterica is S.enterica subspecies enterica. Optionally, the method kills aplurality of different S. enterica subspecies enterica serovars;optionally wherein each serovar is selected from the groupconsisting of Typhimurium, Enteritidis, Virchow, Montevideo,Heidelberg, Hadar, Binza, Bredeney, Infantis, Kentucky, Seftenberg,Mbandaka, Anatum, Agona and Dublin. Optionally, the method kills S.enterica subspecies enterica serovars Typhimurium, Infantis andEnteritidis. Optionally, the method kills S. enterica subspeciesenterica serovars Typhimurium and Enteritidis. Optionally, themethod kills S. enterica subspecies enterica serovars Typhimuriumand Infantis. Optionally, the method kills S. enterica subspeciesenterica serovars Enteritidis and Infantis. The most prevalentserovars in chicken are Salmonella Enteritidis, Salmonella Infantisand Salmonella Typhimurium. In general, similar serovars ofSalmonella are found in infected humans and chicken (S. Enteritidisand S. Typhimurium). By killing Salmonella in livestock animals,the invention is useful for reducing the pool of zoonotic bacteriathat are available for transmission to humans (such as by eatingthe livestock or products made thereofrom, such as meat or dairyproducts for human consumption).

[0157] Advantageously, the carrier cells are Enterobacteriaceaecells, optionally E. coli cells. As exemplified by the Examplesbelow, the inventors have surprisingly found that (i) antibacterialagents can be efficiently transferred from such cells to Salmonellatarget cells both in vivo and in vitro; and (ii) 100% killing ofSalmonella was possible when the agent is transferred byconjugation from Enterobacteriacae cells to Salmonella cells.Furthermore, surprisingly DNA encoding a guided nucleaseantibacterial was capable of killing 18 Salmonella spp. Serotypes,including the clinically- and zoonotically-important Typhimurium,Infantis and Enteritidis. Optionally, the method kills S entericasubspecies enterica serovars Typhimurium and Enteritidis serovars.Optionally, the Enterobacteriaciae cells are cells of anEnterobacteriaciae species shown in Table 5.

[0158] Importantly, reduction of target cells was observed in theGI tract of the subject. Thus, optionally the method reduces targetcells in the gastrointestinal tract of the animal; optionally themethod reduces target cells in the jejunum, ileum, colon, liver,spleen or caecum of the animal; optionally wherein the animal is abird and the method reduces target cells in the caecum of the bird.This may be important to reduce spread of zoonotic or otherdeterimental target strains in the faeces of the subjects, such aslivestock animals. Thus, in an example the method is carried out ona group of subjects (eg, a herd or flock, such as a herd of swineor a flock of birds), wherein spread of cells of the target speciesis reduced in the group. The inventors have also demonstrated thisin a flock of poultry where Salmonella were killed using theinvention, wherein a guided nuclease was used to cut a plurality ofprotospacer sequences in target cells, thereby killing the cellsand reducing spread thereof in the flock.

[0159] Thus, in an example the method is carried out on a group(optionally a flock or herd) of animals, wherein some or all of theanimals comprise target cells, wherein spread of cells of thetarget species is reduced in the group; or wherein spread isreduced from the group to a second group of animals.

[0160] Optionally, the first DNA is comprised by a plasmid, forexample wherein the plasmid comprises a RP4 origin of transfer(oriT). The plasmid may be any type of plasmid disclosedherein.

[0161] The agent may be any antibacterial agent disclosed herein,preferably a guided nuclease that is programmed to cut one or moretarget sequences in target cells. A suitable nuclease may be aTALEN, meganuclease, zinc finger nuclease or Cas nuclease. Forexample, the agent comprises one or more components (eg, a Casnuclease and/or a guide RNA or a crRNA) of a CRISPR/Cas system thatis operable in a target cell to cut a protospacer sequencecomprised by the target cell, optionally wherein the target cellscomprise first and second strains of a bacterial species and eachstrain comprises the protospacer sequence, wherein cells of thestrains are killed. For example, the system is operable to cut atleast 3 different protospacer sequences comprised by the cellgenome. Optionally, each or some of said protospacer sequences iscomprised by a pathogenicity island that is comprised by the cell.As shown in the Examples, this is highly effective for target cellkilling. Optionally, the agent is operable to cut a plurality ofdifferent protospacer sequences comprised by the target cellgenome. Optionally, the agent comprises one or more components of aCRISPR/Cas system that is operable in a target cell to cut at least2, 3, 4, 5, 6, 7, 8, 9, or 10 different protospacer sequencescomprised by the target cell genome (eg, comprised by the targetcell chromosome).

[0162] In an embodiment, the agent [0163] (a) comprises a guidednuclease that is capable of recognising and modifying a targetnucleic acid sequence, wherein the target sequence is comprised byan endogenous chromosome or episome of the target cells but is notcomprised by the carrier cells, wherein the nuclease modifies thechromosome or episome to kill the target cells or inhibit thegrowth or proliferation of the target cells; and/or [0164] (b)encodes a guide RNA or crRNA of a CRISPR/Cas system that operateswith a Cas nuclease in the target cells to cut a protospacersequence comprised by the target cells.

[0165] There is also provided:

[0166] A carrier cell (optionally for use in a method of theinvention), wherein the cell is a bacterial cell comprising a firstepisomal DNA encoding an antibacterial agent that is toxic to abacterial target cell but is not toxic to the carrier cell, thecarrier cell being capable of conjugative transfer of the DNA intoa target cell for expression therein of the antibacterial agent,hereby killing the target cell, wherein the target cell is aSalmonella cell and the carrier cell is an Enterobacteriaceaecell.

[0167] There is also provided:

[0168] A composition comprising a plurality of carrier cells foruse in a method comprising administration of the cells to a subjectto treat an infection by pathogenic bacterial target cells, whereineach carrier cell is a bacterial cell comprising a first episomalDNA encoding an antibacterial agent that is toxic to a target cellbut is not toxic to the carrier cell, the carrier cell beingcapable of conjugative transfer of the DNA into a target cell forexpression therein of the agent, wherein first DNA is transferredfrom carrier cells into target cells for expression therein toproduce the antibacterial agent, thereby killing target cells inthe subject or reducing the growth or proliferation of targetcells, wherein the target cells are Salmonella cells and thecarrier cells are Enterobacteriaceae cells. In an alternative, themethod treats or reduces a symptom of an infection by pathogenictarget cells.

[0169] Any administration of cells to a subject herein may be byoral administration. Any administration of cells to a subjectherein may preferably be by administration to the GI tract. Anyadministration of cells to a subject herein may be by systemic,intranasal or inhaled administration.

[0170] There is also provided:

[0171] A non-medical method of killing zoonotic bacterial targetcells in an animal, the method comprising administering to theanimal a plurality of carrier cells, wherein each carrier cell is abacterial cell comprising a first episomal DNA encoding anantibacterial agent that is toxic to a target cell but is not toxicto the carrier cell, the carrier cell being capable of conjugativetransfer of the DNA into a target cell for expression therein ofthe agent, wherein first DNA is transferred from carrier cells intotarget cells for expression therein to produce the antibacterialagent, thereby killing target cells in the subject or reducing thegrowth or proliferation of target cells, wherein the target cellsare Salmonella cells and optionally the carrier cells areEnterobacteriaceae cells.

[0172] The animal may be any animal disclosed herein, eg, alivestock animal, domesticated animal or wild animal (eg, a bat orbird)).

[0173] Optionally, any method herein reduces Salmonella in thegastrointestinal tract of the subject.

[0174] Optionally, the target cells comprise different Salmonellaspp. types that are killed.

[0175] In any aspect, configuration, example, concept orembodiment, the carrier cell, target cell(s) or DNA is respectivelya carrier cell, target cell(s) or DNA as defined in any otheraspect, configuration, example, concept or embodiment.

[0176] The invention also provides:

[0177] A DNA, wherein the DNA is capable of being introduced into atarget cell, wherein the DNA encodes a plurality of guide RNAs orcrRNAs of a CRISPR/Cas system wherein the guide RNAs or crRNAs areoperable with Cas nuclease in the target cell to recognise aplurality of protospacer sequences comprised by the target cellgenome, optionally wherein the target cell is a Salmonella cell ora cell of a species disclosed in Table 5; and [0178] (a) theprotospacer sequences comprise one or more pathogenic islandnucleotide sequences of the target cell genome; [0179] (b) theprotospacer sequences comprise one or more invasion gene sequencesof the target cell genome; [0180] (c) the protospacer sequencescomprise one or more secretion system gene sequences of the targetcell genome; and/or [0181] (d) the protospacer sequences compriseone or more nucleotide sequences of genes selected from avrA, sptP,sicP, sipA, sipD, sipC, sipB, sicA, invB, ssaE, sseA, sseB, sscA,sseC, sseD, sseE, sscB, sseF, sseG, mgtC, cigR, pipA, pipB, pipC,sopB and pipD (optionally selected from invB, sicP, sseE, pipA,pipB, pipC, hilA, marT and sopB) of Salmonella (eg, S. enterica) ororthologues or homologues of said genes.

[0182] Homologue: A gene, nucleotide or protein sequence related toa second gene, nucleotide or protein sequence by descent from acommon ancestral DNA or protein sequence. The term, homologue, mayapply to the relationship between genes separated by the event ofor to the relationship between genes separated by the event ofgenetic duplication.

[0183] Orthologue: Orthologues are genes, nucleotide or proteinsequences in different species that evolved from a common ancestralgene, nucleotide or protein sequence by speciation. Normally,orthologues retain the same function in the course ofevolution.

[0184] By "orthologues or homologues of said genes" it is meantthat a protospacer may be a sequence comprised by a gene of thetarget cell genome, wherein the gene is an orthologue or homologueof a Salmonella gene selected from avrA, sptP, sicP, sipA, sipD,sipC, sipB, sicA, invB, ssaE, sseA, sseB, sscA, sseC, sseD, sseE,sscB, sseF, sseG, mgtC, cigR, pipA, pipB, pipC, sopB and pipD(optionally selected from invB, sicP, sseE, pipA, pipB, pipC, hilA,marT and sopB).

[0185] Optionally the DNA is the first DNA for use in the method ofthe invention. Preferably, the target cell is a Salmonella cell,eg, a S. enterica cell, such as a Salmonella enterica subsp.enterica serovar Enteritidis cell.

[0186] Optionally any Salmonella herein is Salmonella entericasubsp. enterica serovar Typhimurium str. LT2.

[0187] Optionally, the target cell is a cell of a species disclosedin Table 5 other than a Salmonella species and the sequences of (d)are sequences of genes selected from orthologues or homologues ofavrA, sptP, sicP, sipA, sipD, sipC, sipB, sicA, invB, ssaE, sseA,sseB, sscA, sseC, sseD, sseE, sscB, sseF, sseG, mgtC, cigR, pipA,pipB, pipC, sopB and pipD (optionally selected from invB, sicP,sseE, pipA, pipB, pipC, hilA, marT and sopB).

[0188] of Salmonella (eg, S. enterica).

[0189] The DNA may comprise one or more CRISPR spacers, whereineach spacer consists of a nucleotide sequence of a secretion systemgene (optionally a type III protein secretion system or a secretionsystem of SPI-1 or SPI-2 of Salmonella); or a T3SS locus gene; orwith up to 10, 9, 8, 7, 6, 5, 4, 3 or 2 nucleotide differencestherefrom.

[0190] Optionally, the DNA (eg, DNA of the carrier cell) encodes aplurality of guide RNAs or crRNAs of a CRISPR/Cas system whereinthe guide RNAs or crRNAs are operable with Cas nuclease in thetarget cell to recognise a plurality of protospacer sequencescomprised by the target cell genome, wherein the target cell is aSalmonella cell and the protospacer sequences comprise one or morenucleotide sequences of genes selected from invB, sicP and sseE.For example, the protospacer sequences comprise nucleotidesequences of genes invB, sicP and sseE. In an example, the DNA alsoencodes a Cas, eg, a Cas9, Cas3, Cpf1, Cas12, Cas13, CasX or CasY.In an embodiment, the Cas is a Type I, II, III, IV, V or VI Cas,preferably a Type I or II Cas. In an example, the DNA also encodesa Cas3 and cognate Cascade proteins (eg, CasA, B, C, D and E).Optionally, the Cas (and Cascade of present) are E. coli Cas (andCascade).

[0191] Optionally, the gene of the target cell encodes a chaperoneor secreted effector protein, eg, such a protein encoded by apathogenicity island or type III protein secretion system(optionally a T3SS locus, such as a secretion system of SPI-1 andSPI-2 of Salmonella).

[0192] The DNA may comprise one or more CRISPR spacers, whereineach spacer consists of 20-40, 25-35, or 30-35 consecutivenucleotides of a gene comprised by the genome of the target cell;eg, [0193] (a) a gene selected from avrA, sptP, sicP, sipA, sipD,sipC, sipB, sicA, invB, ssaE, sseA, sseB, sscA, sseC, sseD, sseE,sscB, sseF, sseG, mgtC, cigR, pipA, pipB, pipC, sopB and pipD ofSalmonella or a homologue or orthologue thereof; [0194] (b) a genecomprised by a pathogenicity island that is comprised by the targetcell genome; [0195] (c) a secretion system (eg, a type III proteinsecretion system) gene comprised by the target cell genome

[0196] Optionally, the DNA is comprised by a plasmid whichcomprises an origin of transfer (oriT) and an origin of replication(oriV) that is operable for replication of the DNA in a bacterialhost cell.

[0197] Optionally, the first DNA is comprised by a plasmid, whereinthe plasmid comprises a RP4 origin of transfer (oriT) and/or a p15Aorigin of replication.

[0198] Optionally, the DNA comprises SEQ ID NO: 15, optionallywherein the DNA is comprised by a plasmid in a carrier bacterialcell for conjugation to a Salmonella target cell. In an example,the DNA of the invention is comprised by a conjugative plasmid orphagemid.

[0199] In an example, the DNA comprises CRISPR repeat and spacersequences, wherein [0200] (e) the repeat sequences each compriseSEQ ID NO: 16; and/or [0201] (f) the spacer sequences comprise one,two or three sequences selected from SEQ ID NOs: 17-19 andcomplement sequences thereof; optionally wherein the DNA iscomprised by a plasmid in a carrier bacterial cell for conjugationto a Salmonella target cell.

[0202] Optionally, the DNA comprises (optionally in 5' to 3' order)SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19. Optionally, the DNAcomprises one or more (eg, at least 3) spacer sequences shown inTable 6.

[0203] In an example, the DNA encodes a Cas3 and optionally one ormore Cascade proteins (eg, one or more of CasA, B, C, D and E). Inan embodiment, the first DNA encodes a Cas3 and CasA, B, C, D andE. In an embodiment, the first DNA encodes an E. coli Cas3 andCasA, B, C, D and E. Optionally, the guided nuclease (eg, Cas3) isa Type I-A, -B, -C, -D, -E, -F or -U Cas.

[0204] In an example, the agent in any configuration, example,option or embodiment herein, the agent comprises one or morecomponents of a CRISPR/Cas system that is operable in the targetcell to cut a protospacer sequence comprised by the targetcell.

[0205] In an example, the system is operable to cut at least 3different protospacer sequences comprised by the target cellgenome. In an embodiment, each or some of said protospacersequences is comprised by a pathogenicity island that is comprisedby the target cell.

[0206] In an example, the agent in any configuration, example,option or embodiment herein [0207] (a) comprises a guided nucleasethat is capable of recognising and modifying a target nucleic acidsequence, wherein the target sequence is comprised by an endogenouschromosome or episome of the target cells but is not comprised bythe carrier cells, wherein the nuclease modifies the chromosome orepisome to kill the target cells or inhibit the growth orproliferation of the target cells; and/or [0208] (b) encodes aguide RNA or crRNA of a CRISPR/Cas system that operates with a Casnuclease in the target cell to cut a protospacer sequence comprisedby the target cell.

[0209] Optionally, the DNA comprises a constitutive promoter forexpression of the guide RNAs or crRNAs. Optionally, the DNAcomprises a constitutive promoter for expression of a Cas nucleasethat is operable in a target cell with the guide RNAs or crRNAs tomodify (eg, cut) protospacer sequences of the target cellgenome.

[0210] Optionally, the Cas, Cascade proteins, gRNAs and crRNAs areE. coli K12 (MG1655) Cas, Cascade proteins, gRNAs and crRNAsrespectively. Optionally, the DNA is devoid of nucleotide sequencesencoding Cas1 and Cas2 proteins.

[0211] The invention also relates to carrier bacteria encodingdesired protein or RNA (eg, encoding an antimicrobial agent) andmethods of use. In embodiments, the agent can be transferred intotarget cells by conjugation between carrier cells (to which theagent is not toxic) and the target cells, whereby the agent istoxic to the target cells and kills the target cells. In otherembodiments, the growth or proliferation of target cells is reduced(eg, by at least 40, 50, 60, 70, 80, or 90% compared to growth inthe absence of the agent). Each carrier cell comprises episomal DNAencoding an antibacterial agent that is toxic to a target bacterialcell but is not toxic (or is less toxic) to the carrier cell. Theinvention finds application, for example, in controlling or killingtarget bacteria that are pathogenic to humans, animals or plants.The invention finds application, for example, in controlling orkilling zoonotic target bacteria comprised by an animal (eg, alivestock animal). For example, the carrier cells may be comprisedby a medicament for treating or preventing a disease or conditionin a human or animal; a growth promoting agent for administrationto animals for promoting growth thereof; killing zoonositicbacteria in the animals; for administration to livestock as apesticide; a pesticide to be applied to plants; or a plantfertilizer.

[0212] An advantage of the invention is that the carrier cells maybe used as producer cells in which DNA encoding the antibacterialagent can be replicated. Another advantage of an example of theinvention is that further replication of the DNA can be avoided intarget cells that do not comprise one or more factors that arerequired for such replication. Thus, a scheme can be envisagedwherein the factor(s) are present in the carrier cells (and DNAencoding the agent is replicated to provide many copies forsubsequent conjugative transfer into target cells) and in thetarget cells the DNA is not further replicated, which is useful forcontaining the action of the antibacterial agent, such as inenvironments or in a human or animal body or in (or on) a plant aContainment may be required to avoid undesired killing ofnon-target cells or to provide control generally over dosing and/orthe administration of the killing activity regime.

[0213] The first DNA is replicable in the carrier cell (but not inthe target cell), in which case it is important that the agent isnot toxic to the carrier cell, whilst it is toxic to the targetcell. In certain embodiments, the invention uses sequence-specifickilling of the target cell to achieve this selectivity.

[0214] To this end, in an example the first DNA encodes a guidednuclease that is operable in the target cell to recognize and cut atarget sequence of a target cell chromosome, thereby killing thecell or wherein the growth or proliferation of the cell is reduced.This is advantageous over the use of other types of toxic agent,which are less discriminate in their action, being able to killseveral species or strain (eg, potentially also being toxic to thecarrier cell to some degree). By using a guided nuclease (eg, aTALEN or Cas nuclease), these can be programmed to recognize atarget sequence that is present in the target cell genome (eg,comprised by a chromosome or episome of the target cell), but isabsent in the genome of the carrier cell.

[0215] Thus, in this case replication of the first DNA can freelyhappen in the carrier cell without risk of killing the cell orreducing its growth or proliferation due to the encoded agent andreplication of sequences encoding the agent. Thus, in an example,where the first DNA encodes a guided nuclease, the guided nucleaseis capable of recognizing and cutting a target nucleic acidsequence comprised by the genome (eg, chromosome) of the targetcell, wherein the target cell is absent in the carrier cell.

[0216] A particularly useful example is where the first DNA encodesa Cas nuclease (eg, a Cas9 or Cas3) that is operable with a guideRNA or crRNA in the target cell, wherein the RNA is operable toguide the Cas to the target sequence, wherein the Cas modifies (eg,cuts) the target sequence and the target cell is killed or targetcell growth or proliferation is inhibited. In one embodiment, thefirst DNA encodes the Cas and the guide RNA or crRNA. In anotherembodiment, the first DNA encodes the guide RNA or crRNA, but doesnot encode a cognate Cas. In this embodiment, the RNA is operablein the target cell with an endogenous Cas encoded by the targetcell genome, wherein the RNA is operable to guide the Cas to thetarget sequence, wherein the Cas modifies (eg, cuts) the targetsequence and the target cell is killed or target cell growth orproliferation is inhibited. In this se sense, the agent maycomprise a component of a CRISPR/Cas system (eg, a Cas nuclease,Cascade Cas, crRNA, guide RNA or tracrRNA). Thus, the inventionusefully recognizes the benefit of using antibacterial agents thatact by target recognition in the target cell but not in the carriercell, which opens up the ability for the first DNA to freelyreplicated in the carrier cell without significant toxicity to thecarrier cell.

Example Plasmids

[0217] A method of delivery of any agent, such as a CRISPR-Cassystem (or a component thereof) can be by bacterial conjugation, anatural process whereby a donor bacterium transfers DNA from itselfto a recipient bacterium. Donor bacteria elaborate a surfacestructure, the pilus which can be considered to be like a syringeor drinking straw through which the DNA is delivered. The donorpilus binds to the surface of a receptive recipient and this eventtriggers the process of DNA transfer. Plasmids are suitable forthis conjugative process, where the plasmid comprises DNA encodingthe agent of the invention.

[0218] DNA transfer by conjugation may only take place with a`susceptible recipient` but does not generally occur with arecipient carrying a similar type of plasmid. Because conjugationis via pilus bridge, it is possible for that bridge to attachitself not to a recipient but to the donor bacterium. This couldresult in a futile cycle of transfer of the plasmid DNA to itself.Plasmids thus naturally encode incompatibility factors. One is asurface arrayed protein that prevents the pilus binding tobacterium displaying that surface protein such as itself or anyother bacterium carrying the same plasmid. Additionally, plasmidsnaturally encode another incompatibility system that closelyregulates the copy number of the plasmid inside a bacterium. Thus,should a conjugation event manage to evade surface exclusion andstart to transfer DNA by conjugation, the recipient will preventthat plasmid establishing as it already maintains the current copynumber and will not accept and maintain a further unwantedadditional copy.

[0219] In an example of the invention, the DNA encoding the agentis comprised by a plasmid. In an embodiment, the plasmid is amember of a plasmid incompatibility group, wherein the target celldoes not comprise a plasmid of said group. Optionally, the plasmidof the invention is a member of the incompatibility group P (ie,the plasmid is an incP plasmid). Salmonella very rarely carry incPplasmids, so this incP plasmid is useful where the target cell is aSalmonella cell. For example within the Enterobacteriaceae thefollowing is a non-exclusive list of potential plasmids that coulduse for delivery: IncFI, IncFII, IncFIII, IncFIV, IncFV, IncM,Inc9, InclO, Incl, IncA, IncB, IncC, IncH, Incla, InclIc, IncI2,Incly, IncJ, IncL, IncN, Inc2e, IncO, IncP, IncS, IncT and/or IncW.Thus, optionally, the target cell is an Enterobacteriaceae cell andthe DNA of the invention is comprised by a plasmid, wherein theplasmid is selected from an IncFI, IncFII, IncFIII, IncFIV, IncFV,IncM, Inc9, InclO, Incl, IncA, IncB, IncC, IncH, Incla, InclIc,IncI2, Incly, IncJ, IncL, IncN, Inc2e, IncO, IncP, IncS, IncT andIncW plasmid.

[0220] In an example, the carrier cell of the invention comprisestwo or more plasmids, each plasmid comprising a DNA of theinvention that encodes an antibacterial agent, wherein a first ofsaid plasmids is a member of a first incompatibility group, whereinthe target cell does not comprise a plasmid of said first group,and wherein a second of said plasmids is a member of a secondincompatibility group, wherein the target cell does not comprise aplasmid of said second group. For example, a carrier cell maycomprise an incP plasmid encoding an anti-target cell CRISPR-Cassystem or a component thereof (eg, encoding a first crRNA or guideRNA that targets a first protospacer sequence of the target cellgenome) and wherein the carrier cell further comprises an incF1plasmid encoding an anti-target cell CRISPR-Cas system or acomponent thereof (eg, encoding a second crRNA or guide RNA thattargets a second protospacer sequence of the target cell genome),the protospacers comprising different nucleotide sequences. Forexample, the protospacers are comprised by different genes of thetarget cell genome. For example the protospacers are comprised byone or more pathogenicity islands of the target cell genome.Optionally, the target cell is an Enterobacteriaceae cell.Optionally, the carrier cell comprises a group of plasmidscomprising 2, 3, 4, 5, 6 or more different types of plasmid,wherein each plasmid is capable of being conjugatively transferredinto a target cell, wherein the plasmids encode different agents ordifferent components of an antibacterial agent. For example, theplasmids encode different cRNAs or gRNAs that target differentprotospacers comprised by the target cell genome. For example, thegroup of plasmids comprises up to n different types of plasmid,wherein the plasmids are members of up to n differentincompatibility groups, eg, groups selected from IncFI, IncFII,IncFII, IncFIV, IncFV, IncM, Inc9, InclO, Incl, IncA, IncB, IncC,IncH, IncIa, InclIc, IncI2, Incly, IncJ, IncL, IncN, Inc2e, IncO,IncP, IncS, IncT and IncW. For example, n=2, 3, 4, 5, 6, 7, 8, 9 or10.

[0221] For example, the carrier cell comprises (i) a first plasmidthat encodes a first type of CRISPR/Cas system that targets a firstprotospacer comprised by the target cell genome, or encodes acomponent of said system; and (ii) a second plasmid that encodes asecond type of CRISPR/Cas system that targets a second protospacercomprised by the target cell genome, or encodes a component of saidsystem, wherein the first and second types are different. Forexample, the first type is a Type I system, and the second type isa Type II system (eg, the first plasmid encodes a Cas3, Cascade anda crRNA or guide RNA that is operable with the Cas3 and Cascade inthe target cell to modify the first protospacer; and the secondplasmid encodes a Cas9 and a crRNA or guide RNA that is operablewith the Cas9 in the target cell to modify the second protospacer).In an alternative, the Cas3 and Cascade are encoded by anendogenous target cell gene, wherein the first plasmid encodes thecrRNA or guide RNA that is operable with the endogenous Cas3 andCascade in the target cell to modify the first protospacer. In analternative, the Cas9 is encoded by an endogenous target cell gene,wherein the second plasmid encodes the crRNA or guide RNA that isoperable with the endogenous Cas9 in the target cell to modify thesecond protospacer. Optionally, the Cas3 and Cascade are encoded byendogenous genes of the target cell and the Cas9 is encoded by thesecond plasmid.

[0222] Instead of a Type I and Type II system, the inventionalternatively provides in an embodiment a first plasmid encoding aType I CRISPR/Cas system (or component thereof, eg, a Cas3 or acrRNA or a gRNA) and a second plasmid encoding a Type IIICRISPR/Cas system (or a component thereof). Instead of a Type I andType II system, the invention alternatively provides in anembodiment a first plasmid encoding a Type I CRISPR/Cas system (orcomponent thereof) and a second plasmid encoding a Type IVCRISPR/Cas system (or a component thereof). Instead of a Type I andType II system, the invention alternatively provides in anembodiment a first plasmid encoding a Type I CRISPR/Cas system (orcomponent thereof) and a second plasmid encoding a Type VCRISPR/Cas system (or a component thereof). Instead of a Type I andType II system, the invention alternatively provides in anembodiment a first plasmid encoding a Type I CRISPR/Cas system (orcomponent thereof) and a second plasmid encoding a Type VICRISPR/Cas system (or a component thereof).

[0223] Instead of a Type I and Type II system, the inventionalternatively provides in an embodiment a first plasmid encoding aType II CRISPR/Cas system (or component thereof, eg, a Cas9 or acrRNA or a gRNA) and a second plasmid encoding a Type IIICRISPR/Cas system (or a component thereof). Instead of a Type I andType II system, the invention alternatively provides in anembodiment a first plasmid encoding a Type II CRISPR/Cas system (orcomponent thereof) and a second plasmid encoding a Type IVCRISPR/Cas system (or a component thereof). Instead of a Type I andType II system, the invention alternatively provides in anembodiment a first plasmid encoding a Type II CRISPR/Cas system (orcomponent thereof) and a second plasmid encoding a Type VCRISPR/Cas system (or a component thereof). Instead of a Type I andType II system, the invention alternatively provides in anembodiment a first plasmid encoding a Type II CRISPR/Cas system (orcomponent thereof) and a second plasmid encoding a Type VICRISPR/Cas system (or a component thereof).

[0224] Instead of a Type I and Type II system, the inventionalternatively provides in an embodiment a first plasmid encoding aType V CRISPR/Cas system (or component thereof, eg, a Cas12a or acrRNA) and a second plasmid encoding a Type III CRISPR/Cas system(or a component thereof). Instead of a Type I and Type II system,the invention alternatively provides in an embodiment a firstplasmid encoding a Type V CRISPR/Cas system (or component thereof)and a second plasmid encoding a Type IV CRISPR/Cas system (or acomponent thereof). Instead of a Type I and Type II system, theinvention alternatively provides in an embodiment a first plasmidencoding a Type V CRISPR/Cas system (or component thereof) and asecond plasmid encoding a Type V CRISPR/Cas system (or a componentthereof). Instead of a Type I and Type II system, the inventionalternatively provides in an embodiment a first plasmid encoding aType V CRISPR/Cas system (or component thereof) and a secondplasmid encoding a Type VI CRISPR/Cas system (or a componentthereof).

[0225] Instead of a Type I and Type II system, the inventionalternatively provides in an embodiment first and second plasmids,each encoding a Type I CRISPR/Cas system (or a component thereof).Instead of a Type I and Type II system, the invention alternativelyprovides in an embodiment first and second plasmids, each encodinga Type II CRISPR/Cas system (or a component thereof). Instead of aType I and Type II system, the invention alternatively provides inan embodiment first and second plasmids, each encoding a Type IIICRISPR/Cas system (or a component thereof). Instead of a Type I andType II system, the invention alternatively provides in anembodiment first and second plasmids, each encoding a Type IVCRISPR/Cas system (or a component thereof). Instead of a Type I andType II system, the invention alternatively provides in anembodiment first and second plasmids, each encoding a Type VCRISPR/Cas system (or a component thereof). Instead of a Type I andType II system, the invention alternatively provides in anembodiment first and second plasmids, each encoding a Type VICRISPR/Cas system (or a component thereof).

[0226] Optionally, the plasmids are members of differentincompatibility groups, eg, groups selected from IncFI, IncFII,IncFIII, IncFIV, IncFV, IncM, Inc9, InclO, Incl, IncA, IncB, IncC,IncH, IncIa, InclIc, IncI2, Incly, IncJ, IncL, IncN, Inc2e, IncO,IncP, IncS, IncT and IncW. In an example here, the target cell isan Enterobacteriaceae cell.

Embodiments

[0227] Thus, by way of example the invention provides the followingEmbodiments. [0228] 1. A carrier bacterial cell comprising a firstepisomal DNA, the DNA comprising a nucleic acid of interest (NSI)that encodes a protein of interest (POI) or RNA of interest (ROI)for expressing the POI or ROI in a target bacterial cell, thecarrier cell being capable of conjugative transfer of the DNA intothe target cell for expression therein of the POI, ROI or agent,wherein [0229] (a) the carrier cell comprises a second DNA which isdifferent from the first DNA, wherein the second DNA comprises orencodes a first factor required for replication of the first DNA;[0230] (b) the first DNA does not comprise or encode said firstfactor, wherein the first DNA is non-self-replicative in theabsence of the first factor, but is able to replicate in thecarrier cell in the presence of the first factor provided by thesecond DNA; [0231] (c) wherein the carrier cell comprises genesencoding one or more conjugation factors sufficient to carry outconjugative transfer of the first DNA into a target bacterialcell.

[0232] In a first alternative, Embodiment 1 provides:--

[0233] A carrier bacterial cell comprising a first episomal DNA,the DNA comprising a nucleic acid of interest (NSI) that encodes aprotein of interest (POI) or RNA of interest (ROI) for expressingthe POI or ROI in a target bacterial cell, the carrier cell beingcapable of conjugative transfer of the DNA into the target cell forexpression therein of the POI or ROI.

[0234] In a second alternative, Embodiment 1 provides:--

[0235] A carrier bacterial cell comprising a first episomal DNA,the DNA encoding an antibacterial agent that is toxic to a targetbacterial cell but is not toxic to the carrier cell, the carriercell being capable of conjugative transfer of the DNA into thetarget cell for expression therein of the agent.

[0236] In an example, the agent comprises a guided nuclease that iscapable of recognizing and cutting a target nucleic acid sequencecomprised by the target cell genome, wherein the target sequence isnot comprised by the carrier cell. In this sense, therefore, theantibacterial agent is toxic to a target bacterial cell but is nottoxic to the carrier cell.

[0237] For example, there is provided:--

[0238] A carrier bacterial cell comprising a first episomal DNA,the DNA encoding an antibacterial agent that is toxic to a targetbacterial cell but is not toxic to the carrier cell, the carriercell being capable of conjugative transfer of the DNA into thetarget cell for expression therein of the agent, wherein the agentis a component of a CRISPR/Cas system that is operable in thetarget cell to modify a target nucleic acid sequence comprised bythe target cell genome (eg, comprised by the target cellchromosome).

[0239] Another example provides:--

[0240] A carrier bacterial cell comprising a first episomal DNA,the DNA encoding an antibacterial agent that is toxic to a targetbacterial cell but is not toxic to the carrier cell, the carriercell being capable of conjugative transfer of the DNA into thetarget cell for expression therein of the agent, wherein [0241] (a)the carrier cell comprises a second DNA which is different from thefirst DNA, wherein the second DNA comprises or encodes a firstfactor required for replication of the first DNA; [0242] (b) thefirst DNA does not comprise or encode said first factor, whereinthe first DNA is non-self-replicative in the absence of the firstfactor, but is able to replicate in the carrier cell in thepresence of the first factor provided by the second DNA; [0243] (c)wherein the carrier cell comprises genes encoding one or moreconjugation factors sufficient to carry out conjugative transfer ofthe first DNA into a target bacterial cell.

[0244] An example also provides:--

[0245] A carrier bacterial cell comprising a plasmid comprising afirst DNA, the DNA encoding a guided nuclease that is capable ofrecognising and modifying a target nucleic acid sequence, thecarrier cell being capable of conjugative transfer of the plasmidinto the target cell for expression therein of the nuclease,wherein the target sequence is comprised by an endogenouschromosome or episome of the target cell but is not comprised bythe carrier cell, wherein the nuclease is capable of modifying (eg,cutting) the chromosome or episome to kill the target cell orinhibit the growth or proliferation of the target cell.

[0246] Optionally, the nuclease is a Cas nuclease, meganuclease,zinc finger nuclease or TALEN.

[0247] Optionally, the nuclease is a Cas nuclease of a Type I, II,III, IV or V CRISPR system.

[0248] An example also provides:--

[0249] A carrier bacterial cell comprising a plasmid comprising afirst DNA, the DNA encoding a component of a CRISPR/Cas system thatis capable of recognising and modifying a target nucleic acidsequence, the carrier cell being capable of conjugative transfer ofthe plasmid into the target cell for expression therein of thecomponent, whereby the expressed component forms part of a saidsystem in the target cell, wherein the target sequence is comprisedby an endogenous chromosome or episome of the target cell but isnot comprised by the carrier cell, wherein the system is capable ofmodifying (eg, cutting) the chromosome or episome to kill thetarget cell or inhibit the growth or proliferation of the targetcell.

[0250] In an aspect, the component is a guide RNA or crRNA that iscapable of hybridising to the target sequence of the target cell.They system may be a Type I, II, III, IV or V CRISPR system.

[0251] Optionally, [0252] (a) the carrier cell comprises a secondDNA which is different from the first DNA, wherein the second DNAcomprises or encodes a first factor required for replication of thefirst DNA; [0253] (b) the first DNA does not comprise or encodesaid first factor, wherein the first DNA is non-self-replicative inthe absence of the first factor, but is able to replicate in thecarrier cell in the presence of the first factor provided by thesecond DNA; [0254] (c) wherein the carrier cell comprises genesencoding one or more conjugation factors sufficient to carry outconjugative transfer of the first DNA into a target bacterialcell.

[0255] The second DNA may be comprised by a chromosome or episome(eg, plasmid) of the carrier cell. Any method of the invention mayuse carrier cell(s) of any of these examples. Advantageously, thecell is for treating or preventing a target cell infection in ahuman or an animal subject (eg, a chicken, cow, pig, fish orshellfish). Advantageously, the carrier cell is a cell of a speciesthat is probiotic to said subject or is probioitic to humans oranimals (eg, chickens). For example, the carrier cell is aprobiotic E. coli cell. For example, the carrier cell is aprobiotic Bacillus cell. In an example, the target cell is a cellof a species that is pathogenic to said subject, or is pathogenicto humans or aniumals (eg, chickens). Advantageously, the first DNAencodes one or more guide RNAs or one or more crRNAs that arecapable of hybridizing in the target cell to respective targetnucleic acid sequence(s), wherein the target sequence(s) arecomprised by an endogenous chromosome and/or endogenous episome ofthe target cell. For example, the first DNA encodes 2, 3, 4, 5, 6,7, 7, 9, or 10 (or more than 10) different gRNAs or differentcrRNAs that hybridise to a respective target sequence, wherein thetarget sequences are different from each other. For example, 3different gRNAs or crRNAs are encoded by the first DNA. Forexample, 2 different gRNAs or crRNAs are encoded by the first DNA.For example, 3 different gRNAs or crRNAs are encoded by the firstDNA. For example, 4 different gRNAs or crRNAs are encoded by thefirst DNA. For example, 3 different gRNAs or crRNAs are encoded bythe first DNA. For example, 5 different gRNAs or crRNAs are encodedby the first DNA. For example, 6 different gRNAs or crRNAs areencoded by the first DNA. For example, 7 different gRNAs or crRNAsare encoded by the first DNA. For example, 8 different gRNAs orcrRNAs are encoded by the first DNA. For example, 9 different gRNAsor crRNAs are encoded by the first DNA. For example, 10 differentgRNAs or crRNAs are encoded by the first DNA. For example, 11different gRNAs or crRNAs are encoded by the first DNA. Forexample, 12 different gRNAs or crRNAs are encoded by the first DNA.For example, 13 different gRNAs or crRNAs are encoded by the firstDNA. In an example, the target cells are Salmonella cells (eg,wherein the subject is a chicken). In an example, the target cellsare E. coli cells. In an example, the target cells areCampylobacter cells (eg, wherein the subject is a chicken). In anexample, the target cells are Edwardsiella cells (eg, wherein thesubject is a fish or shellfish, eg, a catfish or a shrimp orprawn). In an example, the target cells are E. coli cells.

[0256] In an alternative herein, the carrier and target cells arearchaeal cells. In an alternative herein, the carrier and targetcells are yeast cells and "conjugation" is to be read instead asreferring to yeast "mating" and, eg, the second DNA is comprised bya chromosome of the carrier yeast cell.

[0257] In a preferred example, the NOI encodes an antibacterialagent that is toxic to a target bacterial cell but is not toxic tothe carrier cell. In an example, the POI is an antibiotic agent, anantibody, an antibody chain or an antibody variable domain. In anexample, the ROI is a guide RNA or a crRNA that is operable in thetarget cell with a cognate Cas (eg, a Cas nuclease to target andcut a protospacer sequence comprised by a chromosome or episome ofthe target cell). In an example the RNA is a siRNA that is capableof hybridizing to an endogenous target nucleic acid sequence of thetarget cell to silence transcription and/or translationthereof.

[0258] The the carrier cell comprises a chromosome or secondepisomal DNA which is different from the first DNA. Thus, forexample the second DNA is comprised by a chromosome of the carriercell. In an other example, the second DNA is comprised by a plasmidof the carrier cell. [0259] 2. The carrier cell of Embodiment 1,wherein [0260] (d) the first DNA is devoid of a component requiredfor conjugative transfer of the first DNA into a target bacterialcell; and [0261] (e) the carrier cell comprises said component,wherein the component is comprised by or encoded by the second DNAor a third DNA comprised by the carrier cell.

[0262] The third DNA may be comprised by a chromosome or episome(eg, plasmid). Where explicitly recited in Embodiments 2 onwards,the component is referring to the component required forconjugative transfer, as the context makes clear. [0263] 3. Thecarrier cell of Embodiment 2, wherein the component is comprised bya Mpf or Dtr module. For example, the module is a RK2, RP4 or R6Ktra module. Optionally, the component is comprised by a Mpf (matingpair formation) module, eg, a RK2 or RP4 tra1 module or a homologuethereof. Optionally, the component is comprised by a Dtr(DNA-transfer replication) module, eg, a RK2 or RP4 tra2 module ora homologue thereof. [0264] 4. The carrier cell of Embodiment 2,wherein the component is encoded by an operon of a Mpf (eg, tra1)or Dtr (eg, tra2) module.

[0265] For example, the module is a RK2, RP4 or R6K tra module.Optionally, the module is a Mpf (mating pair formation) module, eg,a RK2 or RP4 tra1 module or a homologue thereof. Optionally, themodule is a Dtr (DNA-transfer replication) module, eg, a RK2 or RP4tra2 module or a homologue thereof.

[0266] The Mpf operon of RP4 or RK2 is the tra2 operon (comprisingthe trb genes trbBCDEFGHIJKL) together with gene traF. The genetraF is comprised in RK2 or RP4 in a tra1 operon (along withtraJXIHG). Thus, in an embodiment, the component is a gene selectedfrom trbB, trbC, trbD, trbE, trbF, trbG, trbH, trbI, trbJ, trbK,trbL and traF. In an embodiment the first DNA is devoid of two ormore genes selected from RP4 trbB, trbC, trbD, trbE, trbF, trbG,trbH, trbI, trbJ, trbK, trbL and traF or homologues thereof. In anembodiment the first DNA is devoid of two or more genes selectedfrom RK2 trbB, trbC, trbD, trbE, trbF, trbG, trbH, trbI, trbJ,trbK, trbL and traF or homologues thereof. In an example, thecomponent is a traK, traL or traM gene. In an embodiment the firstDNA is devoid of two or more genes selected from RP4 traK, traL andtraM or homologues thereof. In an embodiment the first DNA isdevoid of two or more genes selected from RK2 traK, traL and traMor homologues thereof. Optionally, in these embodiments the firstDNA is comprised by a RP4 or RK2-type plasmid.

[0267] R6K Mpf is encoded by the sltX1tivB1B2B3-4B5B6B7B8B9B10B11operon that also includes clpX1 of the Dtr module. Thus, in anembodiment, the component is a gene comprises by the RK6sltX1tivB1B2B3-4B5B6B7B8B9B10B11 operon. In an embodiment, the thecomponent is clpX1 of the RK6 Dtr module. In an embodiment, thecomponent is a gene selected from clpX1 and dtrX1rlxX1. In anembodiment, the component is a gene selected from a RK6 clpX1 anddtrX1rlxX1 or homologues thereof. Optionally, in these embodimentsthe first DNA is comprised by a RK6-type plasmid.

[0268] The carrier cell of any preceding Embodiment, wherein thecarrier cell chromosome and/or an episome of the carrier cell(other than an episome comprising the first DNA) comprises anexpressible tra1 and/or tra2 module or a homologue thereof.

[0269] Any episome herein may be a plasmid. [0270] 5. The carriercell of any preceding Embodiment, wherein the carrier cellchromosome and/or an episome of the carrier cell (other than anepisome comprising the first DNA) comprises an expressible operonof a tra1 and/or tra2 module or a homologue thereof. [0271] 6. Thecarrier cell of any one of Embodiments 3 to 6, wherein thecomponent is tra1 component. [0272] 7. The carrier cell of any oneof Embodiments 3 to 6, wherein the component is tra2 component.[0273] 8. The carrier cell of any one of Embodiments 2 to 7,wherein the carrier cell chromosome encodes the first factor andcomprises said component. [0274] 9. The carrier cell of anypreceding Embodiment, wherein the first factor is a rep protein,optionally wherein the protein is encoded by pir or trfA or ahomologue thereof. [0275] 10. The carrier cell of any precedingEmbodiment, wherein the first DNA is comprised by a RK2 or R6Kplasmid. [0276] 11. The carrier cell of any preceding Embodiment,wherein the first DNA comprises an oriV of a RK2 or R6K plasmid, ora homologue thereof. [0277] 12. The carrier cell of any precedingEmbodiment, wherein the first DNA comprises an oriT of a RK2 or R6Kplasmid, or a homologue thereof. [0278] 13. The carrier cell of anypreceding Embodiment, wherein the first DNA is comprised by aplasmid. [0279] 14. The carrier cell of any preceding Embodiment,wherein the second DNA is comprised by a plasmid or is comprised bya chromosome of the carrier cell. [0280] 15. The carrier cell ofany preceding Embodiment, wherein the agent comprises one or morecomponents of a CRISPR/Cas system that is operable in the targetcell to cut a protospacer sequence comprised by the target cell,eg, wherein the protospacer sequence is comprised by the cellchromosome.

[0281] In an embodiment, the cutting herein kills the target cell.In another embodiment, the cutting inhibits the growth orproliferation of the target cell. [0282] 16. The carrier cell ofany preceding Embodiment, wherein the agent encodes a guide RNA orcrRNA of a CRISPR/Cas system that is operable with a Cas nucleasein the target cell to cut a protospacer sequence comprised by thetarget cell, eg, wherein the protospacer sequence is comprised bythe cell chromosome.

[0283] In an example, the target cell is a Salmonella cell and theprotospacer is comprised by a pipA, pipB, pipC, hilA, sicP, mart orsopB gene. In an example, the protospacer is comprised by a genethat is a homologue or orthologue of a Salmonella sicP, sseF, pipA,pipB, pipC, hilA, sicP, mart or sopB gene. [0284] 17. The carriercell of any preceding Embodiment, wherein the first DNA comprises agene that encodes a product, wherein the product is essential forsurvival or proliferation of the carrier cell when in anenvironment that is devoid of the product, wherein the carrier cellchromosome does not comprise an expressible gene encoding theproduct and optionally the first DNA is the only episomal DNAcomprised by the carrier cell that encodes the product. [0285] 18.The carrier cell of Embodiment 17, wherein the gene is selectedfrom an aroA, argH, hisD, leuB, lysA, metB, proC, thrC, pheA, tyrA,trpC and pflA gene; or wherein the gene is an anti-toxin gene andoptionally the first DNA encodes a cognate toxin. [0286] 19. Thecarrier cell of any preceding Embodiment, wherein the carrier cellis an E. coli (eg, Nissle, F18 or S17 E. coli strain), Bacillus(eg, B subtilis), Enterococcus or Lactobacillus cell. Optionally,the carrier cell is a cell of a human, chicken pig, sheep, cow,fish (eg, catfish or salmon) or shellfish (eg, shrimp or lobster)commensal bacterial strain (eg, a commensal E. coli strain). [0287]20. The carrier cell of any preceding Embodiment, wherein thecarrier cell is for administration to a microbiota of a human oranimal subject for medical use.

[0288] For example, the medical use is for treating or preventing adisease disclosed herein. For example, the medical use is fortreating or preventing a condition disclosed herein. [0289] 21. Thecarrier of Embodiment 20, wherein the medical use is for thetreatment or prevention of a disease or condition mediated by saidtarget cells. [0290] 22. The carrier of any one of Embodiments 1 to20 for administration to an animal for enhancing growth or weightof the animal.

[0291] In alternative, the administration is to a human forenhancing the growth or weight of the human. Optionally, theenhancing is not a medical therapy. Optionally, the enhancing is amedical therapy. [0292] 23. The carrier of any one of Embodiments20 to 22, wherein the use comprises the administration of aplurality of carrier cells to a microbiota (eg, a gut microbiota)of the subject, wherein the microbiota comprises target cells andfirst DNA is transferred into target cells for expression thereinto produce the antibacterial agent, thereby killing target cells inthe subject or reducing the growth or proliferation of targetcells. [0293] 24. A DNA encoding an antibacterial agent that istoxic to a target bacterial cell but is not toxic to a carriercell, wherein the first DNA comprises an origin of replication butdoes not comprise or encode a first factor required for replicationof the first DNA, and wherein the first DNA comprises an origin oftransfer but is devoid of a component required for conjugativetransfer of the first DNA into a target bacterial cell, whereinwhen in the presence of the component the DNA is capable ofconjugative transfer into the target cell.

[0294] Thus, when the DNA is in a carrier cell, the DNA is capableof conjugative transfer into a target cell. [0295] 25. The DNA ofEmbodiment 24, wherein the DNA is according to the DNA recited inany one of Embodiments 1 to 23. [0296] 26. The DNA of Embodiment 24or 25, wherein the cells are according to the cells recited in anyone of Embodiments 1 to 23. [0297] 27. A method for enhancinggrowth or weight of an animal subject (eg, a chicken), wherein themethod comprises the administration of a plurality of carrier cellsaccording to any one of Embodiments 1 to 23 to a microbiota of thesubject, wherein the microbiota comprises target cells and firstDNA is transferred from carrier cells into target cells forexpression therein to produce the antibacterial agent, therebykilling target cells (eg, Salmonella cells) in the subject orreducing the growth or proliferation of target cells.

[0298] In alternative, the administration is to a human forenhancing the growth or weight of the human. Optionally, theenhancing is not a medical therapy. Optionally, the enhancing is amedical therapy. [0299] 28. A method for enhancing growth or weightof a plant (eg, a tomato plant), wherein the method comprises theadministration of a plurality of carrier cells according to any oneof Embodiments 1 to 23 to a microbiota of the plant, wherein themicrobiota comprises target cells and first DNA is transferred fromcarrier cells into target cells for expression therein to producethe antibacterial agent, thereby killing target cells (eg,Pseudomonas cells) in the plant or reducing the growth orproliferation of target cells.

[0300] The plant may be any plant disclosed herein. For example aplant herein in any configuration or embodiment of the invention isselected from a tomato plant, a potato plant, a wheat plant, a cornplant, a maize plant, an apple tree, a bean-producing plant, a peaplant, a beetroot plant, a stone fruit plant, a barley plant, a hopplant and a grass. For example, the plant is a tree, eg, palm, ahorse chestnut tree, a pine tree, an oak tree or a hardwood tree.For example the plant is a plant that produces fruit selected fromstrawberries, raspberries, blackberries, reducrrants, kiwi fruit,bananas, apples, apricots, avoocados, cherries, oranges,clementines, satsumas, grapefruits, plus, dates, figs, limes,lemons, melons, mangos, pears, olives or grapes. Optionally, theplant is a dicotyledon. Optionally, the plant is a flowering plant.Optionally, the plant is a monocotyledon.

[0301] In any configuration, embodiment or example herein, thetarget bacteria are P. syringae bacteria (eg, comprised by aplant). Pseudomonas syringae pv. syringae is a commonplant-associated bacterium that causes diseases of both monocot anddicot plants worldwide. In an example the targt bacteria are P.syringae bacteria of a pathovar selected from P. s. pv. aceris, P.s. pv. aptata, P. s. pv. atrofaciens, [0302] P. s. pv. dysoxylis,P. s. pv. japonica, P. s. pv. lapsa, P. s. pv. panici, P. s. pv.papulans, P. s. pv. pisi, [0303] P. s. pv. syringae and P. s. pv.morsprunorum. [0304] P. s. pv. aceris attacks maple Acer species.[0305] P. s. pv. actinidiae attacks kiwifruit Actinidia deliciosa.[0306] P. s. pv. aesculi attacks horse chestnut Aesculushippocastanum, causing bleeding canker. [0307] P. s. pv. aptataattacks beets Beta vulgaris. [0308] P. s. pv. atrofaciens attackswheat Triticum aestivum. [0309] P. s. pv. dysoxylis attacks thekohekohe tree Dysoxylum spectabile. [0310] P. s. pv. japonicaattacks barley Hordeum vulgare. [0311] P. s. pv. lapsa attackswheat Triticum aestivum. [0312] P. s. pv. panici attacks Panicumgrass species. [0313] P. s. pv. papulans attacks crabapple Malussylvestris species. [0314] P. s. pv. phaseolicola causes haloblight of beans. [0315] P. s. pv. pisi attacks peas Pisum sativum.[0316] P. s. pv. syringae attacks Syringa, Prunus, and Phaseolusspecies. [0317] P. s. pv. glycinea attacks soybean, causingbacterial blight of soybean.

[0318] In an example, the target bacteria are P. syringae selectedfrom a serovar recited in a bullet point in the immediatelypreceding paragraph and the bacteria are comprised by a plant alsomentioned in that bullet point.

[0319] In an example, the weight is dry weight. For example, themethod is for increasing dry weight (eg, within 1 or 2 weeks ofsaid administration). Optionally, the increase is an increase of atleast 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20% compared toa control plant of the same species or strain to which theadministration if carrier cells has not taken place, wherein allplants are kept under the same environmental conditions. Forexample, such an increase is within 1, 2, 3, 4, 5, 6, or 8 weeksfollowing the first administration of the carrier cells. In anexample, the method is for increasing the dry weight of a leafand/or fruit of the plant, such as a tomato plant.

[0320] In an example, the weight is wet weight. For example, themethod is for increasing wet weight (eg, within 1 or 2 weeks ofsaid administration). Optionally, the increase is an increase of atleast 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20% compared toa control plant of the same species or strain to which theadministration if carrier cells has not taken place, wherein allplants are kept under the same environmental conditions. Forexample, such an increase is within 1, 2, 3, 4, 5, 6, or 8 weeksfollowing the first administration of the carrier cells. In anexample, the method is for increasing the dry weight of a leafand/or fruit of the plant, such as a tomato plant. [0321] 29. Themethod of Embodiment 28, wherein the microbiota is comprised by aleaf, trunk, root or stem of the plant.

[0322] In an example, in any configuration or embodiment herein thetarget bacteria (or taraget cell) is comprised by a microbiota of aplant. In an example, the microbiota is comprised by a leaf. In anexample, the microbiota is comprised by a xylem. In an example, themicrobiota is comprised by a phloem. In an example, the microbiotais comprised by a root. In an example, the microbiota is comprisedby a tuber. In an example, the microbiota is comprised by a bulb.In an example, the microbiota is comprised by a seed. In anexample, the microbiota is comprised by an exocarp, epicarp,mesocarp or endocarp. In an example, the microbiota is comprised bya fruit, eg, a simple fruits; aggregate fruits; or multiple fruits.In an example, the microbiota is comprised by a seed or embryo, eg,by a seed coat; a seed leaf; cotyledons; or a radicle. In anexample, the microbiota is comprised by a flower, eg, comprised bya peduncle; sepal: petals; stamen; filament; anther or pistil. Inan example, the microbiota is comprised by a root; eg, a tap rootsystem, or a fibrous root system. In an example, the microbiota iscomprised by a leaf or leaves, eg, comprised by a leaf blade,petiole or stipule. In an example, the microbiota is comprised by astem, eg, comprised by bark, epidermis, phloem, cambium, xylem orpith. [0323] 30. A method for reducing a biofilm comprised by asubject or comprised on a surface, wherein the biofilm comprisestarget cells (eg, Pseudomonas cells), wherein the method comprisesthe administration of a plurality of carrier cells according to anyone of Embodiments 1 to 23 to the biofilm, wherein first DNA istransferred from carrier cells into target cells for expressiontherein to produce the antibacterial agent, thereby killing targetcells in the biofilm or reducing the growth or proliferation oftarget cells.

[0324] In an example "reducing a biofilm" comprises reducing thecoverage area of the biofilm. In an example "reducing a biofilm"comprises reducing the proliferation of the biofilm. In an example"reducing a biofilm" comprises reducing the durability of thebiofilm. In an example "reducing a biofilm" comprises reducing thespread of the biofilm (eg, in or on the subject, eg, spread to theenvironment containing the subject). [0325] 31. The method ofEmbodiment 30, wherein the subject is a human or animal.

[0326] For example, the biofilm is comprised by a lung of thesubject, eg, wherein the target cells are Pseudomonas (eg, P.aeruginosa) cells. This may be useful wherein the subject is ahuman suffering from a lung disease or condition, such as pneumoniaor cystic fibrosis. For example, the biofilm is comprised by ananimal or human organ disclosed herein. For example, the biofilm iscomprised by a microbiota of a human or animal disclosed herein.[0327] 32. The method of Embodiment 30, wherein the subject is aplant (eg, any plant disclosed herein).

[0328] Optionally, in this Embodiment the target cells arePseudomonas syringae cells. [0329] 33. The method of Embodiment 31or 32, wherein the biofilm is comprised by a leaf, trunk, root orstem of the plant.

[0330] In an example, in any configuration or embodiment herein thetarget bacteria (or taraget cell) is comprised by a biofilm of aplant. In an example, the biofilm is comprised by a leaf. In anexample, the biofilm is comprised by a xylem. In an example, thebiofilm is comprised by a phloem. In an example, the biofilm iscomprised by a root. In an example, the biofilm is comprised by atuber. In an example, the biofilm is comprised by a bulb. In anexample, the biofilm is comprised by a seed. In an example, thebiofilm is comprised by an exocarp, epicarp, mesocarp or endocarp.In an example, the biofilm is comprised by a fruit, eg, a simplefruits; aggregate fruits; or multiple fruits. In an example, thebiofilm is comprised by a seed or embryo, eg, by a seed coat; aseed leaf; cotyledons; or a radicle. In an example, the biofilm iscomprised by a flower, eg, comprised by a peduncle; sepal: petals;stamen; filament; anther or pistil. In an example, the biofilm iscomprised by a root; eg, a tap root system, or a fibrous rootsystem. In an example, the biofilm is comprised by a leaf orleaves, eg, comprised by a leaf blade, petiole or stipule. In anexample, the biofilm is comprised by a stem, eg, comprised by bark,epidermis, phloem, cambium, xylem or pith. [0331] 34. The method ofany one of Embodiments 30 to 33 (eg, 30), wherein the surface is asurface ex vivo, such as a surface comprised by a domestic orindustrial apparatus or container. [0332] 35. A method ofreplicating a first DNA to produce a plurality of copies of saidDNA, the method comprising culturing a plurality of carrierbacterial cells according to any one of Embodiments 1 to 23,wherein the first DNA is replicated in the cells.

[0333] Optionally, the method further comprises isolating first DNAafter said culturing. The skilled addresse is familiar withtechniques and conditions for culturing cells that can be used.[0334] 36. The method of Embodiment 35, comprising [0335] (a)obtaining a sample of the carrier cells after culturing; [0336] (b)contacting the sample of carrier cells with a plurality of targetbacterial cells to allow conjugation between carrier cells andtarget cells; and [0337] (c) allowing copies of first DNA to betransferred by conjugative transfer from carrier cells to targetcells, wherein the antibacterial agent is provided in target cellsand target cells are killed or the growth or proliferation oftarget cells is reduced; [0338] (d) wherein the first DNA is notreplicable in the target cells.

[0339] For example, the first DNA is not substantially replicablein the target cells, eg, less than 10, 5, 4, 3, 2 or 1%replication).

[0340] The first DNA is not (or not substantially) replicable inthe target cells due to the absence of the first factor or sequenceencoding it in the target cells. [0341] 37. A method of killing aplurality of target bacterial cells or reducing the growth orproliferation thereof, the method comprising [0342] (a) obtaining asample of the carrier cells according to any one of Embodiments 1to 23 or obtainable by the method of Embodiment 35; [0343] (b)contacting the sample of carrier cells with the plurality of targetbacterial cells to allow conjugation between carrier cells andtarget cells; and [0344] (c) allowing copies of first DNA to betransferred by conjugative transfer from carrier cells to targetcells, wherein the antibacterial agent is provided in target cellsand target cells are killed or the growth or proliferation oftarget cells is reduced; [0345] (d) wherein the first DNA is not(or not substantially) replicable in the target cells. [0346] 38.The method of Embodiment 36 or 37, wherein the target cells arecomprised by a biofilm, eg, a biofilm as disclosed herein. [0347]39. A method for containing the action of an antibacterial agent inan environment, wherein the agent is toxic to target bacterialcells, the method comprising carrying out the method of Embodiment37 or 38 and the agent is said agent recited of the Embodiment.[0348] 40. The method of Embodiment 39, wherein the environment iscomprised by a human or animal subject and the target cells arecomprised by a biofilm of the subject, wherein the method comprisesadministering the sample of carrier cells to the biofilm of thesubject, wherein the carrier cells are contacted with the targetcells in step (b), wherein the method is a contained method fortreating or preventing a disease or condition mediated by targetcells in the subject. [0349] 41. The carrier cell, DNA or method ofany preceding Embodiment, wherein the target bacteria areSalmonella, Pseudomonas, Escherichia, Klebsiella, Campylobacter,Helicobacter, Acinetobacter, Enterobacteriacea, Clostridium,Staphylococcus or Streptococcus bacteria. [0350] 42. The carriercell, DNA or method of any preceding Embodiment, wherein the targetbacteria are Salmonella enterica bacteria.

[0351] For example, the target bacteria are selected from the groupconsisting of Salmonella enterica subsp. enterica, serovarsTyphimurium, Enteritidis, Virchow, Montevideo, Hadar and Binza.[0352] 43. The carrier cell, DNA or method of any one ofEmbodiments 1 to 41, wherein the target bacteria are Pseudomonas(eg, P. syringae or P. aeruginosa) bacteria. [0353] 44. The carriercell or method of any one of Embodiments 1 to 41, wherein thetarget bacteria are E coli bacteria.

[0354] Optionally, the target bacteria are enterohemorrhagic E.coli (EHEC), E. coli Serotype O157:H7 or Shiga-toxin producing E.coli (STEC)). In an example, the taraget bacteria are selected from[0355] Shiga toxin-producing E. coli (STEC) (STEC may also bereferred to as Verocytotoxin-producing E. coli (VTEC); [0356]Enterohemorrhagic E. coli (EHEC) (this pathotype is the one mostcommonly heard about in the news in association with foodborneoutbreaks); [0357] Enterotoxigenic E. coli (ETEC); [0358]Enteropathogenic E. coli (EPEC); [0359] Enteroaggregative E. coli(EAEC); [0360] Enteroinvasive E. coli (EIEC); and [0361] Diffuselyadherent E. coli (DAEC).

[0362] Enterohemorrhagic Escherichia coli (EHEC) serotype O157:H7is a human pathogen responsible for outbreaks of bloody diarrhoeaand haemolytic uremic syndrome (HUS) worldwide. Conventionalantimicrobials trigger an SOS response in EHEC that promotes therelease of the potent Shiga toxin that is responsible for much ofthe morbidity and mortality associated with EHEC infection. Cattleare a natural reservoir of EHEC, and approximately 75% of EHECoutbreaks are linked to the consumption of contaminatedbovine-derived products. EHEC causes disease in humans but isasymptomatic in adult ruminants. Characteristics of E. coliserotype O157:H7 (EHEC) infection includes abdominal cramps andbloody diarrhoea, as well as the life-threatening complicationhaemolytic uremic syndrome (HUS). Currently there is a need for atreatment for EHEC infections (Goldwater and Bettelheim, 2012). Theuse of conventional antibiotics exacerbates Shiga toxin-mediatedcytotoxicity. In an epidemiology study conducted by the Centers forDisease Control and Prevention, patients treated with antibioticsfor EHEC enteritis had a higher risk of developing HUS (Slutsker etal., 1998). Additional studies support the contraindication ofantibiotics in EHEC infection; children on antibiotic therapy forhemorrhagic colitis associated with EHEC had an increased chance ofdeveloping HUS (Wong et al., 2000; Zimmerhackl, 2000; Safdar etal., 2002; Tarr et al., 2005). Conventional antibiotics promoteShiga toxin production by enhancing the replication and expressionof stx genes that are encoded within a chromosomally integratedlambdoid prophage genome. The approach of some configurations ofpresent invention rely on nuclease cutting. Stx induction alsopromotes phage-mediated lysis of the EHEC cell envelope, allowingfor the release and dissemination of Shiga toxin into theenvironment (Karch et al., 1999; Matsushiro et al., 1999; Wagner etal., 2002). Thus, advantageously, these configurations of theinvention provide alternative means for treating EHEC in human andanimal subjects. This is exemplified below with surprising resultson the speed and duration of anti-EHEC action produced by nucleaseaction (as opposed to conventional antibiotic action).

[0363] In an example, the subject (eg, a human or animal) issuffering from or at risk of haemolytic uremic syndrome (HUS), eg,the subject is suffering from an E. coli infection, such as an EHECE. coli infection. [0364] 45. A pharmaceutical composition,livestock growth promoting composition, soil improver, herbicide,plant fertilizer, food or food ingredient sterilizing composition,dental composition, personal hygiene composition or disinfectantcomposition (eg, for domestic or industrial use) comprising aplurality of carrier cells according to any one of Embodiments 1 to23.

[0365] Herein, a carrier cell is, eg, a probiotic cell foradministration to a human or animal subject. For example, thecarrier cell is commensal in a microbiome (eg, gut or bloodmicrobiome) of a human or animal subject, wherein the carrier isfor administration to the subject. In an example, a carrier cell isa bacterial cell (and optionally the target cell is a bacterialcell). In an example, a carrier cell is an archaeal cell (andoptionally the target cell is an archaeal cell) Optionally, thecarrier cell is a gram-positive bacterial cell and the target cellis a gram-positive bacterial cell.

[0366] Optionally, the carrier cell is a gram-positive bacterialcell and the target cell is a gram-negative bacterial cell.

[0367] Optionally, the carrier cell is a gram-negative bacterialcell and the target cell is a gram-positive bacterial cell.

[0368] Optionally, the carrier cell is a gram-negative bacterialcell and the target cell is a gram-negative bacterial cell.

[0369] Optionally, the carrier cell is a Bacillus bacterial celland the target cell is a gram-positive bacterial cell.

[0370] Optionally, the carrier cell is a Bacillus bacterial celland the target cell is a gram-netative bacterial cell.

[0371] Optionally, the carrier cell is a Bacillus bacterial celland the target cell is a Salmonella bacterial cell.

[0372] Optionally, the carrier cell is a Bacillus bacterial celland the target cell is an E. coli bacterial cell.

[0373] Optionally, the carrier cell is an E. coli bacterial celland the target cell is a Pseudomonas bacterial cell.

[0374] Optionally, the carrier cell is an E. coli bacterial celland the target cell is a gram-positive bacterial cell.

[0375] Optionally, the carrier cell is an E. coli bacterial celland the target cell is a gram-netative bacterial cell.

[0376] Optionally, the carrier cell is an E. coli bacterial celland the target cell is a Salmonella bacterial cell.

[0377] Optionally, the carrier cell is an E. coli bacterial celland the target cell is an E. coli bacterial cell.

[0378] Optionally, the carrier cell is an E. coli bacterial celland the target cell is a Pseudomonas bacterial cell.

[0379] A Bacillus cell herein is optionally a B subtilis cell.

[0380] Optionally, the carrier cell is a probiotic or commensal E.coli bacterial cell for administration to a human or animalsubject. Optionally, the carrier cell is a probiotic or commensalBacillus bacterial cell for administration to a human or animalsubject.

[0381] Herein, optionally the first DNA is comprised by a plasmid,eg, a closed circular DNA.

[0382] In an embodiment, in an example the first DNA is dsDNA. Inan embodiment, in an example the first DNA is ssDNA.

[0383] In an alternative configuration, the first DNA is instead afirst RNA.

[0384] Optionally, the target cell is a Salmonella cell (eg,wherein the carrier cell is an E. coli cell), eg, a Salmonellaenterica subsp. enterica, eg, a Salmonella enterica subsp. entericaserovar Typhimurium, Enteritidis, Virchow, Montevideo, Hadar orBinza.

[0385] For example, the target bacteria are selected from the groupconsisting of S. enterica; S. typhimurium; P. aeruginosa; E. coli;K. pneumoniae; C. jujeni; H. pylori; A. baumanii; C. difficile; S.aureus; S. pyogenes or S. thermophilus.

[0386] In an example, the target cell is a cell of a species thatcauses nosocomial infection in humans.

[0387] Optionally, the target cell is comprised by an animal (eg,poultry animal (such as chicken), swine, cow, fish (eg, catfish orsalmon) or shellfish (eg, prawn or lobster)) microbiome.Optionally, the microbiome is a gut microbiome. For example, thetarget cell is a Salmonella cell comprised by a chicken gutbiofilm. For example, the target cell is a Salmonella cellcomprised by a chicken gut biofilm sample ex vivo.

[0388] In an embodiment, the first DNA comprises a bacterial oriVand/or an oriT. In an embodiment, the first DNA is comprised by aplasmid, wherein the plasmid comprises and oriV and/or an oriT.

[0389] The first factor may be a protein or RNA. For example, thefirst factor is pir or trfA. In an example the first factor isoperable with an oriV comprised by the first DNA for replicationthereof.

[0390] In an embodiment, the first DNA is comprised by a plasmid,wherein the plasmid comprises an oriV and does not encode anyreplication protein (eg, pir or trfA) that is operable with theoriV to initiate replication of the plasmid.

[0391] In an embodiment, the first DNA is devoid of a componentrequired for conjugative transfer of the first DNA into a targetbacterial cell. Optionally, the component is a protein. Optionally,the component is a RNA. Optionally, the component is a tra1component. Optionally, the component is a tra2 component. In anexample, the carrier cell comprises said component, wherein thecomponent is comprised by or encoded by the carrier cellchromosome, the second DNA or a third DNA in the carrier cell.Preferably, the component is comprised by or encoded by the carriercell chromosome.

[0392] Optionally, the component required for conjugative transferis a RP4 plasmid component, eg, a component of a RP4 tra module(eg, tra1 or tra2 module).

[0393] Optionally, the component required for conjugative transferis a RK2 plasmid component, eg, a component of a RK2 tra module(eg, tra1 or tra2 module).

[0394] Optionally, the component required for conjugative transferis a R6K plasmid component, eg, a component of a R6K tra module(eg, tra1 or tra2 module).

[0395] Optionally, the first DNA is comprised by a plasmid thatdoes not comprise an antibiotic resistance marker gene and/or aplasmid addiction system gene. As explained in the Examplessection, this may be advantageous in the rare case of an identicalIncP plasmid being present in the target cell that will providetrfA (or other component required for conjugation where thatcomponent is not encoded by the plasmid comprising the first DNA),both plasmids will compete for the available TrfA (or othercomponent), resulting in loss of one plasmid, and thus will bequickly lost from any offspring target cells.

[0396] Optionally, the plasmid comprising the first DNA furthercomprises an anti-restriction gene encoding a product forinhibiting a restriction enzyme of the target cell (eg, an Type Irestriction enzyme). as anti-restriction genes that inhibit Type Irestriction enzymes (eg, the anti-restriction gene product is anocr of T7, klcA of RK2, ard or ardB).

[0397] Additionally or alternatively, the plasmid comprises a geneencoding an essential component of a type IV secretion system,wherein the chromosome of the carrier cell comprises genes encodingthe remainder of the secretion system, wherein the essentialcomponent is required for conjugative transfer of the plasmid fromthe carrier cell to the target cell. For example, with theexception of a tra1 or tra2 gene encoding the essential component,the chromosome comprises all of the remainder of traKLM, traJXIHGFgenes of RK2 tra1 and all of the remainder of trbBCEFGHJL genes ofRK2 tra2 (preferably when the plasmid is a RK2-type plasmid). In analternative example, with the exception of a gene encoding theessential component, the chromosome comprises all of the reaminderof RK6 homologues of traKLM, traJXIHGF genes of RK2 tra1 and all ofthe remainder of RK6 homologues of trbBCEFGHJL genes of RK2 tra2(preferably when the plasmid is a RK6-type plasmid). In analternative example, with the exception of a gene encoding theessential component, the chromosome comprises all of the reaminderof RP4 homologues of traKLM, traJXIHGF genes of RK2 tra1 and all ofthe remainder of RP4 homologues of trbBCEFGHJL genes of RK2 tra2(preferably when the plasmid is a RP4-type plasmid).

[0398] For example, with the exception of a tra1 or tra2 geneencoding the essential component, the chromosome comprises all ofthe remainder of a DNA fragment of the RK2 plasmid from traF totraM and all of the remainder of a DNA fragment of the RK2 plasmidfrom trbB to trK (preferably when the plasmid is a RK2-typeplasmid). For example, with the exception of a tra1 or tra2 geneencoding the essential component, the chromosome comprises all ofthe remainder of the RK2 plasmid genes from traF to traM and all ofthe remainder of the RK2 plasmid genes from trbB to trK (preferablywhen the plasmid is a RK2-type plasmid). For example, thechromosome comprises (in the following order 5' to 3', or 3' to 5')the following RK2 tra1 genes: traFGHIXJKLM, or traKLM, ortraJXIHGF. For example, the chromosome comprises (in the followingorder 5' to 3', or 3' to 5') the following RK2 tra2 genes:trbBCDEFGHIJKL or trbBCEFGHJL.

[0399] For example, with the exception of a gene encoding theessential component, the chromosome comprises all of the remainderof a DNA fragment of the RK6 plasmid from a homologue of RK2 traFto a homologue of RK2 traM and all of the remainder of a DNAfragment of the RK6 plasmid from a homologue of RK2 trbB to ahomologue of a RK2 trK (preferably when the plasmid is a RK6-typeplasmid). For example, with the exception of a gene encoding theessential component, the chromosome comprises all of the remainderof the RK6 plasmid genes from a homologue of RK2 traF to ahomologue of RK2 traM and all of the remainder of the RK6 plasmidgenes from a homologue of RK2 trbB to a homologue of RK2 trK(preferably when the plasmid is a RK6-type plasmid). For example,the chromosome comprises (in the following order 5' to 3', or 3' to5') RK6 homologues of the following RK2 tra1 genes: traFGHIXJKLM,or traKLM, or traJXIHGF. For example, the chromosome comprises (inthe following order 5' to 3', or 3' to 5') RK6 homologues of thefollowing RK2 tra2 genes: trbBCDEFGHIJKL or trbBCEFGHJL.

[0400] For example, with the exception of a gene encoding theessential component, the chromosome comprises all of the remainderof a DNA fragment of the RP4 plasmid from a homologue of RK2 traFto a homologue of RK2 traM and all of the remainder of a DNAfragment of the RP4 plasmid from a homologue of RK2 trbB to ahomologue of a RK2 trK (preferably when the plasmid is a RP4-typeplasmid). For example, with the exception of a gene encoding theessential component, the chromosome comprises all of the remainderof the RP4 plasmid genes from a homologue of RK2 traF to ahomologue of RK2 traM and all of the remainder of the RP4 plasmidgenes from a homologue of RK2 trbB to a homologue of RK2 trK(preferably when the plasmid is a RP4-type plasmid). For example,the chromosome comprises (in the following order 5' to 3', or 3' to5') RP4 homologues of the following RK2 tra1 genes: traFGHIXJKLM,or traKLM, or traJXIHGF. For example, the chromosome comprises (inthe following order 5' to 3', or 3' to 5') RP4 homologues of thefollowing RK2 tra2 genes: trbBCDEFGHIJKL or trbBCEFGHJL.

[0401] Preferably, the second DNA or a chromosome comprising thesecond DNA is devoid of a oriT. Preferably, the third DNA or achromosome comprising the third DNA is devoid of a oriT. Forexample, the oriT is only comprised by the first DNA (or plasmidcomprising this) and is not comprised by any other DNA in thecarrier cell. Thus, transfer is confined just to the first DNA orits plasmid.

[0402] The first DNA in all embodiments and configurations maypreferably not be comprised by a runaway replication plasmid.Naturally occurring plasmids are present within host cells at acharacteristic concentration (referred to herein as a particularplasmid "copy number"). Mutations that destroy the elements of thecontrol cause an over-replication phenotype that manifests itselfby an increase in the plasmid copy number ("copy-up" phenotype). Inextreme cases of copy-up mutations, plasmid replication iscompletely unchecked due to the loss of copy control mechanisms.This is referred to as "runaway plasmid replication" or simply"runaway replication" and the plasmid engaging in such runawayreplication is a "runaway replication plasmid".

[0403] In an example, the invention relates to a compositioncomprising a plurality of carrier cells of the invention (eg,wherein copies of the first DNA are comprised by respectiveplasmids). Optionally, all of the carrier cells comprise identicalsaid first and second DNAs. Optionally, the plurality comprises afirst sub-population of carrier cells (first cells) and a secondsub-population of carrier cells (second cells) wherein the firstcells comprise identical first DNAs and the second cells compriseidentical first DNAs (which are different from the first DNAs ofthe first cells). For example, the former DNAs comprise a NSI thatis different from the NSI comprised by the other DNAs. For example,the first DNAs encode a first guide RNA or crRNA and the secondDNAs encode a second guide RNA or crRNA, wherein the first guideRNA/crRNA is capable of hybridizing to a first protospacer sequencein first target cells; and the second guide RNA/crRNA is capable ofhybridizing to a second protospacer sequence in second targetcells, wherein the protospacers are different. Optionally, thefirst target cells are different from the second target cells.Optionally, the first target cells are of the same species orstrain as the second target cells. Alternatively, the first targetcells are of species or strain that is different from the speciesor strain of the second target cells (in this way a cocktail ofcarrier cells is provided, eg, for administration to a human oranimal or plant, to target and kill a plurality of target cells ofdifferent species or strains).

[0404] In an example, the or each first DNA comprises a plurality(eg, a first and a second) NSIs wherein a first NSI is differentfrom a second NSI (eg, they encode different proteins or RNAs, suchas different guide RNAs or crRNAs). In an example, the or eachfirst DNA comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,16, 17, 18, 19 or 20 different types of NSIs. In an example, the oreach first DNA comprises NSIs encoding 2, 3, 4, 5, 6, 7, 8, 9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 different guide RNAs. Inan example, the or each first DNA comprises NSIs encoding 2, 3, 4,5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20different crRNAs. In an example, the or each first DNA comprisesNSIs encoding at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17, 18, 19 or 20 different guide RNAs. In an example, theor each first DNA comprises NSIs encoding at least 2, 3, 4, 5, 6,7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 differentcrRNAs.

[0405] Optionally, the composition is comprised by a liquid (eg, anaqueous liquid or in water), the composition comprising the carriercells at an amount of from 1.times.10.sup.3 to 1.times.10.sup.10(eg, from 1.times.10.sup.4 to 1.times.10.sup.10; from1.times.10.sup.4 to 1.times.10.sup.9; from 1.times.10.sup.4 to1.times.10.sup.8; from 1.times.10.sup.4 to 1.times.10.sup.7; from1.times.10.sup.3 to 1.times.10.sup.10; from 1.times.10.sup.3 to1.times.10.sup.9; from 1.times.10.sup.3 to 1.times.10.sup.8; from1.times.10.sup.3 to 1.times.10.sup.7; from 1.times.10.sup.6 to1.times.10.sup.10; from 1.times.10.sup.5 to 1.times.10.sup.9; from1.times.10.sup.5 to 1.times.10.sup.8; from 1.times.10.sup.5 to1.times.10.sup.7; from 1.times.10.sup.6 to 1.times.10.sup.10; from1.times.10.sup.6 to 1.times.10.sup.9; from 1.times.10.sup.6 to1.times.10.sup.8; or from 1.times.10.sup.6 to 1.times.10.sup.7)cfu/ml. For example, the liquid is a beverage, such for human oranimal consumption. For example, the beverage is a livestockbeverage, eg, a poultry beverage (ie, a beverage for consumption bypoultry, such as chicken).

[0406] In an example, the composition is a dietary (eg, dietarysupplement) composition for consumption by humans or animals. In anexample, the composition is a slimming composition for consumptionby humans or animals. In an example, the composition is a growthpromotion composition for consumption by humans or animals. In anexample, the composition is a body building composition forconsumption by humans. In an example, the composition is aprobiotic composition for consumption by humans or animals. In anexample, the composition is a biocidal composition for consumptionby humans or animals. In an example, the composition is apesticidal composition for consumption by humans or animals. In anexample, the composition is a zoonosis control composition forconsumption by animals.

[0407] In an example, the composition comprises vitamins inaddition to the carrier cells. In an example, the compositioncomprises vitamin A, B (eg, B12), C, D, E and/or K in addition tothe carrier cells. In an example, the composition comprises lipidsin addition to the carrier cells. In an example, the compositioncomprises carbohydrates in addition to the carrier cells. In anexample, the composition comprises proteins and/or amino acids inaddition to the carrier cells. In an example, the compositioncomprises minerals in addition to the carrier cells. In an example,the composition comprises metal ions (eg, Mg.sup.2+, Cu.sup.2+and/or Zn.sup.2+) in addition to the carrier cells. In an example,the composition comprises sodium ions, potassium ions, magnesiumions, calcium ions, manganese ions, iron ions, cobalt ions, copperions, zinc ions and/or molybdenum ions.

[0408] In an example, the composition is a plant fertilizercomposition. In an example, the composition is a herbicide. In anexample, the composition is a pesticide composition for applicationto plants.

[0409] In any embodiment or example, where appropriate: The plantsare, for example, crop plants. The plants are, for example, wheat.The plants are, for example, corn. The plants are, for example,maize. The plants are, for example, fruiting plants. The plantsare, for example, vegetable plants. The plants are, for example,tomato plants. The plants are, for example, potato plants. Theplants are, for example, grass plants. The plants are, for example,flowering plants. The plants are, for example, trees. The plantsare, for example, shrubs.

[0410] In an example, the composition is for environmentalapplication, wherein the environment is an outdoors environment(eg, application to a field or waterway or reservoir).

[0411] In an example, the composition is comprised by a food orfood ingredient (eg, for human or animal consumption). In anexample, the composition is comprised by a beverage or beverageingredient (eg, for human or animal consumption).

[0412] In an example the target cell(s) are human biofilm cells,eg, wherein the biofilm is a gut, skin, lung, eye, nose, ear,gastrointestinal tract (GI tract), stomach, hair, kidney, urethra,bronchiole, oral cavity, mouth, liver, heart, anus, rectum,bladder, bowel, intestine, penis, vagina or scrotum biofilm. In anexample the target cell(s) are animal biofilm cells, eg, whereinthe biofilm is a gut, skin, lung, eye, nose, ear, gastrointestinaltract (GI tract), caecum, jejunum, ileum, colon, stomach, hair,feather, scales, kidney, urethra, bronchiole, oral cavity, mouth,liver, spleen, heart, anus, rectum, bladder, bowel, intestine,penis, vagina or scrotum biofilm. For example, the biofilm is abird (eg, chicken) caecum biofilm. For example, the biofilm is abird (eg, chicken) gastrointestinal tract (GI tract), caecum,jejunum, ileum, colon or stomach biofilm.

[0413] In an example, any method herein is ex vivo. In an example,a method herein is in vivo. In an example, a method herein is invitro. In an example, a method herein is carried out in anenvironment, eg, in a domestic (such as in a house), industrial(such as in a factory) or agricultural environment (such as in afield). In an example, a method herein is carried out in or on acontainer; or on a surface.

[0414] In an example, the NSI (or a RNA product thereof) is capableof recombination with the target cell chromosome or an episomecomprised by the target cell to modify the chromosome or episome.Optionally, this is carried out in a method wherein the chromosomeor episome is cut (eg, at a predetermined site using a guidednuclease, such as a Cas, TALEN, zinc finger nuclease ormeganuclease) and simultaneously or sequentially the first DNA isintroduced into the target cell by conjugation with the carriercell and the NSI or a sequence thereof is inserted into thechromosome or episome at or adjacent the cut site.

[0415] In an example the first DNA comprises one or more componentsof a CRISPR/Cas system operable to perform protospacer cutting inthe target cell (eg, wherein the protospacer comprises 10-20,10-30, 10-40, 10-100, 12-15 or 12-20 consecutive nucleotides thatare capable of hybridizing in the target cell with a crRNA or gRNAencoded by the NSI).

[0416] For example, the system is a Type I, II, III, IV or VCRISPR/Cas system.

[0417] In an example, the NSI encodes a Cas9 (and optionally asecond, different, Cas, such as a Cas3, Cas9, Cpf1, Cas13a, Cas13bor Cas10). In an example, the NSI encodes a Cas3 (and optionally asecond, different, Cas, such as a Cas3, Cas9, Cpf1, Cas13a, Cas13bor Cas10). In an example, the NSI encodes a Cas selected from aCas3, Cas9, Cpf1, Cas13a, Cas13b and Cas10. Additionally oralternatively, the first DNA (eg, the NSI) encodes a guide RNA orcrRNA or tracrRNA. For example, the guide RNA or crRNA or tracrRNAis cognate to (ie, operable with in the target cell) the firstCas.

[0418] In an example, a Cas herein is a Cas9. In an example, a Casherein is a Cas3. The Cas may be identical to a Cas encoded by thetarget bacteria.

[0419] In an embodiment, the presence in the target bacterium ofthe NSI or its encoded protein or RNA mediates target cell killing,or downregulation of growth or propagation of target cells. In anembodiment, the presence in the target bacterium of the NSI or itsencoded protein or RNA mediates switching off of expression of oneor more RNA or proteins encoded by the target cell genome, ordownregulation thereof.

[0420] In an embodiment, the presence in the target bacterium ofthe NSI or its encoded protein or RNA mediates upregulation ofgrowth or propagation of the target cell. In an embodiment, thepresence in the target bacterium of the NSI or its encoded proteinor RNA mediates switching on of expression of one or more RNA orproteins encoded by the target cell genome, or upregulationthereof.

[0421] In an embodiment, the NSI encodes a component of aCRISPR/Cas system that is toxic to the target bacterium.

[0422] In an embodiment, the first DNA is comprised by a plasmid orshuttle vector. In an embodiment, the second DNA is comprised by avector (eg, a plasmid or shuttle vector), helper phage (eg, ahelper phagemid) or is integrated in the genome of a host bacterialcell.

[0423] Optionally, the target cell is devoid of a functionalendogenous CRISPR/Cas system before transfer therein of the firstDNA, eg, a first DNA comprising component of an exogenousCRISPR/Cas system that is functional in the target cell and toxicto the target cell. An embodiment provides an antibacterialcomposition comprising a plurality of carrier cells of theinvention, wherein each target cell is optionally according to thisparagraph, for administration to a human or animal subject formedical use.

[0424] In an example, the composition of the invention is aherbicide, pesticide, insecticide, plant fertilizer or cleaningagent.

[0425] Optionally, target bacteria herein are comprised by amicrobiome of the subject, eg, a gut microbiome. Alternatively, themicrobiome is a skin, scalp, hair, eye, ear, oral, throat, lung,blood, rectal, anal, vaginal, scrotal, penile, nasal or tonguemicrobiome.

[0426] In an example the subject (eg, human or animal) is furtheradministered a medicament simultaneously or sequentially with thecarrier cell administration. In an example, the medicament is anantibiotic, antibody, immune checkpoint inhibitor (eg, ananti-PD-1, anti-PD-L1 or anti-CTLA4 antibody), adoptive celltherapy (eg, CAR-T therapy) or a vaccine.

[0427] In an embodiment, the NSI encodes a guided nuclease, such asa Cas nuclease, TALEN, zinc finger nuclease or meganuclease. Thus,the toxic agent may comprise a guided nuclease, such as a Casnuclease, TALEN, zinc finger nuclease or meganuclease. Optionally,the NSI encodes a restriction nuclease that is capable of cuttingthe chromosome of the target cell.

[0428] Optionally, the composition is a pharmaceutical compositionfor use in medicine practised on a human or animal subject.

[0429] In an example, the animal is a livestock or companion petanimal (eg, a cow, pig, goat, sheep, horse, dog, cat or rabbit). Inan example, the animal is an insect (an insect at any stage of itslifecycle, eg, egg, larva or pupa). In an example, the animal is aprotozoan. In an example, the animal is a cephalopod.

[0430] Optionally, the composition is a herbicide, pesticide, foodor beverage processing agent, food or beverage additive,petrochemical or fuel processing agent, water purifying agent,cosmetic additive, detergent additive or environmental (eg, soil)additive or cleaning agent.

[0431] The invention also provides: A target bacterial cell or aplurality of target bacterial cells each comprising a said firstDNA.

[0432] For example the carrier bacteria are Lactobacillus (eg, L.reuteri or L. lactis), E. coli, Bacillus or Streptococcus (eg, S.thermophilus) bacteria. Usefully, the carrier can provideprotection for the first DNA from the surrounding environment. Theuse of a carrier may be useful for oral administration or otherroutes where the carrier can provide protection for the first DNAfrom the acid stomach or other harsh environments in the subject.Furthermore, the carrier can be formulated into a beverage, forexample, a probiotic drink, eg, an adapted Yakult (trademark),Actimel (trademark), Kevita (trademark), Activia (trademark),Jarrow (trademark) or similar drink for human consumption.

[0433] Optionally, the carrier cell(s) or composition are foradministration to a human or animal subject for medical use,comprising killing target bacteria using the agent or expressionproduct of the NSI, wherein the target bacteria mediate as diseaseor condition in the subject. In an example, when the subject is ahuman, the subject is not an embryo. In an example, the carriercells are probiotic in the subject.

[0434] The invention also provides: A method of killing targetbacterial cells in an environment, optionally wherein the method isnot practised on a human or animal body, wherein the methodcomprises exposing the environment to the carrier cell(s) orcomposition of the invention and allowing the product of the NSI tobe expressed in the target cells, wherein the target bacteria arekilled in the presence of said product. For example, the productencodes a CRISPR/Cas system or component thereof, such as a systemor component disclosed herein. Thus, the system may be capable ofrecognisisng and cutting a chromosomal protopspacer sequence of thetarget cell, whereby the target cell is killed. Optionally, in afurther step killed target cells are isolated.

[0435] The invention also provides: Use of the composition orcell(s) of the invention, in the manufacture of an antibacterialagent that kills target bacteria, for the treatment of a disease orcondition in a human or animal subject comprising the targetbacteria.

[0436] Optionally, the environment is a microbiome of soil; aplant, part of a part (e.g., a leaf, fruit, vegetable or flower) orplant product (e.g., pulp); water; a waterway; a fluid; a foodstuffor ingredient thereof; a beverage or ingredient thereof; a medicaldevice; a cosmetic; a detergent; blood; a bodily fluid; a medicalapparatus; an industrial apparatus; an oil rig; a petrochemicalprocessing, storage or transport apparatus; a vehicle or acontainer.

[0437] Optionally, the environment is an ex vivo bodily fluid(e.g., urine, blood, blood product, sweat, tears, sputum or spit),bodily solid (e.g., faeces) or tissue of a human or animal subjectthat has been administered the composition.

[0438] Optionally, the environment is an in vivo bodily fluid(e.g., urine, blood, blood product, sweat, tears, sputum or spit),bodily solid (e.g., faeces) or tissue of a human or animal subjectthat has been administered the composition.

[0439] In an embodiment, the first DNA is comprised by a phagemidor cloning vector (eg, a shuttle vector, eg, a pUC vector).

[0440] In an embodiment, the second DNA is comprised by thebacterial carrier cell chromosome.

[0441] Optionally, the toxic agent comprises one or more componentsof a CRISPR/Cas system, eg, a DNA sequence encoding one or morecomponents of Type I Cascade (eg, CasA).

[0442] Optionally, the toxic agent comprises a DNA sequenceencoding guided nuclease, such as a Cas nuclease, TALEN, zincfinger nuclease or meganuclease.

[0443] In an example, the carrier cell(s) or composition arecomprised by a medical container, eg, a syringe, vial, IV bag,inhaler, eye dropper or nebulizer. In an example, the carriercell(s) or composition are comprised by a sterile container. In anexample, the carrier cell(s) or composition are comprised by amedically-compatible container. In an example, the carrier cell(s)or composition are comprised by a fermentation vessel, eg, a metal,glass or plastic vessel. In an example, the carrier cell(s) orcomposition are comprised by an agricultural apparatus. In anexample, the carrier cell(s) or composition are comprised by foodproduction or processing apparatus. In an example, the carriercell(s) or composition are comprised by a horticultural apparatus.In an example, the carrier cell(s) or composition are comprised bya farming apparatus. In an example, the carrier cell(s) orcomposition are comprised by petrochemicals recovery or processingapparatus. In an example, the carrier cell(s) or composition arecomprised by a distillation apparatus. In an example, the carriercell(s) or composition are comprised by cell culture vessel (eg,having a capacity of at least 50, 100, 1000, 10000 or 100000litres). Additionally or alternatively, the target cell(s) arecomprised by any of these apparatus etc.

[0444] In an example, the carrier cell(s) or composition arecomprised by a medicament, e.g in combination with instructions ora packaging label with directions to administer the medicament byoral, IV, subcutaneous, intranasal, intraocular, vaginal, topical,rectal or inhaled administration to a human or animal subject. Inan example, the carrier cell(s) or composition are comprised by anoral medicament formulation. In an example, the carrier cell(s) orcomposition are comprised by an intranasal or ocular medicamentformulation. In an example, the carrier cell(s) or composition arecomprised by a personal hygiene composition (eg, shampoo, soap ordeodorant) or cosmetic formulation. In an example, th the carriercell(s) or composition are comprised by a detergent formulation. Inan example, the carrier cell(s) or composition are comprised by acleaning formulation, eg, for cleaning a medical or industrialdevice or apparatus. In an example, the carrier cell(s) orcomposition are comprised by foodstuff, foodstuff ingredient orfoodstuff processing agent.

[0445] In an example, the carrier cell(s) or composition arecomprised by beverage, beverage ingredient or beverage processingagent. In an example, the carrier cell(s) or composition arecomprised by a medical bandage, fabric, plaster or swab. In anexample, the carrier cell(s) or composition are comprised by aherbicide or pesticide. In an example, the carrier cell(s) orcomposition are comprised by an insecticide.

[0446] In an example, the CRISPR/Cas component(s) are component(s)of a Type I CRISPR/Cas system. In an example, the CRISPR/Cascomponent(s) are component(s) of a Type II CRISPR/Cas system. In anexample, the CRISPR/Cas component(s) are component(s) of a Type IIICRISPR/Cas system. In an example, the CRISPR/Cas component(s) arecomponent(s) of a Type IV CRISPR/Cas system. In an example, theCRISPR/Cas component(s) are component(s) of a Type V CRISPR/Cassystem. In an example, the CRISPR/Cas component(s) comprise aCas9-encoding nucleotide sequence (eg, S pyogenes Cas9, S. aureusCas9 or S. thermophilus Cas9). In an example, the CRISPR/Cascomponent(s) comprise a Cas3-encoding nucleotide sequence (eg, E.coli Cas3, C. dificile Cas3 or Salmonella Cas3). In an example, theCRISPR/Cas component(s) comprise a Cpf-encoding nucleotidesequence. In an example, the CRISPR/Cas component(s) comprise aCasX-encoding nucleotide sequence. In an example, the CRISPR/Cascomponent(s) comprise a CasY-encoding nucleotide sequence.

[0447] In an example, each carrier cell encodes a CRISPR/Cascomponent or protein of interest from a nucleotide sequence (NSI)comprising a promoter that is operable in the target bacteria.

[0448] Optionally, target bacteria are gram negative bacteria (eg,a spirilla or vibrio). Optionally, target bacteria are grampositive bacteria. Optionally, target bacteria are mycoplasma,chlamydiae, spirochete or mycobacterium bacteria. Optionally,target bacteria are Streptococcus (eg, pyogenes or thermophilus).Optionally, target bacteria are Staphylococcus (eg, aureus, eg,MRSA). Optionally, target bacteria are E. coli (eg, O157: H7), eg,wherein the Cas is encoded by the vecor or an endogenous targetcell Cas nuclease (eg, Cas3) activity is de-repressed. Optionally,target bacteria are Pseudomonas (eg, syringae or aeruginosa).Optionally, target bacteria are Vibro (eg, cholerae (eg, O139) orvulnificus). Optionally, target bacteria are Neisseria (eg,gonnorrhoeae or meningitidis). Optionally, target bacteria areBordetella (eg, pertussis). Optionally, target bacteria areHaemophilus (eg, influenzae). Optionally, target bacteria areShigella (eg, dysenteriae). Optionally, target bacteria areBrucella (eg, abortus). Optionally, target bacteria are Francisellahost. Optionally, target bacteria are Xanthomonas. Optionally,target bacteria are Agrobacterium. Optionally, target bacteria areErwinia. Optionally, target bacteria are Legionella (eg,pneumophila). Optionally, target bacteria are Listeria (eg,monocytogenes). Optionally, target bacteria are Campylobacter (eg,jejuni). Optionally, target bacteria are Yersinia (eg, pestis).Optionally, target bacteria are Borelia (eg, burgdorferi).Optionally, target bacteria are Helicobacter (eg, pylori).Optionally, target bacteria are Clostridium (eg, dificile orbotulinum). Optionally, target bacteria are Erlichia (eg,chaffeensis). Optionally, target bacteria are Salmonella (eg, typhior enterica, eg, serotype typhimurium, eg, DT 104). Optionally,target bacteria are Chlamydia (eg, pneumoniae). Optionally, targetbacteria are Parachlamydia host. Optionally, target bacteria areCorynebacterium (eg, amycolatum). Optionally, target bacteria areKlebsiella (eg, pneumoniae). Optionally, target bacteria areEnterococcus (eg, faecalis or faecim, eg, linezolid-resistant).Optionally, target bacteria are Acinetobacter (eg, baumannii, eg,multiple drug resistant).

[0449] Further examples of target cells are as follows:--

1. Optionally the target bacteria are Staphylococcus aureus cells,eg, resistant to an antibiotic selected from methicillin,vancomycin, linezolid, daptomycin, quinupristin, dalfopristin andteicoplanin. 2. Optionally the target bacteria are Pseudomonasaeruginosa cells, eg, resistant to an antibiotic selected fromcephalosporins (eg, ceftazidime), carbapenems (eg, imipenem ormeropenem), fluoroquinolones, aminoglycosides (eg, gentamicin ortobramycin) and colistin. 3. Optionally the target bacteria areKlebsiella (eg, pneumoniae) cells, eg, resistant to carbapenem. 4.Optionally the target bacteria are Streptococcus (eg, thermophilus,pneumoniae or pyogenes) cells, eg, resistant to an antibioticselected from erythromycin, clindamycin, beta-lactam, macrolide,amoxicillin, azithromycin and penicillin. 5. Optionally the targetbacteria are Salmonella (eg, serotype Typhi) cells, eg, resistantto an antibiotic selected from ceftriaxone, azithromycin andciprofloxacin. 6. Optionally the target bacteria are Shigellacells, eg, resistant to an antibiotic selected from ciprofloxacinand azithromycin. 7. Optionally the target bacteria areMycobacterium tuberculosis cells, eg, resistant to an antibioticselected from Resistance to isoniazid (INH), rifampicin (RMP),fluoroquinolone, amikacin, kanamycin and capreomycin andazithromycin. 8. Optionally the target bacteria are Enterococcuscells, eg, resistant to vancomycin. 9. Optionally the targetbacteria are Enterobacteriaceae cells, eg, resistant to anantibiotic selected from a cephalosporin and carbapenem. 10.Optionally the target bacteria are E. coli cells, eg, resistant toan antibiotic selected from trimethoprim, itrofurantoin, cefalexinand amoxicillin. 11. Optionally the target bacteria are Clostridium(eg, dificile) cells, eg, resistant to an antibiotic selected fromfluoroquinolone antibiotic and carbapenem. 12. Optionally thetarget bacteria are Neisseria gonnorrhoea cells, eg, resistant toan antibiotic selected from cefixime (eg, an oral cephalosporin),ceftriaxone (an injectable cephalosporin), azithromycin andtetracycline. 13. Optionally the target bacteria are Acinetoebacterbaumannii cells, eg, resistant to an antibiotic selected frombeta-lactam, meropenem and a carbapenem. 14. Optionally the targetbacteria are Campylobacter (eg, jejuni) cells, eg, resistant to anantibiotic selected from ciprofloxacin and azithromycin. 15.Optionally, the target cell(s) produce Beta (.beta.)-lactamase (eg,ESBL-producing E. coli or ESBL-producing Klebsiella). 16.Optionally, the target cell(s) are bacterial cells that areresistant to an antibiotic recited in any one of examples 1 to14.

[0450] In an example, the target cell(s) is a cell of a speciesselected from Shigella, E. coli, Salmonella, Serratia, Klebsiella,Yersinia, Pseudomonas and Enterobacter.

[0451] Optionally, the composition comprises carrier cells that areeach or in combination capable of conjugative transfer of firstDNAs into target cells of species selected from two or more ofShigella, E coli, Salmonella, Serratia, Klebsiella, Yersinia,Pseudomonas and Enterobacter.

[0452] In an example, the reduction in growth or proliferation ofcarrier cells is at least 50, 60, 70, 80, 90 or 95%. Optionally,the composition or carrier cell(s) are administered simultaneouslyor sequentially with an an antibiotic that is toxic to the targetcells. For example, the antibiotic can be any antibiotic disclosedherein.

[0453] Optionally, the expression of the NSI is under the controlof an inducible promoter that is operable in the target cell.Optionally, the expression of the NSI is under the control of aconstitutive promoter that is operable in the target cell.

[0454] In embodiments, the first DNA (eg, comprised by a plasmid)contains a screenable or selectable marker gene. For example, theselectable marker gene is an antibiotic resistance gene.

[0455] The carrier bacteria can be bacteria of a species or genusselected from those appearing in Table 5. For example, the speciesis found in warm-blooded animals (eg, livestock vertebrates). Forexample, the species is found in humans. For example, the speciesis found in plants. Preferably, non-pathogenic bacteria thatcolonize the non-sterile parts of the human or animal body (e.g.,skin, digestive tract, urogenital region, mouth, nasal passages,throat and upper airway, ears and eyes) are utilized as carriercells, and in an example the methodology of the invention is usedto combat a target cell bacterial infection of such a part of thebody of a human or animal. In another embodiment, the infection issystemic infection. Examples of particularly preferred carrierbacterial species include, but are not limited to: non-pathogenicstrains of Escherichia coli (E. coli F18, S17 and E. coli strainNissle), various species of Lactobacillus (such as L. casei, L.plantarum, L. paracasei, L. acidophilus, L. fermentum, L. zeae andL. gasseri), or other nonpathogenic or probiotic skin- or GIcolonizing bacteria such as Lactococcus, Bifidobacteria,Eubacteria, and bacterial mini-cells, which are anucleoid cellsdestined to die but still capable of transferring plasmids (see;e.g., Adler et al., Proc. Natl. Acad. Sci. USA 57; 321-326, 1970;Frazer and Curtiss III, Current Topics in Microbiology andImmunology 69: 1-84, 1975; U.S. Pat. No. 4,968,619 to Curtiss III).In some embodiments, the target recipient cells are pathogenicbacteria comprised by a human, animal or plant, eg, on the skin orin the digestive tract, urogenital region, mouth, nasal passage,throat and upper airway, eye(s) and ear(s). Of particular interestfor targeting and eradication are pathogenic strains of Pseudomonasaeruginosa, Escherichia coli, Staphylococcus pneumoniae and otherspecies, Enterobacter spp., Enterococcus spp. and Mycobacteriumtuberculosis. In an example, the target cell genus or species isany genus or species listed in Table 5.

[0456] The present invention finds use with a wide array ofsettings or environments, eg, in therapeutic, agricultural, orother settings, including, but not limited to, those described inU.S. Pat. Nos. 6,271,359, 6,261,842, 6,221,582, 6,153,381,6,106,854, and 5,627,275. Others are also discussed herein, andstill others will be readily apparent to those of skill in theart.

[0457] Numerous types of plasmids comprising the first DNA aresuitable for use in the present invention. In view of this, one ofskill in the art will appreciate that a single carrier bacterialstrain might harbor more than one type of such plasmid (eg,differing in the antibacterial agent that they encode). Further, inanother example two or more different carrier bacterial strains,each containing one or more such plasmids, may be combined for amulti-target effect, ie, for killing two or more different targetspecies or strains, or for killing the cells of the same species orstrain of target cell.

[0458] The present invention finds utility for treatment of humansand in a variety of veterinary, agronomic, horticultural and foodprocessing applications. For human and veterinary use, anddepending on the cell population or tissue targeted for protection,the following modes of administration of the carrier bacteria ofthe invention are contemplated: topical, oral, nasal, ocular,aural, pulmonary (e.g., via an inhaler), ophthalmic, rectal,urogenital, subcutaneous, intraperitoneal and intravenous. Thebacteria may be supplied as a pharmaceutical composition, in adelivery vehicle suitable for the mode of administration selectedfor the patient being treated. The term "patient" or "subject" asused here refers to humans or animals (animals being particularlyuseful as models for clinical efficacy of a particular donorstrain, for example, or being farmed or livestock animals).Commercially-relevant animals are chicken, turkey, duck, catfish,salmon, cod, herring, lobster, shrimp, prawns, cows, sheep, goats,pigs, goats, geese or rabbits.

[0459] For example, to deliver the carrier bacteria to thegastrointestinal tract or to the nasal passages, the preferred modeof administration may be by oral ingestion or nasal aerosol, or byfeeding (alone or incorporated into the subject's feed or foodand/or beverage, such as drinking water). In this regard, thecarrier cells may be comprised by a food of livestock (or farmed orcompanion animal), eg, the carrier bacteria are comprised by a feedadditive for livestock. Alternatively, the additive is a beverage(eg, water) additive for livestock. It should be noted thatprobiotic bacteria, such as Lactobacillus acidophilus, are sold asgel capsules containing a lyophilized mixture of bacterial cellsand a solid support such as mannitol. When the gel capsule isingested with liquid, the lyophilized cells are re-hydrated andbecome viable, colonogenic bacteria. Thus, in a similar fashion,carrier bacterial cells of the present invention can be supplied asa powdered, lyophilized preparation in a gel capsule, or in bulk,eg, for sprinkling onto food or beverages. The re-hydrated, viablebacterial cells will then populate and/or colonze sites throughoutthe upper and/or lower gastrointestinal system, and thereafter comeinto contact with the target bacteria.

[0460] For topical applications, the carrier bacteria may beformulated as an ointment or cream to be spread on the affectedskin surface. Ointment or cream formulations are also suitable forrectal or vaginal delivery, along with other standard formulations,such as suppositories. The appropriate formulations for topical,vaginal or rectal administration are well known to medicinalchemists. The present invention will be of particular utility fortopical or mucosal administrations to treat a variety of bacterialinfections or bacterially related undesirable conditions. Somerepresentative examples of these uses include treatment of (1)conjunctivitis, caused by Haemophilus sp., and corneal ulcers,caused by Pseudomonas aeruginosa; (2) otititis externa, caused byPseudomonas aeruginosa; (3) chronic sinusitis, caused by manyGram-positive cocci and Gram-negative rods, or for generaldecontamination of bronchii; (4) cystic fibrosis, associated withPseudomonas aeruginosa; (5) enteritis, caused by Helicobacterpylori (eg, to treat or prevent gastric ulcers), Escherichia coli,Salmonella typhimurium, Campylobacter or Shigella sp.; (6) openwounds, such as surgical or non-surgical, eg, as a prophylacticmeasure; (7) burns to eliminate Pseudomonas aeruginosa or otherGram-negative pathogens; (8) acne, eg, caused by Propionobacteracnes; (9) nose or skin infection, eg, caused by metlncillinresistant Staphylococcus aureus (MSRA); (10) body odor, eg, causedby Gram-positive anaerobic bacteria (i.e., use of carrier cells indeodorants); (11) bacterial vaginosis, eg, associated withGardnerella vaginalis or other anaerobes; and (12) gingivitisand/or tooth decay caused by various organisms.

[0461] In one example, the target cells are E. coli cells and thedisease or condition to be treated in a human is a uterine tractinfection or a ventilator associated infection, eg, pneumonia.

[0462] In other embodiments, the carrier cells of the presentinvention find application in the treatment of surfaces for theremoval or attenuation of unwanted target bacteria, for example usein a method of treating such a surface or an environment comprisingtarget bacteria, wherein the method comprises contacting thesurface or environment with carrier bacteria of the invention,allowing conjugative transfer of the first DNA of the inventionfrom the carrier to the target bacteria, and allowing theantibacterial agent to kill target cells. For example, surfacesthat may be used in invasive treatments such as surgery,catheterization and the like may be treated to prevent infection ofa subject by bacterial contaminants on the surface. It iscontemplated that the methods and compositions of the presentinvention may be used to treat numerous surfaces, objects,materials and the like (e.g., medical or first aid equipment,nursery and kitchen equipment and surfaces) to control bacterialcontamination thereon.

[0463] Pharmaceutical preparations or other compositions comprisingthe carrier bacteria may be formulated in dosage unit form for easeof administration and uniformity of dosage. Dosage unit form, asused herein, refers to a physically discrete unit of thepharmaceutical preparation appropriate for the patient or plant orenvironment or surface undergoing treatment. Each dosage shouldcontain a quantity of the carrier bacteria calculated to producethe desired antibacterial effect in association with the selectedcarrier. Procedures for determining the appropriate dosage unit arewell known to those skilled in the art. Dosage units may beproportionately increased or decreased based on the weight of apatient, plant, surface or environment. Appropriate concentrationsfor achieving eradication of pathogenic target cells (eg, comprisedby a tissue of the patient) may be determined by dosageconcentration curve calculations, as known in the art.

[0464] Other uses for the carrier bacteria of the invention arealso contemplated. These include a variety agricultural,horticultural, environmental and food processing applications. Forexample, in agriculture and horticulture, various plant pathogenicbacteria may be targeted in order to minimize plant disease. Oneexample of a plant pathogen suitable for targeting is Erwinia (eg,E. amylovora, the causal agent of fire blight). Similar strategiesmay be utilized to reduce or prevent wilting of cut flowers. Forveterinary or animal farming, the carrier cells of the inventionmay be incorporated into animal feed (chicken, swine, poultry,goat, sheep, fish, shellfish or cattle feed) to reduce bio-burdenor to eliminate certain pathogenic organisms (e.g., Salmonella,such as in chicken, turkey or other poultry). In other embodiments,the invention may be applied on meat or other foods to eliminateunwanted or pathogenic bacteria (e.g., E. coli O157:1H7 on meat, orProteus spp., one cause of "fishy odour" on seafood).

[0465] Environmental utilities comprise, for example, engineeringcarrier bacteria, eg, Bacillus thurengiensis and one of itsconjugative plasmids, to deliver and conditionally express aninsecticidal agent in addition to or instead of an antibacterialagent (e.g., for the control of mosquitos that disseminate malariaor West Nile virus). In such applications, as well as in theagricultural and horticultural or other applications describedabove, formulation of the carrier bacteria as solutions, aerosols,or gel capsules are contemplated.

[0466] In preferred embodiments of the present invention, certainfeatures are employed in the DNA, plasmids and carrier cells of theinvention to minimize potential risks associated with the use ofengineered DNA or genetically modified organisms in theenvironment. For instance, eg, in environmentally sensitivecircumstances, it may be advantageous to utilisenon-self-transmissible DNA or plasmids. Instead, the DNA orplasmids will be mobilisable by conjugative machinery but will notbe self-transmissible. This may be accomplished in some embodimentsby integrating into the carrier cell chromosome all or some of thetra genes whose products are necessary for the assembly ofconjugative machinery. In such embodiments, DNA or plasmids of theinvention are configured to possess an origin of transfer (oriT)but not the tra genes that are provided on the cell's chromosome.This feature prevents the recipient killer cell, before or evenafter it dies, from transferring the killer DNA or plasmid further.Another biosafety feature comprises utilizing conjugation systemswith predetermined host-ranges. Certain elements are known tofunction only in few related bacteria (narrow-host-range) andothers are known to function in many unrelated bacteria(broad-host-range or promiscuous) (del Solar et al., Mol.Microbiol. 32: 661-666, 1996; Zatyka and Thomas, FEMS Microbiol.Rev. 21: 291-319, 1998). Also, many of those conjugation systemscan function in either gram-positive or gram-negative bacteria butgenerally not in both (del Solar, 1996, supra; Zatyka and Thomas,1998).

[0467] Inadvertant proliferation of antibiotic resistance may beminimized in embodiments by avoiding the use of antibioticresistance markers on the DNA or plasmids of the invention whichare conjugatively transferred into target cells. In an alternativeapproach, the gene responsible for the synthesis of an amino acid(i.e. serine) can be mutated, generating the requirement for thisamino acid in the donor. Such mutant bacteria will prosper on medialacking serine provided that they contain a plasmid with the sergene whose product is needed for growth. Thus, the inventioncontemplates the advantageous use of plasmids containing the sergene or another nutritional genetic marker. These markers willpermit selection and maintenance of the DNA or plasmids in carriercells. Another biosafety approach comprises the use ofrestriction-modification systems to modulate the host range of theDNA or plasmids. Conjugation and plasmid establishment are expectedto occur more frequently between taxonomically related species inwhich plasmid can evade restriction systems and replicate. Type IIrestriction endonucleases make a double-strand break within or neara specific recognition sequence of duplex DNA. Cognate modificationenzymes can methylate the same sequence and protect it fromcleavage. Restriction-modification systems (RM) are ubiquitous inbacteria and archaebacteria but are absent in eukaryotes. Some ofRM systems are plasmid-encoded, while others are on the bacterialchromosome (Roberts and Macelis, Nucl. Acids Res. 24: 223-235,1998). Restriction enzymes cleave foreign DNA such as viral orplasmid DNA when this DNA has not been modified by the appropriatemodification enzyme. In this way, cells are protected from invasionof foreign DNA. Thus, by using a carrier strain producing one ormore methylases, cleavage by one or more restriction enzymes couldbe evaded. Site-directed mutagenesis is used to produce plasmid DNAthat is either devoid of specific restriction sites or thatcomprises new sites, protecting or making plasmid DNA vulnerable,respectively against endonucleases. Broad-host range plasmids (eg.RP4) may evade restriction systems simply by not having many of therestriction cleavage sites that are typically present onnarrow-host plasmids (Willkins et al., 1996, J. Mol. Biol 258,447-456). Preferred embodiments of the present invention alsoutilize environmentally safe bacteria as carriers. For example,delivery of DNA vaccines by attenuated intracellular gram-positiveand gram-negative bacteria has been reported (Dietrich et al., 2001Vaccine 19, 2506-2512; Grillot-Courvalin et al, 1999 CurrentOpinion in Biotech. 10, 477-481). In addition, the donor strain canbe one of thousands of harmless bacteria that colonize thenon-sterile parts of the body (e.g., skin, gastrointestinal,urogenital, mouth, nasal passages, throat and upper airwaysystems). Examples of preferred donor (ie, carrier) bacterialspecies are set forth hereinabove.

[0468] In another strategy, non-dividing, non-growing carrier cellsare utilized instead of living cells. Minicells and maxicells arewell studied model systems of metabolically active but nonviablebacterial cells. Minicells lack chromosomal DNA and are generatedby special mutant cells that undergo cell division without DNAreplication. If the cell contains a multicopy plasmid, many of theminicells will contain plasmids. Minicells neither divide nor grow.However, minicells that possess conjugative plasmids are capable ofconjugal replication and transfer of plasmid DNA to livingrecipient cells. (Adler et al., 1970, supra; Frazer and Curtiss,1975, supra; U.S. Pat. No. 4,968,619, supra). Maxicells can beobtained from a strain of E. coli that carries mutations in the keyDNA repair pathways (recA, uvrA and phr). Because maxicells lack somany DNA repair functions, they die upon exposure to low doses ofUV. Importantly, plasmid molecules (e.g., pBR322) that do notreceive an UV hit continue to replicate. Transcription andtranslation (plasmid-directed) can occur efficiently under suchconditions (Sancar et al., J. Bacteriol. 137: 692-693, 1979), andthe proteins made prior to irradiation should be sufficient tosustain conjugation. This is supported by the following twoobservations: i) that streptomycin-killed cells remain activedonors, and ii) that transfer of conjugative plasmids can occur inthe presence of antibiotics that prevent de novo gene expression(Heineman and Ankenbauer, 1993, J. Bacteriol. 175, 583-588; Cooperand Heineman, 2000. Plasmid 43, 171-175). Accordingly, UV-treatedmaxicells will be able to transfer plasmid DNA to live recipients.It should also be noted that the conservation of recA and uvrAgenes among bacteria should allow maxicells of donor strains otherthan E. coli to be obtained.

[0469] Also contemplated for use in the invention are any of themodified bacteria that cannot function because they containtemperature-sensitive mutation(s) in genes that encode foressential cellular functions (e.g., cell wall, protein synthesis,RNA synthesis, as described, for example, in U.S. Pat. No.4,968,619, supra).

[0470] In an alternative, archaea are used instead of bacteria forthe carrier cells. Additionally or alternatively, the target cellsare archaeal cells.

[0471] As used herein, the term "carrier cell" includes dividingand/or non-dividing bacterial cells (minicells and maxicells), orconditionally non-functional cells.

[0472] In an example the first DNA is comprised by an engineeredRK2 plasmid (ie, a RK2 plasmid that has been modified byrecombinant DNA technology or a progeny of such a modifiedplasmid). Plasmid RK2 is a promiscuous plasmid that can replicatein 29 (and probably many more) gram-negative species (Guiney andLanka, 1989, p 27-54. In C. M. Thomas (ed) Promiscous plasmids ingram-negative bacteria. London, Ltd London United Kingdom). PlasmidRK2 is a 60-kb self-transmissible plasmid with a completenucleotide sequence known (Pansegrau et al., 1994, J. Mol. Biol.239, 623-663). A minimal replicon derived from this large plasmidhas been obtained that is devoid of all its genes except for a trfAgene, that encodes plasmid's Rep protein called TrfA, and an originof vegetative replication oriV For a review of RK2 replication andits control by TrfA protein, see Helinski et al., 1996 (InEscherichia coli and Salmonella Cellular and Molecular Biology,Vol. 2 (ed. F. Neidhardt, et al., 2295-2324, ASM Press, WashingtonD.C.).

[0473] In an example the first DNA is comprised by an engineeredR6K plasmid (ie, a R6K plasmid that has been modified byrecombinant DNA technology or a progeny of such a modifiedplasmid).

[0474] The present invention is optionally for an industrial ordomestic use, or is used in a method for such use. For example, itis for or used in agriculture, oil or petroleum industry, food ordrink industry, clothing industry, packaging industry, electronicsindustry, computer industry, environmental industry, chemicalindustry, aerospace industry, automotive industry, biotechnologyindustry, medical industry, healthcare industry, dentistryindustry, energy industry, consumer products industry,pharmaceutical industry, mining industry, cleaning industry,forestry industry, fishing industry, leisure industry, recyclingindustry, cosmetics industry, plastics industry, pulp or paperindustry, textile industry, clothing industry, leather or suede oranimal hide industry, tobacco industry or steel industry.

[0475] The present invention is optionally for use in an industryor the environment is an industrial environment, wherein theindustry is an industry of a field selected from the groupconsisting of the medical and healthcare; pharmaceutical; humanfood; animal food; plant fertilizers; beverage; dairy; meatprocessing; agriculture; livestock farming; poultry farming; fishand shellfish farming; veterinary; oil; gas; petrochemical; watertreatment; sewage treatment; packaging; electronics and computer;personal healthcare and toiletries; cosmetics; dental; non-medicaldental; ophthalmic; non-medical ophthalmic; mineral mining andprocessing; metals mining and processing; quarrying; aviation;automotive; rail; shipping; space; environmental; soil treatment;pulp and paper; clothing manufacture; dyes; printing; adhesives;air treatment; solvents; biodefence; vitamin supplements; coldstorage; fibre retting and production; biotechnology; chemical;industrial cleaning products; domestic cleaning products; soaps anddetergents; consumer products; forestry; fishing; leisure;recycling; plastics; hide, leather and suede; waste management;funeral and undertaking; fuel; building; energy; steel; and tobaccoindustry fields.

[0476] In an example, the first DNA comprises a CRISPR array thattargets target bacteria, wherein the array comprises one, or two ormore different spacers (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40,50 or more spacers) for targeting the genome of targetbacteria.

[0477] In an example, the target bacteria are comprised by anenvironment as follows. In an example, the environment is amicrobiome of a human, eg, the oral cavity microbiome or gutmicrobiome or the bloodstream. In an example, the environment isnot an environment in or on a human. In an example, the environmentis not an environment in or on a non-human animal. In anembodiment, the environment is an air environment. In anembodiment, the environment is an agricultural environment. In anembodiment, the environment is an oil or petroleum recoveryenvironment, eg, an oil or petroleum field or well. In an example,the environment is an environment in or on a foodstuff or beveragefor human or non-human animal consumption. In an example, theenvironment is a maritime environment, eg, in seawater or on a boat(eg, in ship or boat ballast water).

[0478] In an example, the environment is a a human or animalmicrobiome (eg, gut, vaginal, scalp, armpit, skin or oral cavitymicrobiome). In an example, the target bacteria are comprised by ahuman or animal microbiome (eg, gut, vaginal, scalp, armpit, skinor oral cavity microbiome).

[0479] In an example, the carrier bacteria or composition of theinvention are administered intranasally, topically or orally to ahuman or non-human animal, or is for such administration. Theskilled person aiming to treat a microbiome of the human or animalwill be able to determine the best route of administration,depending upon the microbiome of interest. For example, when themicrobiome is a gut microbiome, administration can be intranasallyor orally. When the microbiome is a scalp or armpit microbiome,administration can be topically. When the microbiome is in themouth or throat, the administration can be orally.

[0480] In an example, the environment is harboured by a beverage orwater (eg, a waterway or drinking water for human consumption) orsoil. The water is optionally in a heating, cooling or industrialsystem, or in a drinking water storage container.

[0481] In an example, the carrier and/or target bacteraia areFirmicutes selected from Anaerotruncus, Acetanaerobacterium,Acetitomaculum, Acetivibrio, Anaerococcus, Anaerofilum,Anaerosinus, Anaerostipes, Anaerovorax, Butyrivibrio, Clostridium,Capracoccus, Dehalobacter, Dialister, Dorea, Enterococcus,Ethanoligenens, Faecalibacterium, Fusobacterium, Gracilibacter,Guggenheimella, Hespellia, Lachnobacterium, Lachnospira,Lactobacillus, Leuconostoc, Megamonas, Moryella, Mitsuokella,Oribacterium, Oxobacter, Papillibacter, Proprionispira,Pseudobutyrivibrio, Pseudoramibacter, Roseburia, Ruminococcus,Sarcina, Seinonella, Shuttleworthia, Sporobacter, Sporobacterium,Streptococcus, Subdoligranulum, Syntrophococcus, Thermobacillus,Turibacter and Weisella.

[0482] In an example, the carrier bacteria, composition, use ormethod is for reducing pathogenic infections or for re-balancinggut or oral biofilm eg, for treating or preventing obesity ordisease in a human or animal; or for treating or preventing a GIcondition (such as Crohn's disease, IBD or colitis). For example,the DNA, carrier bacteria, composition, use or method is forknocking-down Salmomnella, Campylobacter, Erwinia, Xanthomonous,Edwardsiella, Pseudomonas, Klebsiella, Pectobacterium, Clostridiumdificile or E. coli bacteria in a gut biofilm of a human or animalor a plant, preferably in a human or animal.

[0483] In an example, the animal is a chicken, eg, and the targetbacteria are Salmonella or Campylobacter. In an example, the animalis a fish (eg, catfish or salmon) or shellfish (eg, prawn orlobster), eg, and the target bacteria are Edwardsiella. In anexample, the plant is a potato plant and, eg, the target bacteriaare Pectobacterium. In an example, the plant is a cabbage plantand, eg, the target bacteria are Xanthomonous (eg, X. campestris).In an example, the plant is a marijuana plant and, eg, the targtbacteria are Pseudomonas (eg, P. cannabina or P. amygdali),Agrobacterium (eg, A. tumefaciens) or Xanthomonas (eg, X.campestris). In an example, the plant is a hemp plant and, eg, thetargt bacteria are are Pseudomonas (eg, P. cannabina or P.amygdali), Agrobacterium (eg, A. tumefaciens) or Xanthomonas (eg,X. campestris).

[0484] In an example, the disease or condition is a cancer,inflammatory or autoimmune disease or condition, eg, obesity,diabetes IBD, a GI tract condition or an oral cavity condition.

[0485] Optionally, the environment is comprised by, or the targetbacteria are comprised by, a gut biofilm, skin biofilm, oral cavitybiofilm, throat biofilm, hair biofilm, armpit biofilm, vaginalbiofilm, rectal biofilm, anal biofilm, ocular biofilm, nasalbiofilm, tongue biofilm, lung biofilm, liver biofilm, kidneybiofilm, genital biofilm, penile biofilm, scrotal biofilm, mammarygland biofilm, ear biofilm, urethra biofilm, labial biofilm, organbiofilm or dental biofilm. Optionally, the environment is comprisedby, or the target bacteria are comprised by, a plant (eg, atobacco, crop plant, fruit plant, vegetable plant or tobacco, eg onthe surface of a plant or contained in a plant) or by anenvironment (eg, soil or water or a waterway or aqueousliquid).

[0486] In an example, the carrier cell(s) or composition is fortreating a disease or condition in an animal or human, wherein thedisease or condition. In an example, the disease or condition iscaused by or mediated by an infection of target cells comprised bythe subject or patient. In an example, the disease or condition isassociated with an infection of target cells comprised by thesubject or patient.

[0487] In an example, a symptom of the disease or condition is aninfection of target cells comprised by the subject or patient.

[0488] Optionally, the disease or condition of a human or animalsubject is selected from [0489] (a) A neurodegenerative disease orcondition; [0490] (b) A brain disease or condition; [0491] (c) ACNS disease or condition; [0492] (d) Memory loss or impairment;[0493] (e) A heart or cardiovascular disease or condition, eg,heart attack, stroke or atrial fibrillation; [0494] (f) A liverdisease or condition; [0495] (g) A kidney disease or condition, eg,chronic kidney disease (CKD); [0496] (h) A pancreas disease orcondition; [0497] (i) A lung disease or condition, eg, cysticfibrosis or COPD; [0498] (j) A gastrointestinal disease orcondition; [0499] (k) A throat or oral cavity disease or condition;[0500] (l) An ocular disease or condition; [0501] (m) A genitaldisease or condition, eg, a vaginal, labial, penile or scrotaldisease or condition; [0502] (n) A sexually-transmissible diseaseor condition, eg, gonorrhea, HIV infection, syphilis or Chlamydiainfection; [0503] (o) An ear disease or condition; [0504] (p) Askin disease or condition; [0505] (q) A heart disease or condition;[0506] (r) A nasal disease or condition [0507] (s) A haematologicaldisease or condition, eg, anaemia, eg, anaemia of chronic diseaseor cancer; [0508] (t) A viral infection; [0509] (u) A pathogenicbacterial infection; [0510] (v) A cancer; [0511] (w) An autoimmunedisease or condition, eg, SLE; [0512] (x) An inflammatory diseaseor condition, eg, rheumatoid arthritis, psoriasis, eczema, asthma,ulcerative colitis, colitis, Crohn's disease or IBD; [0513] (y)Autism; [0514] (z) ADHD; [0515] (aa) Bipolar disorder; [0516] (bb)ALS [Amyotrophic Lateral Sclerosis]; [0517] (cc) Osteoarthritis;[0518] (dd) A congenital or development defect or condition; [0519](ee) Miscarriage; [0520] (ff) A blood clotting condition; [0521](gg) Bronchitis; [0522] (hh) Dry or wet AMD; [0523] (ii)Neovascularisation (eg, of a tumour or in the eye); [0524] (jj)Common cold; [0525] (kk) Epilepsy; [0526] (ll) Fibrosis, eg, liveror lung fibrosis; [0527] (mm) A fungal disease or condition, eg,thrush; [0528] (nn) A metabolic disease or condition, eg, obesity,anorexia, diabetes, Type I or Type II diabetes. [0529] (oo)Ulcer(s), eg, gastric ulceration or skin ulceration; [0530] (pp)Dry skin; [0531] (qq) Sjogren's syndrome; [0532] (rr) Cytokinestorm; [0533] (ss) Deafness, hearing loss or impairment; [0534](tt) Slow or fast metabolism (ie, slower or faster than average forthe weight, sex and age of the subject); [0535] (uu) Conceptiondisorder, eg, infertility or low fertility; [0536] (vv) Jaundice;[0537] (ww) Skin rash; [0538] (xx) Kawasaki Disease; [0539] (yy)Lyme Disease; [0540] (zz) An allergy, eg, a nut, grass, pollen,dust mite, cat or dog fur or dander allergy; [0541] (aaa) Malaria,typhoid fever, tuberculosis or cholera; [0542] (bbb) Depression;[0543] (ccc) Mental retardation; [0544] (ddd) Microcephaly; [0545](eee) Malnutrition; [0546] (fff) Conjunctivitis; [0547] (ggg)Pneumonia; [0548] (hhh) Pulmonary embolism; [0549] (iii) Pulmonaryhypertension; [0550] (jjj) A bone disorder; [0551] (kkk) Sepsis orseptic shock; [0552] (lll) Sinusitus; [0553] (mmm) Stress (eg,occupational stress); [0554] (nnn) Thalassaemia, anaemia, vonWillebrand Disease, or haemophilia; [0555] (ooo) Shingles or coldsore; [0556] (ppp) Menstruation; [0557] (qqq) Low sperm count.

Neurodegenerative or CNS Diseases or Conditions for Treatment orPrevention by the Invention

[0558] In an example, the neurodegenerative or CNS disease orcondition is selected from the group consisting of Alzheimerdisease, geriopsychosis, Down syndrome, Parkinson's disease,Creutzfeldt-jakob disease, diabetic neuropathy, Parkinson syndrome,Huntington's disease, Machado-Joseph disease, amyotrophic lateralsclerosis, diabetic neuropathy, and Creutzfeldt Creutzfeldt-Jakobdisease. For example, the disease is Alzheimer disease. Forexample, the disease is Parkinson syndrome.

[0559] In an example, wherein the method of the invention ispractised on a human or animal subject for treating a CNS orneurodegenerative disease or condition, the method causesdownregulation of Treg cells in the subject, thereby promotingentry of systemic monocyte-derived macrophages and/or Treg cellsacross the choroid plexus into the brain of the subject, wherebythe disease or condition (eg, Alzheimer's disease) is treated,prevented or progression thereof is reduced. In an embodiment themethod causes an increase of IFN-gamma in the CNS system (eg, inthe brain and/or CSF) of the subject. In an example, the methodrestores nerve fibre and/or reduces the progression of nerve fibredamage. In an example, the method restores nerve myelin and/orreduces the progression of nerve myelin damage. In an example, themethod of the invention treats or prevents a disease or conditiondisclosed in WO2015136541 and/or the method can be used with anymethod disclosed in WO2015136541 (the disclosure of this documentis incorporated by reference herein in its entirety, eg, forproviding disclosure of such methods, diseases, conditions andpotential therapeutic agents that can be administered to thesubject for effecting treatment and/or prevention of CNS andneurodegenerative diseases and conditions, eg, agents such asimmune checkpoint inhibitors, eg, anti-PD-1, anti-PD-L1, anti-TIM3or other antibodies disclosed therein).

Cancers for Treatment or Prevention by the Method

[0560] Cancers that may be treated include tumours that are notvascularized, or not substantially vascularized, as well asvascularized tumours. The cancers may comprise non-solid tumours(such as haematological tumours, for example, leukaemias andlymphomas) or may comprise solid tumours. Types of cancers to betreated with the invention include, but are not limited to,carcinoma, blastoma, and sarcoma, and certain leukaemia or lymphoidmalignancies, benign and malignant tumours, and malignancies e.g.,sarcomas, carcinomas, and melanomas. Adult tumours/cancers andpaediatric tumours/cancers are also included.

[0561] Haematologic cancers are cancers of the blood or bonemarrow. Examples of haematological (or haematogenous) cancersinclude leukaemias, including acute leukaemias (such as acutelymphocytic leukaemia, acute myelocytic leukaemia, acutemyelogenous leukaemia and myeloblasts, promyeiocytic,myelomonocytic, monocytic and erythroleukaemia), chronic leukaemias(such as chronic myelocytic (granulocytic) leukaemia, chronicmyelogenous leukaemia, and chronic lymphocytic leukaemia),polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin'slymphoma (indolent and high grade forms), multiple myeloma,Waldenstrom's macroglobulinemia, heavy chain disease,myeiodysplastic syndrome, hairy cell leukaemia andmyelodysplasia.

[0562] Solid tumours are abnormal masses of tissue that usually donot contain cysts or liquid areas. Solid tumours can be benign ormalignant. Different types of solid tumours are named for the typeof cells that form them (such as sarcomas, carcinomas, andlymphomas). Examples of solid tumours, such as sarcomas andcarcinomas, include fibrosarcoma, myxosarcoma, liposarcoma,chondrosarcoma, osteosarcoma, and other sarcomas, synovioma,mesothelioma, Ewing's tumour, leiomyosarcoma, rhabdomyosarcoma,colon carcinoma, lymphoid malignancy, pancreatic cancer, breastcancer, lung cancers, ovarian cancer, prostate cancer,hepatocellular carcinoma, squamous eel! carcinoma, basal cellcarcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroidcarcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceousgland carcinoma, papillary carcinoma, papillary adenocarcinomas,medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma,hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumour,cervical cancer, testicular tumour, seminoma, bladder carcinoma,melanoma, and CNS tumours (such as a glioma (such as brainstemglioma and mixed gliomas), glioblastoma (also known as glioblastomamultiforme) astrocytoma, CNS lymphoma, germinoma, medu!loblastoma,Schwannoma craniopharyogioma, ependymoma, pineaioma,hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma,neuroblastoma, retinoblastoma and brain metastases).

Autoimmune Diseases for Treatment or Prevention by the Method

[0563] 1. Acute Disseminated Encephalomyelitis (ADEM) [0564] 2.Acute necrotizing hemorrhagic leukoencephalitis [0565] 3. Addison'sdisease [0566] 4. Agammaglobulinemia [0567] 5. Alopecia areata[0568] 6. Amyloidosis [0569] 7. Ankylosing spondylitis [0570] 8.Anti-GBM/Anti-TBM nephritis [0571] 9. Antiphospholipid syndrome(APS) [0572] 10. Autoimmune angioedema [0573] 11. Autoimmuneaplastic anemia [0574] 12. Autoimmune dysautonomia [0575] 13.Autoimmune hepatitis [0576] 14. Autoimmune hyperlipidemia [0577]15. Autoimmune immunodeficiency [0578] 16. Autoimmune inner eardisease (AIED) [0579] 17. Autoimmune myocarditis [0580] 18.Autoimmune oophoritis [0581] 19. Autoimmune pancreatitis [0582] 20.Autoimmune retinopathy [0583] 21. Autoimmune thrombocytopenicpurpura (ATP) [0584] 22. Autoimmune thyroid disease [0585] 23.Autoimmune urticaria [0586] 24. Axonal & neuronal neuropathies[0587] 25. Balo disease [0588] 26. Behcet's disease [0589] 27.Bullous pemphigoid [0590] 28. Cardiomyopathy [0591] 29. Castlemandisease [0592] 30. Celiac disease [0593] 31. Chagas disease [0594]32. Chronic fatigue syndrome [0595] 33. Chronic inflammatorydemyelinating polyneuropathy (CIDP) [0596] 34. Chronic recurrentmultifocal osteomyelitis (CRMO) [0597] 35. Churg-Strauss syndrome[0598] 36. Cicatricial pemphigoid/benign mucosal pemphigoid [0599]37. Crohn's disease [0600] 38. Cogans syndrome [0601] 39. Coldagglutinin disease [0602] 40. Congenital heart block [0603] 41.Coxsackie myocarditis [0604] 42. CREST disease [0605] 43. Essentialmixed cryoglobulinemia [0606] 44. Demyelinating neuropathies [0607]45. Dermatitis herpetiformis [0608] 46. Dermatomyositis [0609] 47.Devic's disease (neuromyelitis optica) [0610] 48. Discoid lupus[0611] 49. Dressler's syndrome [0612] 50. Endometriosis [0613] 51.Eosinophilic esophagitis [0614] 52. Eosinophilic fasciitis [0615]53. Erythema nodosum [0616] 54. Experimental allergicencephalomyelitis [0617] 55. Evans syndrome [0618] 56. Fibromyalgia[0619] 57. Fibrosing alveolitis [0620] 58. Giant cell arteritis(temporal arteritis) [0621] 59. Giant cell myocarditis [0622] 60.Glomerulonephritis [0623] 61. Goodpasture's syndrome [0624] 62.Granulomatosis with Polyangiitis (GPA) (formerly called Wegener'sGranulomatosis) [0625] 63. Graves' disease [0626] 64.Guillain-Barre syndrome [0627] 65. Hashimoto's encephalitis [0628]66. Hashimoto's thyroiditis [0629] 67. Hemolytic anemia [0630] 68.Henoch-Schonlein purpura [0631] 69. Herpes gestationis [0632] 70.Hypogammaglobulinemia [0633] 71. Idiopathic thrombocytopenicpurpura (ITP) [0634] 72. IgA nephropathy [0635] 73. IgG4-relatedsclerosing disease [0636] 74. Immunoregulatory lipoproteins [0637]75. Inclusion body myositis [0638] 76. Interstitial cystitis [0639]77. Juvenile arthritis [0640] 78. Juvenile diabetes (Type 1diabetes) [0641] 79. Juvenile myositis [0642] 80. Kawasaki syndrome[0643] 81. Lambert-Eaton syndrome [0644] 82. Leukocytoclasticvasculitis [0645] 83. Lichen planus [0646] 84. Lichen sclerosus[0647] 85. Ligneous conjunctivitis [0648] 86. Linear IgA disease(LAD) [0649] 87. Lupus (SLE) [0650] 88. Lyme disease, chronic[0651] 89. Meniere's disease [0652] 90. Microscopic polyangiitis[0653] 91. Mixed connective tissue disease (MCTD) [0654] 92.Mooren's ulcer [0655] 93. Mucha-Habermann disease [0656] 94.Multiple sclerosis [0657] 95. Myasthenia gravis [0658] 96. Myositis[0659] 97. Narcolepsy [0660] 98. Neuromyelitis optica (Devic's)[0661] 99. Neutropenia [0662] 100. Ocular cicatricial pemphigoid[0663] 101. Optic neuritis [0664] 102. Palindromic rheumatism[0665] 103. PANDAS (Pediatric Autoimmune Neuropsychiatric DisordersAssociated with Streptococcus) [0666] 104. Paraneoplasticcerebellar degeneration [0667] 105. Paroxysmal nocturnalhemoglobinuria (PNH) [0668] 106. Parry Romberg syndrome [0669] 107.Parsonnage-Turner syndrome [0670] 108. Pars planitis (peripheraluveitis) [0671] 109. Pemphigus [0672] 110. Peripheral neuropathy[0673] 111. Perivenous encephalomyelitis [0674] 112. Perniciousanemia [0675] 113. POEMS syndrome [0676] 114. Polyarteritis nodosa[0677] 115. Type I, II, & III autoimmune polyglandularsyndromes [0678] 116. Polymyalgia rheumatica [0679] 117.Polymyositis [0680] 118. Postmyocardial infarction syndrome [0681]119. Postpericardiotomy syndrome [0682] 120. Progesteronedermatitis [0683] 121. Primary biliary cirrhosis [0684] 122.Primary sclerosing cholangitis [0685] 123. Psoriasis [0686] 124.Psoriatic arthritis [0687] 125. Idiopathic pulmonary fibrosis[0688] 126. Pyoderma gangrenosum [0689] 127. Pure red cell aplasia[0690] 128. Raynauds phenomenon [0691] 129. Reactive Arthritis[0692] 130. Reflex sympathetic dystrophy [0693] 131. Reiter'ssyndrome [0694] 132. Relapsing polychondritis [0695] 133. Restlesslegs syndrome [0696] 134. Retroperitoneal fibrosis [0697] 135.Rheumatic fever [0698] 136. Rheumatoid arthritis [0699] 137.Sarcoidosis [0700] 138. Schmidt syndrome [0701] 139. Scleritis[0702] 140. Scleroderma [0703] 141. Sjogren's syndrome [0704] 142.Sperm & testicular autoimmunity [0705] 143. Stiff personsyndrome [0706] 144. Subacute bacterial endocarditis (SBE) [0707]145. Susac's syndrome [0708] 146. Sympathetic ophthalmia [0709]147. Takayasu's arteritis [0710] 148. Temporal arteritis/Giant cellarteritis [0711] 149. Thrombocytopenic purpura (TTP) [0712] 150.Tolosa-Hunt syndrome [0713] 151. Transverse myelitis [0714] 152.Type 1 diabetes [0715] 153. Ulcerative colitis [0716] 154.Undifferentiated connective tissue disease (UCTD) [0717] 155.Uveitis [0718] 156. Vasculitis [0719] 157. Vesiculobullousdermatosis [0720] 158. Vitiligo [0721] 159. Wegener'sgranulomatosis (now termed Granulomatosis with Polyangiitis(GPA).

Inflammatory Diseases for Treatment or Prevention by the Method

[0721] [0722] 1. Alzheimer [0723] 2. ankylosing spondylitis [0724]3. arthritis (osteoarthritis, rheumatoid arthritis (RA), psoriaticarthritis) [0725] 4. asthma [0726] 5. atherosclerosis [0727] 6.Crohn's disease [0728] 7. colitis [0729] 8. dermatitis [0730] 9.diverticulitis [0731] 10. fibromyalgia [0732] 11. hepatitis [0733]12. irritable bowel syndrome (IBS) [0734] 13. systemic lupuserythematous (SLE) [0735] 14. nephritis [0736] 15. Parkinson'sdisease [0737] 16. ulcerative colitis.

Growth Promoters & Lowering Food Conversion Ratios

[0738] The Examples demonstrate that target bacteria can betargeted using an antibacterial agent to promote growth and enhanceFCR in poultry. In the Example, a guided nuclease system was usedto specifically target Salmonella in the poultry.

[0739] In a first aspect, there is provided:--

[0740] A method of promoting the growth of an animal (eg, alivestock animal, eg, a poultry animal), the method comprisingadministering to the animal a guided nuclease system or a componentthereof, and introducing the system or component into targetbacteria comprised by the animal, wherein the guided nuclease iscapable of recognising and modifying (eg, cutting) a targetnucleotide sequence comprised by the target bacteria, wherebytarget bacteria are killed or the growth or proliferation of targetbacteria are inhibited and the growth of the animal ispromoted.

[0741] The method is a non-medical method and the presence oftarget bacteria in the animal is capable of inhibiting the growthof the animal. Thus, the method reduces the burden of such bacteriain the animal and promotes growth.

[0742] In a second aspect there is provided:--

[0743] A method of enhancing feed conversion ratio (FCR) in ananimal (eg, a livestock animal, eg, a poultry animal), the methodcomprising administering to the animal a guided nuclease system ora component thereof, and introducing the system or component intotarget bacteria comprised by the animal, wherein the guidednuclease is capable of recognising and modifying (eg, cutting) atarget nucleotide sequence comprised by the target bacteria,whereby target bacteria are killed or the growth or proliferationof target bacteria are inhibited and the FCR of the animal isenhanced.

[0744] The method is a non-medical method and the presence oftarget bacteria in the animal is capable of increasing the FCR ofthe animal. Thus, the method reduces the burden of such bacteria inthe animal and enhances FCR (ie, reduces FCR number).

[0745] In a third aspect there is provided:--

[0746] A method of promoting the growth of an animal (eg, alivestock animal, eg, a poultry animal), the method comprisingadministering to the animal an antibacterial agent that is toxic toSalmonella bacteria, wherein Salmonella target bacteria comprisedby the animal are exposed to the agent and are killed or the growthor proliferation of target bacteria are inhibited and the growth ofthe animal is promoted.

[0747] The method is a non-medical method and the presence oftarget bacteria in the animal is capable of inhibiting the growthof the animal. Thus, the method reduces the burden of such bacteriain the animal and promotes growth.

[0748] In a fourth aspect there is provided:--

[0749] A method of enhancing feed conversion ratio (FCR) in ananimal (eg, a livestock animal, eg, a poultry animal), the methodcomprising administering to the animal an antibacterial agent thatis toxic to Salmonella bacteria, wherein Salmonella target bacteriacomprised by the animal are exposed to the agent and are killed orthe growth or proliferation of target bacteria are inhibited andthe FCR of the animal is enhanced.

[0750] The method is a non-medical method and the presence oftarget bacteria in the animal is capable of increasing the FCR ofthe animal. Thus, the method reduces the burden of such bacteria inthe animal and enhances FCR (ie, reduces FCR number).

[0751] In any of these aspects, optionally the animal is alivestock animal. Optionally, the animal is a bird, eg, a poultrybird, eg, a chicken, turkey, goose or duck. Preferably, the animalis a chicken.

[0752] In any of these aspects, optionally the bacteria areEnterobacteriaciae bacteria, eg, Salmonella. For example, thebacteria are Salmonella enterica, typhimurium or enteritidis. Forexample, the Salmonella is any Salmonella species or straindisclosed herein.

[0753] For example, the system, component or agent is supplied tothe animal in an animal feed and/or beverage (eg, mixed in drinkingwater). When supplied in a beverage, the system, component or agentmay be comprised by carrier bacteria, wherein the carrier bacteriaare comprised in the beverage at an amount of from 1.times.10.sup.3to 1.times.10.sup.10 (eg, from 1.times.10.sup.4 to1.times.10.sup.10; from 1.times.10.sup.4 to 1.times.10.sup.9; from1.times.10.sup.4 to 1.times.10.sup.8; from 1.times.10.sup.4 to1.times.10.sup.7; from 1.times.10.sup.3 to 1.times.10.sup.10; from1.times.10.sup.3 to 1.times.10.sup.9; from 1.times.10.sup.3 to1.times.10.sup.8; from 1.times.10.sup.3 to 1.times.10.sup.7; from1.times.10.sup.5 to 1.times.10.sup.10; from 1.times.10.sup.5 to1.times.10.sup.9; from 1.times.10.sup.5 to 1.times.10.sup.8; from1.times.10.sup.5 to 1.times.10.sup.7; from 1.times.10.sup.6 to1.times.10.sup.10; from 1.times.10.sup.6 to 1.times.10.sup.9; from1.times.10.sup.6 to 1.times.10.sup.8; or from 1.times.10.sup.6 to1.times.10.sup.7) cfu/ml. When supplied in a beverage, the system,component or agent may be comprised by carrier bacteria, whereinthe carrier bacteria are comprised in the beverage at an amount ofat least 1.times.10.sup.8 cfu/ml, eg, wherein the animal is apoultry bird, such as a chicken.

[0754] Optionally, the guided nuclease is any guided nucleasedisclosed herein, eg, a Cas, TALEN, meganuclease or a zinc fingernuclease. In an example, the component is a crRNA or guide RNA thatis operable in target cells with a cognate Cas nuclease. The Casnuclease can be any Cas nuclease disclosed herein. The Cas nucleasemay be an endogenous Cas of the target cells or may be encoded byan exogenous nucleic acid that is administered to the animal.

[0755] Systems, components and agents of the invention may beintroduced into target bacteria by bacterial conjugation (eg,conjugative transfer from a carrier cell to the target cell) or byphage wherein the phage transduce into the target cells nucleicacid encoding the system, component or agent.

[0756] Optionally, the target bacteria are comprised by anymicrobiota disclosed herein that is found in animals. Preferably,the microbiota is a gut microbiota (eg, a gut microbiota of achicken).

[0757] The livestock animal can be any livestock animal disclosedherein, eg, a chicken, pig, cow, sheep, farmed fish (such as salmonor catfish) or farmed shellfish (eg, lobster, prawn or shrimp).

[0758] It will be understood that particular embodiments describedherein are shown by way of illustration and not as limitations ofthe invention. The principal features of this invention can beemployed in various embodiments without departing from the scope ofthe invention. Those skilled in the art will recognize, or be ableto ascertain using no more than routine study, numerous equivalentsto the specific procedures described herein. Such equivalents areconsidered to be within the scope of this invention and are coveredby the claims. All publications and patent applications mentionedin the specification are indicative of the level of skill of thoseskilled in the art to which this invention pertains. Allpublications and patent applications and all US equivalent patentapplications and patents are herein incorporated by reference tothe same extent as if each individual publication or patentapplication was specifically and individually indicated to beincorporated by reference. The use of the word "a" or "an" whenused in conjunction with the term "comprising" in the claims and/orthe specification may mean "one," but it is also consistent withthe meaning of "one or more," "at least one," and "one or more thanone." The use of the term "or" in the claims is used to mean"and/or" unless explicitly indicated to refer to alternatives onlyor the alternatives are mutually exclusive, although the disclosuresupports a definition that refers to only alternatives and"and/or." Throughout this application, the term "about" is used toindicate that a value includes the inherent variation of error forthe device, the method being employed to determine the value, orthe variation that exists among the study subjects.

[0759] As used in this specification and claim(s), the words"comprising" (and any form of comprising, such as "comprise" and"comprises"), "having" (and any form of having, such as "have" and"has"), "including" (and any form of including, such as "includes"and "include") or "containing" (and any form of containing, such as"contains" and "contain") are inclusive or open-ended and do notexclude additional, unrecited elements or method steps

[0760] The term "or combinations thereof" or similar as used hereinrefers to all permutations and combinations of the listed itemspreceding the term. For example, "A, B, C, or combinations thereofis intended to include at least one of: A, B, C, AB, AC, BC, orABC, and if order is important in a particular context, also BA,CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example,expressly included are combinations that contain repeats of one ormore item or term, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA,CABABB, and so forth. The skilled artisan will understand thattypically there is no limit on the number of items or terms in anycombination, unless otherwise apparent from the context.

[0761] Any part of this disclosure may be read in combination withany other part of the disclosure, unless otherwise apparent fromthe context.

[0762] All of the compositions and/or methods disclosed and claimedherein can be made and executed without undue experimentation inlight of the present disclosure. While the compositions and methodsof this invention have been described in terms of preferredembodiments, it will be apparent to those of skill in the art thatvariations may be applied to the compositions and/or methods and inthe steps or in the sequence of steps of the method describedherein without departing from the concept, spirit and scope of theinvention. All such similar substitutes and modifications apparentto those skilled in the art are deemed to be within the spirit,scope and concept of the invention as defined by the appendedclaims.

EXAMPLES

Example 1: Target Gene Sequence Assessment & crRNA ArrayDesign

List of Putative Target Genes in Salmonella

[0763] Through careful analysis and decision making, we compiledthe following target genes for assessment by cutting usingCRISPR/Cas components delivered by conjugative plasmids fromcarrier cells as per the invention.

1) pipA Pathogenicity island encoded protein: SPI5 2) mViM putativevirulence factor 3) mViN putative virulence factor 4) phoPTranscribes genes expressed under low Mg+ concentration (OmpRfamily); virulence transcriptional regulatory protein PHOP 5) hilAInvasion genes transcription activator 6) BigA putativesurface-exposed virulence protein 7) sugR ATP binding protein;Pathogenicity island encoded protein: SPI3 8) rhuM Pathogenicityisland encoded protein: SPI3 9) pipC invasion gene Eprotein/Pathogenicity island encoded protein: SPI5 10) pipBPathogenicity island encoded protein: SPI5 11) sicP chaperonerelated to virulence 12) sopB invasion gene D protein/Pathogenicityisland encoded protein: SPI5 13) marT putative transcriptionalregulatory protein/Pathogenicity island encoded protein: SPI3

Target Selection

[0764] Initial target selection of Salmonella-specific genesidentified 13 putative candidates located almost exclusively inSalmonella pathogenicity islands (listed at the start of thisexample). After close inspection, the list of targets was reducedto seven genes, namely pipA, pipB, pipC, hilA, marT, sicP and sopB,that we found importantly showed no significant sequence homologyto other genes from Enterobacteria, thus enabling high specificityof targeting Salmonella cells in vivo and in microbiomes containingnon-target Enterobacteria of different (non-Salmonella) species.Target sites for S. pyogenes Cas9 defined by presence of the PAMmotif (NGG) were extracted using the respective function availablein molecular biology software. A number of 6 to 14 putative targetsites were identified in each of the seven selected genes.

crRNA Design and Synthesis

[0765] To select target sites most likely to result in efficientrestriction of dsDNA, all potential sequences were screened for thepresence of nucleotides at key position that have been described tohave positive or negative effects on the efficiency of doublestrand cuts introduced by Cas9 in the available literature. Threepublications reported such data, although on sgRNA: [0766] (1)Doench et al. 2014, Nature Biotechnology [0767] (2) Gagnon et al.2014, PLoS One [0768] (3) Liu et al. 2016, Scientific Reports

[0769] One target sequence for each gene that adhered to most ofthe parameters described influencing restriction efficiency in eachof the three publications was selected to be incorporated into acrRNA array, resulting in three arrays to be tested. crRNA arrayswere designed based on the sequence data from S. pyogenes(published in Deltcheva et al. 2011, Nature). The followingsequences were constructed: SEQ ID NOs: 1-3.

[0770] Two of these sequences encoding crRNAs were assembled withsequences encoding cognate tracrRNA and Cas9.

Cas9 Constructs (tracrRNA-Cas9-crRNA)

[0771] The selected sequences encoding crRNAs were combined withdifferent versions of the tracrRNA-Cas9 modules, resulting in avaried set of plasmids.

[0772] For constitutive expression of all components (tracrRNA,Cas9 and crRNA), a tracr-Cas fragment based on plasmid pCas9 (Jianget al. 2013, Nature Biotechnology; sequence presented as SEQ ID NO:4) was amplified from S. pyogenes gDNA. We will join this fragmentwith the available crRNA-encoding fragments and clone into highcopy number general cloning plasmid pJet1.2. This series ofconstruct is named pFS1.

[0773] To determine whether expression of this constitutiveCRISPR/Cas construct in a low copy number background will work asefficiently, we will move the system described above into a lowcopy number plasmid. pFS2 constructs are therefore based on the lowcopy number pSC101 origin from pZS21MCS (Expressys).

[0774] To control expression of at least one of the CRISPR/Cascomponents by means of an inducible promoter, we will replace theconstitutive Cas9 promoter with the TetR regulated promoterPLtetO-1. The resulting plasmids of pFS3 are based on the low copynumber pSC101 origin of pZS21MCS as well. The introduced changeswill be as follows: [0775] Spacing between RBS and Start ATG hasbeen shortened to 7 bp (TAAATAC) [0776] Stop codon has been changedfrom a less effective TGAC to a tandem TAATAAT sequence

[0777] Lastly, we will produce a mobilisable version of theconstitutively expressed plasmids like pFS1 and pFS2 mentionedabove. To this end, we will clone the origin of transfer (oriT) ofplasmid RP4 into an intermediate copy number plasmid (p15A origin)carrying a chloramphenicol resistance. This construct should beable to be mobilised and transferred by a chromosomally integratedconjugation machinery as present in RP4 and other mobilisableplasmids.

Further Constructs

[0778] To determine the efficiency of dsDNA restriction by theselected crRNAs prior to a final selection and transformation intoSalmonella, we will aim to clone the target genes (or substantialparts thereof) into a compatible plasmid. The plasmid selected ispZA31MCS (Expressys) with a p15A origin compatible to thepFS1/pFS2/pFS3 constructs described above. Efficiency can then betested in E. coli by loss of chloramphenicol resistance (or loss offluorescence if a yfp derivative is present as a reporter). Thebest performing target sequences can then be used in future, moretargeted plasmids.

We made the following plasmids:-- [0779] pFSmob-CtracrRNA/Cas9--mob--pZA31MCS [0780] pFSmobSal7tracrRNA/Cas9--Salcr7-3--mob--pZA31MCS [0781] pFSmobSal3tracrRNA/Cas9--Salcr3.2--mob--pZA31MCS [0782] pFSmob-C* controlbased on Salcr7-3--mob--pZA31MCS

Plasmid Details

[0782] [0783] Plasmid Name: pFSmob-C [0784] Description: p15Aorigin plasmid based on pZA31MCS (Expressys) carrying 4768 bpinsert (tracrRNA-Cas9-oriT/mob) [0785] Plasmid Length: 6685 bp[0786] Sequence verified: Yes; Insert sequence verified by primerwalking sequencing [0787] Additional Notes: No crRNA array present;Control plasmid

Plasmid Details

[0787] [0788] Plasmid Name: pFSmobSal7 [0789] Description: p15Aorigin plasmid based on pZA31MCS (Expressys) carrying 5598 bpinsert (tracrRNA-Cas9-crRNA-oriT/mob) [0790] Plasmid Length: 7515bp [0791] Sequence verified: Yes; Insert sequence verified byprimer walking sequencing

Plasmid Details

[0791] [0792] Plasmid Name: pFSmobSal3 [0793] Description: p15Aorigin plasmid based on pZA31MCS (Expressys) carrying 5341 bpinsert (tracrRNA-Cas9-crRNA-oriT/mob) [0794] Plasmid Length: 7258bp [0795] Sequence verified: Yes; Insert sequence verified byprimer walking sequencing

Plasmid Details

[0795] [0796] Plasmid Name: pFSmob-C* [0797] Description: p15Aorigin plasmid based on pZA31MCS (Expressys) [0798] Plasmid Length:7348 bp [0799] Sequence verified: Yes; Insert sequence verified byprimer walking sequencing

Example 2: Selectively Removal of Unwanted Salmonella Strains byConjugation Using a Guided Nuclease

Purpose of the Study

[0800] The objective of this study was to selectively removeunwanted Salmonella strains by conjugation experiment. We mobilisedthe pFSMobSal7 plasmid from E. coli S17 to Salmonella spp. Thisplasmid contains tracr-Cas9 the crRNA-encoding array (Sal7-3) andthe origin of transfert (oriT).

SUMMARY

[0801] As a proof of concept the conjugation experiment was firstdone from E. coli to E. coli before mobilising to Salmonella spp.The plasmid pFSMobSal7 (chloramphenicol resistant, CmR) was firsttransformed into a carrier strain that allows the mobilisation. Inthis experiment, the strain that produced the pilus was E. coli S17(ATCC.RTM. 47055TM). The conjugative functions are provided by anRP4 plasmid integrated into the chromosome. The recipient cellshould be Nalidixic acid resistant (25 .mu.g/ml), here we used E.coli JM109 (ATCC.RTM. 53323TM). The Salmonella targeted was FS26from our Salmonella spp collection. The results showed a goodefficiency of conjugation from E. coli S17 to E. coli JM109 andfrom E. coli S17 to Salmonella enteritidis (FS26). Afterconjugation to Salmonella as a recipient the killing with pFSMob-3was efficient.

Introduction

[0802] The pFSmobSal7 plasmid was originated from the intermediatedcopy number pZA31MCS (Expressys). An origin of transfer (OriT)sequence was synthesised (called mob2) and cloned into pZA31MCS byassembly method in addition to the tracr-Cas9 and the crRNA arrayfragments.

[0803] Before starting the conjugation experiment, E. coli S17strains were made electro-competent by a standard protocol(O'Challahan and Charbit, 1990). Plasmids pFSMobsal7 and pFSMobC*were then transformed into E. coli S17 by electroporation andselected in chloramphenicol (Cm30, 30 .mu.g/mL).

[0804] pFSMobSal7 and pFSMobC* were mobilised from the donor E.coli S17 to the recipient E. coli JM109 and to Salmonella spp thatare Nalidixic resistant (NalR) and chloramphenicol sensitive (CmS)by mating on a filter followed by an incubation at 37.degree. C.The mixtures were then plated in Cm30, Nal25 and Cm30+Nal25. Thetransconjugants were selected in double antibiotics Cm30+Nal25(Phornphisutthimas et al, 2007).

[0805] Note that before starting the conjugation experiment, theefficiency of killing of pFSMob plasmids were first tested bytransformation in Salmonella.

Methodology

Material:

[0806] Donor strain: E. coli S17 transformed withpFSMobSal7/pFSMobC* [0807] Recipient strains: JM109/Salmonellaenteritidis FS26 [0808] Luria Bertani Broth (LB) (Product numberL3522, Sigma-Aldrich), LB Cm30 g/ml [0809] Plates of LB agar 1%[0810] Plates of LB agar 1% Cm30 g/ml [0811] Plates of LB agar 1%NaL25 g/ml [0812] Plates of LB agar 1% Cm30+NaL25 [0813]Whatman.RTM. membrane filters nylon, pore size 0.45 m to 1 m,diameter 25 mm. Reference number 28420770 supplied bySigma-Aldrich

Experiment 1: Mobilisation of pFSMobC* from E. coli S17 to E. coliJM109

[0814] As a proof of concept, the conjugation experiment was donefirst from E. coli S17 containing a control plasmid (pFSMobC*) toE. coli JM109. This experiment followed the protocol from ofPhornphisutthimas (Phornphisutthimas et al, 2007): [0815] 1. Growovernight cultures of donors pFSMobC*(S17) from our collection inLB+Cm30 and recipient strain JM109 in LB broth. [0816] 2. In themorning pre-warm the plates of LB agar (1%) for at least 30 minutesbefore starting the experiment [0817] 3. Mix the donor strains withthe recipient at the ratio of 1:1 as following: [0818] 4. 50 W ofpFSMobC*(S17)+50 .mu.l of JM109 [0819] 5. 50 W of pFSMobC*(S17)+50.mu.l of LB [0820] 6. 50 W of LB+50 .mu.l of JM109 [0821] 7. Foreach reaction, put a filter membrane (0.45 .mu.M to 1 .mu.M) on thetop of the pre-warmed LB agar plate (1%) [0822] 8. Load each sampleof mating on a filter [0823] 9. Leave the plates 3 hours at37.degree. C. without shaking, the LB will be absorbed and thebacteria should stay on the filter [0824] 10. After incubation, puteach filter into a universal tube with lml LB broth and vortex well[0825] 11. Plate 100 .mu.l (And serial dilution) on Cm30, Nal25 andCm30+Nal25, leave O.N at 37.degree. C.

[0826] The plates of Cm30 give the number of donors. Plates ofNal25 give the number of recipient and plates of Nal25+Cm30 givethe number of transconjugants (i.e plasmid mobilised from donor torecipient). Plates with donors and recipient alone (no mating) arenegative controls

Results

[0827] 1) After 18 hours at 37.degree. C. colonies wereindividually counted at different dilutions, when countable, andthe number of colonies was expressed as cfu/mL. No colonies wererecovered on negative control plates, as expected (Data not shown).The results (Table 1) show a good efficiency of conjugation from E.coli S17 to E. coli JM109.

TABLE-US-00001 TABLE 1 Conjugation of pFSMobC* from E. coli S17 toE. coli JM109. Results obtained from mating on filter after 3 hoursof incubation at 37.degree. C. Number of Number of Number ofConjugative donors per ml recipient per ml transconjugants perplasmid S17 (Cm30) .sup.a JM109 (Nal25) .sup.a ml (Cm30 + Nal25).sup.a Efficiency .sup.b pFSMobC* 9.46*10.sup.4 1.004*10.sup.52.35*10.sup.4 2.4*10.sup.-1 .sup.a All the controls have beenchecked. .sup.b The efficiency of conjugation is the number oftransconjugants per donor cell

[0828] 2) The mobilisation of pFSmobC* plasmid in the recipientstrain was confirmed by PCR. Primers spCas9-6 forward(5'-ATTGTTTGTGGAGCAGCATAAGC)(SEQ ID NO: 8) and mob2 reverse(5'-GCCTCTAGCACGCGTACCATGGGAT) (SEQ ID NO: 9) were used with anannealing temperature of 50.degree. C. Two colonies from plateswith transconjugants have been tested by PCR. Positive controlswere also included (FIG. 1).

Conclusion 1

[0829] The conjugation experiment from E. coli to E. coli has showna good efficiency of mobilisation. Further optimisation tests on E.coli conjugation showed a higher efficiency of conjugation when themating was incubated for 6 hours at 37.degree. C. with a ratio of1:4.

Experiment 2: Conjugation of pFSMobSal7 from E. coli S17 toSalmonella Spp

[0830] This experiment is following the protocol from ofPhornphisutthimas (Phornphisutthimas et al, 2007) and Carraro etal, 2017 with some modifications: [0831] 1. Grow overnight culturesof pFSMobSal7 (S17) and the control pFSMobC*(S17) from ourcollection in LB+Cm30 and recipient strain Salmonella enteritidisFS26 in LB broth. [0832] 2. In the morning, pre-warm the plates ofLB agar (1%) for at least 30 minutes before starting the experiment[0833] 3. Mix the donor strains with the recipient at the ratio of1:4 as following: [0834] 4. 100 .mu.l of pFSMobC*(S17)+400 .mu.l ofSalmonella FS26 [0835] 5. 100 .mu.l of pFSMobSal7(S17)+400 .mu.l ofSalmonella FS26 [0836] 6. 100 .mu.l of pFSMobC*(S17)+400 .mu.l ofLB [0837] 7. 100 .mu.l of pFSMobSal7 (S17)+400 .mu.l of LB [0838]8. 100 .mu.l of LB+400 .mu.l of Salmonella [0839] 9. Spin at2000.times.g for 3 minutes [0840] 10. Resuspend in 200 .mu.l of LB[0841] 11. Spin at 2000.times.g for 3 minutes [0842] 12. Resuspendin 25 .mu.l of LB [0843] 13. For each reaction, put a filtermembrane (0.45 .mu.M to 1 .mu.M) on the top of the pre-warmed LBagar plate (1%) [0844] 14. Load each sample of mating on a filter[0845] 15. Leave the plates 6 hours at 37.degree. C. withoutshaking, the LB will be absorbed and the bacteria should stay onthe filter [0846] 16. After incubation, put each filter into auniversal tube with 1 ml LB broth and vortex well [0847] 17. Plate100 .mu.l (And serial dilution) on Cm30, Nal25 and Cm30+Nal25,leave O.N at 37.degree. C.

[0848] The plates of Cm30 plates give the number of donors. Platesof Nal25 give the number of recipient and plates of Nal25+Cm30 givethe number of transconjugants (i.e plasmid mobilised from donor torecipient).

Results

[0849] After 18 hours at 37.degree. C. colonies were individuallycounted at dilution -3, and the number of colonies was expressed ascfu/mL (Table 2). No colonies were recovered on negative controlplates, as expected (Data not shown).

TABLE-US-00002 [0849] TABLE 2 Conjugation experiment results ofpFSMob plasmids from E. coli S17 to Salmonella enteritidis FS26.Results obtained from mating of a filter for 6 hours at 37.degree.C. Donor Recipient Number of Conjugative S17/ml FS26/ml Number oftransconjugants/ Conjugation plasmid (Cm30) (Nal25) transconjugantsml (Cm30 + Nal25) efficiency.sup.a pFSMobC* 6.6*10.sup.6 Full 727.2*10.sup.5 1.09*10.sup.-1 pFSMobSal7 4.7*10.sup.6 Full 0 0 0

[0850] In comparison with the plasmid control pFSMobC*, these datashow that the plasmid pFSMobSal7 delivered to the target strain byconjugation is able to remove by 100% the strain Salmonellaenteritidis (FS26) (FIG. 2).

Conclusion

[0851] The study showed that the conjugation is a good method ofdelivery from E. coli S17 to Salmonella enteritidis (FS26) and thatpFSMobSal7 is still efficiently killing when delivered to therecipient by conjugation. Conjugation was able to remove (kill)100% of the Salmonella.

REFERENCES

[0852] Carraro N, Durand R, Rivard N, Anquetil C, Barrette C,Humbert M, Burrus V. (2017). Salmonella genomic island 1 (SGI1)reshapes the mating apparatus of IncC conjugative plasmids topromote self-propagation. PLOS Gen. [0853] O'Challahan D, CharbitA. (1990). High efficiency transformation of Salmonella typhimuriumand Salmonella typhi by electroporation. Mol. Gen. Genet., 223;156-8. [0854] Phornphisutthimas S, Thamchaipenet A, and Panijpan B.(2007). Conjugation in Escherichia coli. Biochem and Mol BioEducation Vol. 35, No. 6, 440-445

Example 3: Pan-Serotype Conjugative Transfer and Killing ofSalmonella

Purpose of the Study

[0855] The purpose of this study was to test the in vitro abilityof pFSmobSal7 and pFSmobSal3 plasmids to selectively removeSalmonella enterica subsp. enterica serotypes by conjugation.

Summary

[0856] Eighteen strains of Salmonella enterica subsp. enterica,serovars Typhimurium (4), Enteritidis (1), Virchow (1), Montevideo(1), Heidelberg (1), Hadar (1), Binza (1), Bredeney (1), Infantis(1), Kentucky (1), Seftenberg (1), Mbandaka (1), Anatum (1), Agona(1) and Dublin (1), were selected from our Salmonella spp.collection (Table 3). Bacteria were made competent and transformedwith two versions of pFSmob plasmid, i.e. pFSmobSal7 andpFSmobSal3, two versions of pFSmob control plasmid, i.e. pFSmob-C*and pFSmob-C, and pZA31MCS (Expressys) as further control. Afterelectroporation and 2 hrs of incubation in SOC Outgrowth Medium(NEB, B90205, LOT-10019857) at 37.degree. C., different dilutionsof the original solution were plated out on 1% LB agar supplementedby chloramphenicol (Cm.sub.30, 30 g/mL). Plates were incubated at37.degree. C. for 18 hrs. Results were interpreted as colonyforming unit/mL (CFU/mL).

Introduction

[0857] The pFSmobSal7 and pFSmobSal3 plasmids carry on their crRNAarrays 7 target genes (pipA, pipB, pipC, hilA, sicP, mart, sopB),and 3 target genes (pipC, hilA, mart), respectively. Positivecontrol pFSmob-C originated from pFSmobSal7 plasmid was used, inparticular pFSmob-C does not contain the crRNA array. ControlpFSmob-C originated from the intermediated copy number pZA31MCS(Expressys) used as a further control. Selection of positivecolonies was performed on chloramphenicol (Cm.sub.30, 30 g/mL). Itwas previously showed the in vitro ability of pFSmobSal7 toselectively remove by transformation Salmonella enterica serovarTyphimurium, Enteritidis, Virchow, Montevideo, Hadar and Binza. Thepurpose of this study was to assess all the Salmonella spp.serotypes present in our collection, in order to evaluate the invitro ability of both pFSmobSal7 and pFSmobSal3 plasmids toselectively unwanted bacteria; in order to collect significantresults, 18 different serotypes were selected from our collectionand tested by electroporation (Table 3). Plasmids pFSmob-C,pFSmob-C* and pZA31MCS (Expressys) were used as controls.

Methodology

[0858] Bacterial strains were recovered from frozen stock kept at-80.degree. C., and cultured at 37.degree. C. for 24 hrs (Edwardsand Ewing, 1986). Susceptibility to Cm.sub.30 (30 g/mL) was testedusing an agar dilution method in accordance with EUCAST clinicalbreakpoint tables. Bacteria were made competent using O'Challahanand Charbit protocol (O'Challahan and Charbit, 1990). All theselected strains were transformed with 100 ng of pFSmobSal7,pFSmobSal3, pFSmob-C, pFSmob-C*, and pZA31MCS (Expressys); anegative control was also included (competent cells without theaddition of DNA) (Table 4). After 18 hrs of incubation, countablecolonies (number of colonies between 30 and 300) were expressed asnumber of colonies per mL (CFU/mL) (Table 4).

TABLE-US-00003 TABLE 3 Salmonella spp. collection. Eighteen strainsof Salmonella enterica subsp. enterica, serovars Typhimurium (4),Enteritidis (1), Virchow (1), Montevideo (1), Heidelberg (1), Hadar(1), Binza (1), Bredeney (1), Infantis (1), Kentucky (1),Seftenberg (1), Mbandaka (1), Anatum (1), Agona (1) and Dublin (1),were selected from our Salmonella spp. collection. Collection noSalmonella sertypes FS2 Typhimurium FS3 Typhimurium FS10Typhimurium FS11 Typhimurium FS11 Typhimurium FS26 Enteritidis FS35Virchow FS38 Montevideo FS41 Heidelberg FS42 Hadar FS43 Binza FS44Bredeney FS50 Infantis FS58 Kentucky FS60 Seftenberg FS61 MbandakaFS62 Anatum FS64 Agona FS67 Dublin

Results

[0859] All the bacteria selected were found to be susceptible toCm.sub.30 according to EUCAST breakpoints (EUCAST, 2013). Afterelectroporation and plating of different dilutions (undiluted,10.sup.-1, 10.sup.-2) on LB agar plates (Fisher Bioreagents,BP1425-500, LOT-171784) supplemented with Cm.sub.30 (30 g/mL)(Sigma), plates were incubated for 18 hrs at 37.degree. C. Bacteriawere considered transformed when they grew on Cm.sub.30 (30 g/mL)agar plates. Countable colonies (between 30 and 300) were expressedas CFU/ml (Table 4). No colonies were recovered on negative controlplates, as expected. All the serotypes but one (FS67, S. Dublin)were efficiently transformed with pZA31MCS (Expressys). Almost allthe serotypes were efficiently transformed with the two controlplasmids (pFSmob-C* and pFSmob-C) with a number of colonies between10.sup.2 and 10.sup.6 CFU/mL.

[0860] With regard to pFSmobSal7 and pFSmobSal3, the killing effectoccurred in all the serotypes and it was found to be similar. Inthe majority of the serotypes, a decreasing in the number ofcolonies was relatively evident in comparison to the onestransformed with the control plasmids. No significant differenceswere found between pFSmobSal7 and pFSmobSal3 in their killingeffect, except in one strain (FS38, S. Montevideo).

TABLE-US-00004 TABLE 4 Transformation of 18 Salmonella spp.serotypes. Eighteen Salmonella spp. Serotypes were transformed withpZA31MCS (Expressys), pFSmob-C*, pFSmob- C, pFSmobSal7, andpFSmobSal3. Almost all the serotypes were efficiently transformedwith pZA31MCS (Expressys), pFSmob-C*, and pFSmob-C, with someexceptions. No significant differences were observed in thetransformation with pFSmobSal7 and pFSmobSal3. Strain FS67, S.Dublin, was found to be not transformable (NT*) with all theplasmids used in this study. Collection Serotype pZA31MCS pFSmob-C*pFSmob-C pFSmobSal7 pFSmobSal3 FS2 Typhimurium 4.8*10{circumflexover ( )}4 1*10{circumflex over ( )}5 4*10{circumflex over ( )}4 06*10{circumflex over ( )}1 FS3 Typhimurium 5*10{circumflex over ()}5 1*10{circumflex over ( )}5 3*10{circumflex over ( )}3 .sup.1*10{circumflex over ( )}1 6*10{circumflex over ( )}1 FS10Typhimurium 5*10{circumflex over ( )}5 0 1.1*10{circumflex over ()}2.sup. 0 0 FS11 Typhimurium 4.7*10{circumflex over ( )}47*10{circumflex over ( )}2 4.1*10{circumflex over ( )}2.sup. 0 0FS26 Enteritidis >1*10{circumflex over ( )}6 9*10{circumflexover ( )}5 >1*10{circumflex over ( )}6 .sup. 3*10{circumflexover ( )}1 4*10{circumflex over ( )}1 FS35 Virchow>1*10{circumflex over ( )}6 2.8*10{circumflex over ( )}3.sup.1.3{circumflex over ( )}10{circumflex over ( )}4 0 0 FS38Montevideo >1*10{circumflex over ( )}6 2.1*10{circumflex over ()}4.sup. 4.2*10{circumflex over ( )}4.sup. 1.4*10{circumflex over ()}2 0 FS41 Heidelberg 1.1*10{circumflex over ( )}44.1*10{circumflex over ( )}2.sup. 6*10{circumflex over ( )}2 0 0FS42 Hadar >1*10{circumflex over ( )}6 7*10{circumflex over ()}2 0 0 0 FS43 Binza 1.7*10{circumflex over ( )}4 7*10{circumflexover ( )}1 1*10{circumflex over ( )}1 0 0 FS44 Bredeney>1*10{circumflex over ( )}6 1*10{circumflex over ( )}59*10{circumflex over ( )}4 1.7*10{circumflex over ( )}33*10{circumflex over ( )}3 FS50 Infantis 1*10{circumflex over ( )}41.8*10{circumflex over ( )}2.sup. 2*10{circumflex over ( )}3 04*10{circumflex over ( )}1 FS58 Kentucky 1.7*10{circumflex over ()}4 7.5*10{circumflex over ( )}3.sup. 3.6*10{circumflex over ()}3.sup. 0 0 FS60 Seftenberg >1*10{circumflex over ( )}61.2*10{circumflex over ( )}5.sup. >1*10{circumflex over ( )}5.sup. 2*10{circumflex over ( )}1 2.4*10{circumflex over ( )}2.sup.FS61 Mbandaka 2*10{circumflex over ( )}2 2*10{circumflex over ( )}10 0 0 FS62 Anatum 1.4*10{circumflex over ( )}3 4*10{circumflex over( )}1 0 0 0 FS64 Agona >1*10{circumflex over ( )}6>1*10{circumflex over ( )}6 3*10{circumflex over ( )}47.8*10{circumflex over ( )}2 3*10{circumflex over ( )}3 FS67 DublinNT* NT NT NT NT

Conclusion

[0861] All the Salmonella spp. serotypes used in this experimentwere efficiently made competent and transformed with pZA31MCS(Expressys), pFSmob-C and pFSmob-C* used as controls. SalmonellaTyphimurium serotype seems not to be always transformable bypFSmob-C*, as observed previously. More in general, no particulardifferences occurred between the two pFSmob-derived controlplasmids used in this study (between 10.sup.2 and 10.sup.6 CFU/mL).On the other hand, the killing effect of pFSmobSal7 and pFSmobSal3was found to be similar (between 101 and 103). In conclusion, inthis study it was demonstrated that pFSmobSal7 and pFSmobSal3 canselectively remove different Salmonella spp. serotypes incomparison with the control plasmids.

REFERENCE

[0862] Edwards P R, Ewing W H. (1986). Identification ofEnterobateriaceae (4.sup.th ed.). Elsevier, New York. EUCAST,European Committee on Antimicrobial Susceptibility Testing. (2013).Breakpoint tables for interpretation of MICs and zone diameters.Available at: http://www.eucast.org (last accessed Aug. 16, 2013,Version 3.1. [0863] O'ChallahanD, Charbit A. (1990). Highefficiency transformation of Salmonella typhimurium and Salmonellatyphi by electroporation. Mol. Gen. Genet., 223; 156-8.

Example 4: Feed Conversion Ratio Improvement in Chickens. CombinedSecond 2 Week Efficacy, 2 Week Safety and 6 Week ProductivityTrial

[0864] Purpose of study [0865] To determine the effectantibacterial conjugative plasmids (pFSmobSal7) on the health,welfare and productivity of chickens over 6 weeks.

Methodology

[0866] Ross 308 birds were housed under controlled biosecureconditions and given water and standard commercial rations adlibitum.

[0867] Birds were dosed continually with either: [0868] 1. Noaddition to water (60 birds) [0869] 2. Strain S17 @ 10.sup.8 cfu/mldrinking water (30 birds) [0870] 3. Strain S17 containing pFSmob-C*@ 10.sup.8 cfu/ml drinking water (30 birds) [0871] 4. Strain S17containing pFSmobSal7 @ 10.sup.8 cfu/ml drinking water (60 birds)[0872] 5. Strain S17 containing pFSmobSal7 @ 10.sup.9 cfu/mldrinking water (30 birds) [0873] 6. Strain S17 containingpFSmobSal7 @ 10.sup.10 cfu/ml drinking water (30 birds)

[0874] Bacterial strains were recovered from frozen stocks kept at-78 C and cultured on LB agar for 24 h at 37 C. Cultures wereprepared daily in LB broth containing antibiotic to prevent loss ofplasmid with shaking at 180 rpm for 16 h at 37 C then centrifugedfor 10 min at 4000.times.g. Medium was removed and the pelletresuspended in PBS then diluted in PBS to give solution for dosageto chickens.

[0875] In parallel, a group of 30 birds was dosed orally with 0.5ml 10.sup.5 CFU/mL Salmonella Enteritidis strain FS26 (Folium) onday 1. Birds were checked for Salmonella colonisation at day 3 ofthe experiment by cloacal swab using ISO 6759 methods (1). On day 5of the experiment 3 of these verified Salmonella-colonised birds(seeder birds) were marked and added to each of groups 1-6. Birdswere weighed weekly and feed consumption and mortalityrecorded.

[0876] Fifteen birds from each group were euthanised on days 12 and19 (7 and 14 days post mixing with seeder birds). Caeca wereremoved for examination for Salmonella by ISO 6759. Hock and padmarks were recorded. Samples of 1 g liver and caecal contents weresnap frozen.

[0877] Thirty birds from each of group 1 and 4 were then monitoredfor behaviour and weight weekly until day 42, when they wereeuthanised and examined as for birds above.

[0878] Results were recorded on paper or dictated via telephone orradio in biosecure accommodation and transcribed to MicrosoftExcel.TM.. For the purposes of data transformation birds with nobacteria detected were allocated a count of 1 bacterium per g.Counts and weight were log transformed and statistical analysisconducted using GraphPad Prism.TM.. Data was assessed for normalityof distribution using a D'Agostino and Pearson omnibus normalitytest and as non-normal was analysed using a Kruskall-Wallis testwith Dunn's multiple comparison test post hoc. Differences inproportions of birds was analysed using Fisher's exact test.

Results

[0879] All seeder birds were colonised with Salmonella by day 3.Those used to seed infections in the test groups had counts of>10.sup.5 cfu/g faeces.

[0880] At day seven 15 birds per group were euthanised andSalmonella in the caecum enumerated (FIG. 3). FIG. 4 shows datapresented a birds positive/negative for Salmonella.

[0881] Birds dosed with S17-pFSmobSal7 (lowest dose) and pFSmob-C*had significantly lower numbers of Salmonella in the caecum thancontrols (FIG. 3) and were significantly less likely to havedetectable Salmonella in the caecum at day 7 post mixing withseeder birds.

[0882] No mortality was seen in any group; no morbidity wasobserved and high dosage of S17-mobSal7 was tolerated well. Birdswere scored for positive and negative behaviours, but no differencewas seen between groups.

[0883] Thirty birds from each of groups 1 and 4 were monitoredfurther until 42 days of age. During this period again, nosignificant differences in behaviour were observed. Feedconsumption between groups was not significantly different andweights did not differ significantly between groups measured inlife. At post mortem Salmonella was not detectable in the caecum bydirect count; no hock or pad marks were observed. Median carcassweight of birds in the S17-pFSmobSal7 group was 205 g greater thanin the control group, a significant increase (FIG. 5). As this wasassociated with equivalent feed consumption between groups, theS17-pFSmobSal7 group had a significantly improved feed conversionratio (FCR).

REFERENCES

[0884] ISO. 2007. ISO 6579:2007: Microbiology of food and animalfeeding stuffs--Horizontal method for the detection of Salmonellaspp. (ISO 6579:2002+Amd 1:2007). Geneva, Switzerland

Example 5: Non-Replicative Conjugative Plasmid with ConditionallyEssential Gene Marker

[0885] To meet regulatory requirements, any plasmid used willpreferably be devoid of an antibiotic selection marker and will benon-replicative in the vast majority, if not all, cells except forthe host cell (ie, carrier cell). To render the plasmidnon-replicative, the replication system of broad host range plasmidRK2, a fairly low copy number plasmid, will be utilised. RK2replication is dependent on the presence of a replication protein,TrfA encoded by trfA on RK2, and binding of TrfA to the vegetativeorigin (oriV) of the plasmid and does not utilize the hostmachinery for replication initiation. Physical separation of trfAfrom the plasmid and incorporation of this gene into the chromosomewill make the resulting plasmid carrying RK2 oriV dependent on ahost encoded function. This will prevent the plasmid from activelyreplicating in a target strain after delivery via conjugation. Inthe rare case of an identical IncP plasmid being present in thetarget cell that will provide trfA, both plasmids will compete forthe available TrfA, resulting in loss of one plasmid. As ourplasmid in this example further does not carry an advantageousantibiotic resistance marker or similar and lacks plasmid addictionsystems, it will be quickly lost from the offspring.

[0886] As a selection marker in the absence of an antibioticresistance, the aroA gene encoding for an enzyme in thebiosynthesis pathway of aromatic amino acids will be used. This isa conditionally essential gene that is essential when the host cellis grown in the absence of available aromatic amino acids or anintermediate from the reaction catalysed by aroA. Moving the aroAgene from the host genome to the plasmid backbone will provide thisselection marker. The aroA gene of the chromosome will be replacedin the host (carrier cell) strain by a copy of trfA.

[0887] An aroA knock-out and replacement of the chromosomal copy bya trfA expression cassette in a E. coli lab strain DH10B will bemade to generate a test strain of bacteria for testing the plasmid.The trfA expression cassette to be used has the sequence of SEQ IDNO: 10.

[0888] The final host (carrier) strain, a commensal E. coli isolatefrom chicken, will undergo the same strain constructionprocedure.

[0889] The aroA coding sequence (SEQ ID NO: 11) will be amplifiedwith a similar promoter and terminator region and assembled intothe plasmid along with modules for the Cas9, tracrRNA, crRNA andthe oriV of RK2.

[0890] Additionally, alternative modules can be tested in thisplasmid configuration such as anti-restriction genes that inhibitType I restriction enzymes (ocr of T7, klcA of RK2, ardA fromconjugative plasmids/transposons, ardB from conjugative plasmids)to improve DNA stability after transfer into target cells.

[0891] Further or alternatively, a module encoding an essentialpart of the type IV secretion system present for conjugation willlocated on the plasmid as this will lead to a non-functionaltransfer system present in the cell if the plasmid is not present.To facilitate conjugation by the host cell, the type IV secretionsystem present on plasmid RK2 will have to be integrated into thehost genome. The essential components of this system are encodedwithin three operons on two locations of the plasmid, tra1 andtra2. Tral encodes the the traKLM and traJXIHGF operons, tra2 thetrbBCEFGHJL genes. During the integration process, the regulatoryregion present in tra1 located between the traKLM and traJXIHGFoperons will be modified. This sequence contains the origin oftransfer (oriT), harbouring the binding site for the TraJ proteinresponsible for initiating transfer of the DNA. If this bindingsite is not altered by mutagenesis to prevent TraJ binding,transfer of chromosomal DNA fragments during the conjugationprocess will be initiated, leading to transfer of unwanted geneticinformation.

[0892] Sequences of the RK2 tra1 and tra2 modules to be used are inSEQ ID NOs 13 and 14.

Example 6: Anti-Salmonella Plasmid Construction & Testing

Summary

[0893] The type I-E Cas system from E. coli K12 (MG1655) is a RNAguide-directed DNase machinery, known as Clustered RegularlyInterspaced Short Palindromic Repeat (CRISPR) and CRISPR-associatedproteins system (CRISPR-Cas), which represents an adaptive immunesystem for prokaryotes that targets invading foreign geneticmaterial for degradation. The Escherichia coli type I-E Cascadesystem is made up of different Cas proteins (casABCDE12 and cas3)and recognizes a wide variety of PAM sequences with varying degreesof efficacy. The main PAM sequences are: 5'-AAG, AGG, ATG, GAG-3'.Type I-E Cas system from E. coli K12 was used to selectively removeSalmonella species. The system was modified as in E. coli MG1655the main components of the cas protein complex are expressed fromtwo transcription units, cas3 and casABCDE12, respectively. Themodifications introduced during the plasmid construction processincluded the exchange of the native, regulated promoter element ofthe casABCDE operon with the constitutive J23114 promoter andreplacing the cas1 and cas2 genes with the cas3 gene including itsnative ribosomal binding site. These changes, in effect, created aconstitutively expressed CRISPR-Cas module that was subsequentlytested for functionality by addition of a crRNA array for specifictargeting of Salmonella species.

[0894] Two versions of Guided Biotic.RTM. plasmids were constructeddiffering in origin of replication (oriV) and antibiotic selectionmarker. The resulting plasmids were named pFS-Sal-08-rm andpFS-Sal-09-rm and were tested in vitro to selectively inhibitgrowth of Salmonella enterica subsp. enterica serovar Enteritidisby conjugative DNA transfer. In the conjugation experiments,pFS-EcoCas3-01-rm and pFS-EcoCas3-03-rm were used as controlplasmids for Salmonella-specific growth inhibition Plasmids wereconstructed, each comprising nucleotide sequences encoding Type I-EE. coli Cas3 and cognate casA, B, C, D and E; a CRISPR array thatis operable with the Cas3 and comprises a first spacer that iscomplementary to a sequence of an invB gene of S. enterica, asecond spacer that is complementary to a sequence of a sicP gene ofS. enterica and a third spacer that is complementary to a sequenceof a sseE gene of S. enterica; an RP4 oriT; a p15A ori; an E. coliproA gene; and an E. coli proB gene. See Table 7 for moredetails.

Methodology

[0895] crRNA Array Design

[0896] Target gene selection, to design the CRISPR spacers, wasfocused on the Salmonella-specific pathogenicity islands (SPIs),which are major virulence factors for Salmonella. Criteria forselection were conservation within Salmonella enterica and a low tovery low occurrence and conservation of the respective gene inother bacteria. These analyses were performed using the Basic LocalAlignment Search Tool (BLAST). Cut-off for number of hits innon-Salmonella species was set at 1000. Level of conservation wasconsidered as high if a search produced >1000 hits. Between 100and 1000 was medium, between 20 and 100 low, very low if <20hits. Specifically, genes associated with the type III proteinsecretion systems, T3SS, of SPI-1 and SPI-2 were explored astargets, taking care to include gene candidates that are conservedacross Salmonella species but exclude those that are conservedacross other bacteria species. Initially, the search focused onsecreted effectors and chaperones, avoiding regulators andfunctional components of the T3SS.

[0897] The three selected highly conserved gene targets sicP, invBand sseE are all part of the T3SS loci encoded by Salmonellapathogenicity islands (SPIs), SPI-1 in the case of sicP and invB(both chaperones), and SPI-2 in the case of sseE (secretedeffector). They all occur in only one copy in Salmonella entericasubsp. enterica serovar Typhimurium str. LT2 and this is the casefor all Salmonella enterica although their duplication in somestrains cannot be ruled out.

[0898] Candidate target genes (a) and, subsequently, spacers (b)were searched on Blast to make sure they are specific forSalmonella and to minimize off-targets. Search was performed usingRefSeq Database, which contains around 10600 Salmonella entericagenomes: [0899] a) Blast search parameters for gene selection:[0900] Salmonella conservation: RefSeq DB restricted to Salmonellaenterica (taxid:28901), megablast, max hits: 20000, standardparameters [0901] Occurrence outside Salmonella: RefSeq DBrestricted to bacteria (taxid:2) excluding Salmonella (taxid:590),Blastn, max hits 1000, standard parameters [0902] b) Blast searchparameters for spacer sequences (including PAMs): [0903] Salmonellaconservation: RefSeq DB restricted to Salmonella enterica(taxid:28901), blastn, max hits:20000, standard parameters [0904]Occurrence outside Salmonella: RefSeq DB restricted to bacteria(taxid:2) excluding Salmonella enterica (taxid:28901), Blastn, maxhits 1000, standard parameters but expect value set to 100 to catchsequences with low but still significant homology

[0905] A number of spacers targeting different Salmonella entericagenes were initially screened in silico, selected, cloned andindividually tested in vitro for their efficacy of targetingSalmonella enterica subsp. enterica serovar Enteritidis FS26 (seeSummary on target gene and spacer selection and Rep-21:Construction and in vitro testing of spacer reporter systems). Thethree best performing spacer sequences active against Salmonellaspecies were selected and combined into a short crRNA array. Thespacer sequences were derived from three highly conserved genespresent in Salmonella pathogenicity islands (SPIs), invB, sicP andsseE. In brief, a limited potential spacer sequences characterizedby the presence of a strong consensus 5'-PAM sequence capable ofinitiating DNA restriction were selected and ranked according tosequence features associated with efficient target DNA restriction,conservation within Salmonella isolates and lack of DNA homologyoutside of Salmonella enterica. Three spacer sequences meetingthese criteria were finally selected and incorporated into afunctional crRNA array. The finalised crRNA array was ordered as asynthetic gene sequence inserted into a standard cloning plasmid(GeneArt, Thermo Fisher Scientific).

[0906] Sequences of selected genes are shown in SEQ ID NOs: 20-22.In each gene, spacers are highlighted in bold and respective PAMsin italics (in the case of invB, the spacer was selected on thenegative DNA strand (anti-sense) so the PAM appears 3' to thespacer. PAM sequences used for spacer selection were AAG, ATG, AGGand GAG. Blast searches for the spacers with their respective PAMswas conducted (Table 10).

[0907] The non-Salmonella hits were further analysed for theirconservation level (spacers accepted when level of conservation inoff-targets was <75%). Sequence selection also depended on wherethe mismatches were located in the off-target hit, ruling out theones showing conserved PAM and seed (first 8pb of the spacer). Oneadditional criterion for our selection also included the type ofbacteria where the hit was present, if present in a pathogen, thespacer was still considered as a possible candidate.

[0908] Each spacer was individually tested in vitro for theirefficacy of targeting Salmonella enterica subsp. enterica serovarEnteritidis FS26, before combining them together in the arraypresent in the plasmid pFS-Sal-09-rm.

Plasmid Assembly

[0909] For the homology-based DNA assembly, individual DNA moduleswere carrying 5' and/or 3' extensions with exact homology to theadjacent module. The extensions were either introduced during a PCRamplification step of the module or were incorporated during thedesign of synthetic DNA modules. The constitutive J23114 promoterwas introduced.

[0910] CasA-E: The 4464 bp casA-casB-casC-casD-casE module wasamplified from E. coli K12 (MG1655) genomic DNA.

[0911] Cas3: The 2709 bp Cas3 module was amplified.

[0912] crRNA: The crRNA array module Sal-crRNA 1 (546 bp), carriesa 25 bp homology extension to the 3'-end of the Cas3 module. Thesequence of the Sal-crRNA Array1 is shown in SEQ ID NO: 15, withthe -10 region of the promoter in italic, direct repeats underlinedand the spacer regions corresponding to the selected Salmonellatarget sequences of invB, sicP and seeE, in bold.

pFS-Sal-08-Rm and pFS-Sal-09-Rm Validation and In Vitro Testing byConjugation

[0913] Having confirmed the sequences of both constructs, theplasmids were transformed into a carrier strain that allowedplasmid mobilization via conjugation to assess the efficacy of theCas3 system to selectively kill Salmonella in presence of theSal-crRNA array 1. In this study, E. coli strain S17-1 .DELTA.Tn7was used. 100 ng of pFS-Sal-08-rm and pFS-Sal-09-rm were used fortransformation of 50 l electrocompetent cells of E. coli S17-1.DELTA.Tn7 by electroporation and selected on Kanamycin andChloramphenicol, respectively. Transformation with both plasmidsresulted in a good transformation efficiency of E. coli S17-1.DELTA.TN7 (10-10.sup.6 transformed CFU/mL). Control plasmids,pFS-EcoCas3-01-rm and pFS-EcoCas3-03, lacking the crRNA array, werealso transformed in the S17-1 .DELTA.Tn7 carrier strain to be usedas controls in FS26 transformation for pFS-Sal-09-rm andpFS-Sal-08-rm. In order to confirm the mobilization capability ofthe new plasmids, S17-1 carrier cells, were first used to conjugateE. coli JM109 cells (nalidixic acid, Nal, resistant). Results,reported in Table 8, show a similar conjugation efficiency betweenpFS-EcoCas3-01 and pFS-Sal-09-rm and between pFS-EcoCas3-03 andpFS-Sal-08-rm, in E. coli JM109. Conjugation efficiency iscalculated dividing the number (CFU/mL) of transconjugants(selected on plates with double antibiotics) by the number ofrecipients (selected on plate with Nal).

[0914] Subsequently, E. coli carrier strain S17-1 .DELTA.Tn7,previously transformed with the plasmids, were used to assesswhether there is a significant growth inhibition of SalmonellaEnteritidis FS26 by conjugation of pFS-Sal-08-rm compared to thecontrol plasmid pFS-EcoCas3-03-rm and of pFS-Sal-09-rm compared topFS-EcoCas3-01-rm. Conjugation was performed from E. coli S17-1.DELTA.Tn7 into nalidixic acid (Nal) resistant SalmonellaEnteritidis FS26. Results showed a significant reduction (CFU/mL)in S. Enteritidis strain FS26 conjugated with both pFS-Sal-08-rmand pFS-Sal-09-rm compared to the respective control plasmids(Table 9).

[0915] In conclusion, inhibition of Salmonella growth by bothplasmids carrying the Sal-crRNA array 1 generated in this studyindicated that the modified Cas module is functional and was ableto express all the individual components of the Type I-E Cascadecomplex, the Cas3 nuclease and the crRNA array without negativelyaffecting growth of non-target E. coli host strains 517-1 andJM109. We demonstrated the ability of the E. coli type I-E Cassystem-based plasmids to be transferred by conjugation from the E.coli S17-1 carrier strain to S. Enteritidis strain FS26. Weobserved a significant inhibition of growth in the Salmonellatransconjugants (>99.9%) of the selected strain throughconjugation of both pFS-Sal-08-rm and pFS-Sal-09-rm in comparisonto the control used. These data therefore highlighted the potentialof these E. coli type I-E Cascade based constructs for the removalof unwanted bacteria, such as for zoonotic control.

Example 7: Test of Stability and Efficacy of a Folium E. coli-BasedProduct in Chickens Fed a Diet Containing Salmonella

[0916] In Example 4, we tested a Guided Biotic.RTM. plasmidcontained in E. coli carrier cells of S17 strain. In this presentExample 7, we instead tested a Guided Biotic.RTM. plasmid (GBplasmid pFS-Sal-09-proAB-rm, Example 6 & Table 7) contained ina different strain (Strain X) of E. coli carrier. A helper plasmidpCon_aroA carried a functional copy of the conjugation machinery ofplasmid RP4 (traJXIHGF-traKLM-trbBCDEFGHIJKL) that was found tofacilitate mobilization of oriT-containing plasmids from the hostcell to a recipient cell in vitro.

Purpose of Study

[0917] To determine the stability of E. coli Strain X with theGuided Biotic.RTM. in drinking water over 24 hours. [0918] Toenumerate intestinal and organ contamination with Salmonella givenin-feed. [0919] To determine the efficacy of E. coli Strain Xcontaining an active GB plasmid in chickens challenged withSalmonella in-feed.

Summary

[0919] [0920] E. coli Strain X was found at the expected level of5.times.log-8 CFU/mL immediately after dosing into deionised watercontaining stabilizers, and 24 hrs had dropped to 8.times.log-7CFU/mL. [0921] Following challenge in-feed (10.sup.4 CFU/g feed)for 24 hrs, low levels (.about.log-2-5 CFU/g) of Salmonella werefound in the crop and caeca on days 1, 3 and 7 after challenge.Lower levels (.about.log-1 CFU/g) were also found in ilealcontents, liver and spleen 7 days post-challenge. [0922] The activeGuided Biotic.RTM., E. coli Strain X containing an active GBplasmid, reduced (P<0.03) Salmonella counts in the crop 7 dayspost-challenge by .about.log-1 CFU/g.

Methodology

[0923] Ross 308 birds (30) were housed under controlled biosecurityconditions and given water and a standard commercial ration adlibitum. Each experimental group was held in a separate pen withwood shaving bedding. Birds had a 18 h light/6 h dark lightingregime. Temperature and humidity were kept between the standardlevels shown in Table 11.

Treatment Groups:

[0924] Low Control--no addition to water, 10.sup.4 CFU Salmonellaper gram feed for 24 hrs on day 7 (15 birds) [0925] GB-Sal--E. coliStrain X Guided Biotic.RTM. containing active GB plasmid(pFS-Sal-09-proAB-rm) at 10.sup.8 CFU/mL in drinking water fromdays 1-14, 10.sup.4 CFU Salmonella per gram feed for 24 hrs on day7 (15 birds)

[0926] Guided Biotic.RTM. strains were recovered daily from frozenstocks kept at -78.degree. C. and cultured on LB agar plusChloramphenicol (30 g/mL) for 24 h at 37.degree. C. Strain X withactive GB plasmid strains were prepared in Terrific broth, grownwith shaking at 180 rpm for 16 h at 37.degree. C. After measuringOD.sub.600 to estimate cell numbers, cells were centrifuged andresuspended in deionised water containing stabilizers to givesolutions for dosage to chickens (10.sup.8 CFU/mL in drinkingwater). Vac Pac containing blue dye was included 3 hrs beforecollection on sampling days, to confirm water and GB intake.Supplemented water samples were collected on GB addition and 24 hrslater on days 4-14 of the trial, for enumeration for GB. Watersamples were decimally diluted in PBS and then plated on toMacConkey agar number 3 (Oxoid CM0115), then incubated at 24 h at37.degree. C.

[0927] Salmonella strain (FS26, with Nalidixic acid marker) wasrecovered from frozen stocks kept at -78.degree. C. and cultured onLB agar for 24 h at 37.degree. C. Test cultures were prepared dailyin LB broth grown with shaking at 180 rpm for 16 h at 37.degree. C.After measuring OD.sub.600 to estimate cell numbers, cells werecentrifuged and resuspended and diluted in phosphate-bufferedsaline to give solutions of 1.times.10.sup.7 CFU/ml which wasdripped on to the feed at a rate of 1 ml bacterial suspension to100 g feed while the feed was mixed thoroughly. Four feed sampleswere collected for enumeration of Salmonella content.

Animal Sample Collection and Plating

[0928] No bird mortality was recorded. Lighting level, additions ofbedding, temperature, humidity and stocking density were logged anddid not differ between treatments. Three birds from each group ondays 1 & 3 and nine birds on day 7 after challenge wereeuthanised and samples taken from the crop, ileal, caecal, liverand spleen. Euthanasia, post-mortem and dissection times wererecorded. Feathers were spray wetted with water. Birds were openedwith a disposable scalpel that was discarded after opening andgloves were changed. Samples of 1 g liver and crop, ileal andcaecal contents were taken and snap frozen in liquid nitrogen.Scalpels were disposed of as each organ was taken. Samples werehomogenised in 9 volumes of phosphate-buffered saline, decimallydiluted in phosphate-buffered saline and examined, with agarsincubated for 16-18 h at 37.degree. C. Samples that were negativein direct plating were examined for Salmonella by enrichment in 9volumes of selenite cystine broth (Oxoid CM0699) for 16-18 h at37.degree. C. The enriched broth was subsequently streaked on toXLD agar (CM0469) containing antibiotics as Table 12 and incubatedat 37.degree. C. for 16-18 h.

[0929] Birds with no bacteria detected in direct counts wereallocated a count of 0 bacterium per g, while those negative indirect counts but positive in the enhanced method were allocated 50CFU/g. Results were recorded on paper or dictated via telephone orradio in biosecure accommodation and transcribed to MicrosoftExcel. Data were analysed in GraphPad Prism. Data were assessed fornormality of distribution using a D'Agostino and Pearson omnibusnormality test and as non-normal was analysed using a Mann-WhitneyU test. Paired data were analysed using a paired T-test.

Results

[0930] 1. Salmonella In-Feed [0931] The presence of Salmonellain-feed (average 9.times.log-4 CFU/g) was as expected.

[0932] 2. Guided Biotic.RTM. Levels in Drinking Water [0933] Theanalysed GB level in drinking water immediately on mixing (average5.times.log-8 CFU/mL) was as planned. Samples taken 24 hrs laterconfirmed an average drop to 8.times.log-7 CFU/mL.

[0934] 3. Effects of Salmonella Dose [0935] Overall, low levels ofSalmonella were found in the crop (.about.log 1-3 CFU/g) and caeca(.about.log 4-5 CFU/g) on days 1 and 3 after challenge. NoSalmonella was found in ileal, liver or spleen samples at thesetimes. [0936] At day 7 post challenge similar levels of Salmonellawere again found in the crop and caeca, as well as lower levels(.about.log 1) in the ileum, liver and spleen.

[0937] 4. Effects of Active Guided Biotic (Control vs GB) [0938] GBreduced (P<0.03) Salmonella counts in the crop 7 dayspost-challenge (FIG. 6). [0939] There was a weak trend for GB toreduce Salmonella in the crop (P=0.40) and caeca (P=0.50) on day 3,and the ileum (P=0.58) and caeca (P=0.60) on day 7.

TABLE-US-00005 [0939] TABLE 5 Example Bacteria Optionally, thecarrier cells are selected from this Table and/or the target cellsare selected from this Table (eg, wherein the carrier and targetcells are of a different species; or of the same species but are adifferent strain or the carrier cells are engineered but the targetcells are wild-type or vice versa). For example the carrier cellsare E coli cells and the target cells are C dificile, E coli,Akkermansia, Enterobacteriacea, Ruminococcus,Faecalibacterium,Firmicutes, Bacteroidetes, Salmonella, Klebsiella, Pseudomonas,Acintenobacter or Streptococcus cells. Abiotrophia AcidocellaActinomyces Alkalilimnicola Aquaspirillum Abiotrophia defectivaAcidocella aminolytica Actinomyces bovis Alkalilimnicola ehrlichiiAquaspirillum polymorphum Acaricomes Acidocella facilis Actinomycesdenticolens Alkaliphilus Aquaspirillum Acaricomes phytoseiuliAcidomonas Actinomyces europaeus Alkaliphilus oremlandiiputridiconchylium Acetitomaculum Acidomonas methanolica Actinomycesgeorgiae Alkaliphilus transvaalensis Aquaspirillum serpensAcetitomaculum ruminis Acidothermus Actinomyces gerencseriaeAllochromatium Aquimarina Acetivibrio Acidothermus cellulolyticusActinomyces Allochromatium vinosum Aquimarina latercula Acetivibriocellulolyticus Acidovorax hordeovulneris AlloiococcusArcanobacterium Acetivibrio ethanolgignens Acidovorax anthuriiActinomyces howellii Alloiococcus otitis ArcanobacteriumAcetivibrio multivorans Acidovorax caeni Actinomyces hyovaginalisAllokutzneria haemolyticum Acetoanaerobium Acidovorax cattleyaeActinomyces israelii Allokutzneria albata Arcanobacterium pyogenesAcetoanaerobium noterae Acidovorax citrulli Actinomyces johnsoniiAltererythrobacter Archangium Acetobacter Acidovorax defluviiActinomyces meyeri Altererythrobacter ishigakiensis Archangiumgephyra Acetobacter aceti Acidovorax delafieldii Actinomycesnaeslundii Altermonas Arcobacter Acetobacter cerevisiae Acidovoraxfacilis Actinomyces neuii Altermonas haloplanktis Arcobacterbutzleri Acetobacter cibinongensis Acidovorax konjaci Actinomycesodontolyticus Altermonas macleodii Arcobacter cryaerophilusAcetobacter estunensis Acidovorax temperans Actinomyces orisAlysiella Arcobacter halophilus Acetobacter fabarum Acidovoraxvalerianellae Actinomyces radingae Alysiella crassa Arcobacternitrofigilis Acetobacter ghanensis Acinetobacter Actinomycesslackii Alysiella filiformis Arcobacter skirrowii Acetobacterindonesiensis Acinetobacter baumannii Actinomyces turicensisAminobacter Arhodomonas Acetobacter lovaniensis Acinetobacterbaylyi Actinomyces viscosus Aminobacter aganoensis Arhodomonasaquaeolei Acetobacter malorum Acinetobacter bouvetii ActinoplanesAminobacter aminovorans Arsenophonus Acetobacter nitrogenifigensAcinetobacter calcoaceticus Actinoplanes auranticolor Aminobacterniigataensis Arsenophonus Acetobacter oeni Acinetobacter gerneriActinoplanes brasiliensis Aminobacterium nasoniae Acetobacterorientalis Acinetobacter haemolyticus Actinoplanes consettensisAminobacterium mobile Arthrobacter Acetobacter orleanensisAcinetobacter johnsonii Actinoplanes deccanensis AminomonasArthrobacter agilis Acetobacter pasteurianus Acinetobacter juniiActinoplanes derwentensis Aminomonas paucivorans Arthrobacter albusAcetobacter pornorurn Acinetobacter lwoffi Actinoplanes digitatisAmmoniphilus Arthrobacter aurescens Acetobacter senegalensisAcinetobacter parvus Actinoplanes durhamensis Ammoniphilusoxalaticus Arthrobacter chlorophenolicus Acetobacter xylinusAcinetobacter radioresistens Actinoplanes ferrugineus Ammoniphilusoxalivorans Arthrobacter citreus Acetobacterium Acinetobacterschindleri Actinoplanes globisporus Amphibacillus Arthrobactercrystallopoietes Acetobacterium bakii Acinetobacter soliActinoplanes humidus Amphibacillus xylanus Arthrobacter cumminsiiAcetobacterium carbinolicum Acinetobacter tandoii Actinoplanesitalicus Amphritea Arthrobacter globiformis Acetobacteriumdehalogenans Acinetobacter tjernbergiae Actinoplanes liguriensisAmphritea balenae Arthrobacter Acetobacterium fimetariumAcinetobacter towneri Actinoplanes lobatus Amphritea japonicahistidinolovorans Acetobacterium malicum Acinetobacter ursingiiActinoplanes missouriensis Amycolatopsis Arthrobacter ilicisAcetobacterium paludosum Acinetobacter venetianus Actinoplanespalleronii Amycolatopsis alba Arthrobacter luteus Acetobacteriumtundrae Acrocarpospora Actinoplanes philippinensis Amycolatopsisalbidoflavus Arthrobacter methylotrophus Acetobacterium wieringaeAcrocarpospora corrugata Actinoplanes rectilineatus Amycolatopsisazurea Arthrobacter mysorens Acetobacterium woodii AcrocarposporaActinoplanes regularis Amycolatopsis coloradensis Arthrobacternicotianae Acetofilamentum macrocephala Actinoplanes Amycolatopsislurida Arthrobacter nicotinovorans Acetofilamentum rigidumAcrocarpospora pleiomorpha teichomyceticus Amycolatopsismediterranei Arthrobacter oxydans Acetohalobium ActibacterActinoplanes utahensis Amycolatopsis rifamycinica Arthrobacterpascens Acetohalobium arabaticum Actibacter sediminisActinopolyspora Amycolatopsis rubida Arthrobacter AcetomicrobiumActinoalloteichus Actinopolyspora halophila Amycolatopsis sulphureaphenanthrenivorans Acetomicrobium faecale ActinoalloteichusActinopolyspora mortivallis Amycolatopsis tolypomycina ArthrobacterAcetomicrobium flavidum cyanogriseus Actinosynnema Anabaenapolychromogenes Acetonema Actinoalloteichus Actinosynnema mirumAnabaena cylindrica Atrhrobacter protophormiae Acetonema longumhymeniacidonis Actinotalea Anabaena flos-aquae ArthrobacterAcetothermus Actinoalloteichus spitiensis Actinotalea fermentansAnabaena variabilis psychrolactophilus Acetothermus paucivoransActinobaccillus Aerococcus Anaeroarcus Arthrobacter ramosusAcholeplasma Actinobacillus capsulatus Aerococcus sanguinicolaAnaeroarcus burkinensis Arthrobacter sulfonivorans Acholeplasmaaxanthum Actinobacillus delphinicola Aerococcus urinaeAnaerobaculum Arthrobacter sulfureus Acholeplasma brassicaeActinobacillus hominis Aerococcus urinaeequi Anaerobaculum mobileArthrobacter uratoxydans Acholeplasma cavigenitalium Actinobacillusindolicus Aerococcus urinaehominis Anaerobiospirillum Arthrobacterureafaciens Acholeplasma equifetale Actinobacillus lignieresiiAerococcus viridans Anaerobiospirillum Arthrobacter viscosusAcholeplasma granularum Actinobacillus minor Aeromicrobiumsucciniciproducens Arthrobacter woluwensis Acholeplasma hippikonActinobacillus muris Aeromicrobium erythreum Anaerobiospirillumthomasii Asaia Acholeplasma laidlawii Actinobacillus AeromonasAnaerococcus Asaia bogorensis Acholeplasma modicum pleuropneumoniaeAeromonas Anaerococcus hydrogenalis Asanoa Acholeplasma morumActinobacillus porcinus allosaccharophila Anaerococcus lactolyticusAsanoa ferruginea Acholeplasma multilocale Actinobacillus rossiiAeromonas bestiarum Anaerococcus prevotii AsticcacaulisAcholeplasma oculi Actinobacillus scotiae Aeromonas caviaeAnaerococcus tetradius Asticcacaulis biprosthecium Acholeplasmapalmae Actinobacillus seminis Aeromonas encheleia Anaerococcusvaginalis Asticcacaulis excentricus Acholeplasma parvumActinobacillus succinogenes Aeromonas Anaerofustis AtopobacterAcholeplasma pleciae Actinobaccillus suis enteropelogenesAnaerofustis stercorihominis Atopobacter phocae Acholeplasma vituliActinobacillus ureae Aeromonas eucrenophila Anaeromusa AtopobiumAchromobacter Actinobaculum Aeromonas ichthiosmia Anaeromusaacidaminophila Atopobium fossor Achromobacter denitrificansActinobaculum massiliense Aeromonas jandaei AnaeromyxobacterAtopobium minutum Achromobacter insolitus Actinobaculum schaaliiAeromonas media Anaeromyxobacter Atopobium parvulum Achromobacterpiechaudii Actinobaculum suis Aeromonas popoffii dehalogenansAtopobium rimae Achromobacter ruhlandii Actinomyces urinaleAeromonas sobria Anaerorhabdus Atopobium vaginae Achromobacterspanius Actinocatenispora Aeromonas veronii Anaerorhabdus furcosaAureobacterium Acidaminobacter Actinocatenispora rupisAgrobacterium Anaerosinus Aureobacterium barkeri AcidaminobacterActinocatenispora Agrobacterium Anaerosinus glycerini Aurobacteriumhydrogenoformans thailandica gelatinovorum AnaerovirgulaAurobacterium liquefaciens Acidaminococcus Actinocatenispora seraAgrococcus Anaerovirgula multivorans Avibacterium Acidaminococcusfermentans Actinocorallia Agrococcus citreus AncalomicrobiumAvibacterium avium Acidaminococcus intestini Actinocoralliaaurantiaca Agrococcus jenensis Ancalomicrobium adetum Avibacteriumgallinarum Acidicaldus Actinocorallia aurea Agromonas AncylobacterAvibacterium paragallinarum Acidicaldus organivorans Actinocoralliacavernae Agromonas oligotrophica Ancylobacter aquaticusAvibacterium volantium Acidimicrobium Actinocorallia glomerataAgromyces Aneurinibacillus Azoarcus Acidimicrobium ferrooxidansActinocorallia herbida Agromyces fucosus Aneurinibacillusaneurinilyticus Azoarcus indigens Acidiphilium Actinocorallialibanotica Agromyces hippuratus Aneurinibacillus migulanus Azoarcustolulyticus Acidiphilium acidophilum Actinocorallia longicatenaAgromyces luteolus Aneurinibacillus Azoarcus toluvoransAcidiphilium angustum Actinomadura Agromyces mediolanusthermoaerophilus Azohydromonas Acidiphilium cryptum Actinomaduraalba Agromyces ramosus Angiococcus Azohydromonas australicaAcidiphilium multivorum Actinomadura atramentaria Agromycesrhizospherae Angiococcus disciformis Azohydromonas lataAcidiphilium organovorum Actinomadura Akkermansia AngulomicrobiumAzomonas Acidiphilium rubrum bangladeshensis Akkermansiamuciniphila Angulomicrobium tetraedrale Azomonas agilis AcidisomaActinomadura catellatispora Albidiferax Anoxybacillus Azomonasinsignis Acidisoma sibiricum Actinomadura chibensis Albidiferaxferrireducens Anoxybacillus pushchinoensis Azomonas macrocytogenesAcidisoma tundrae Actinomadura chokoriensis AlbidovulumAquabacterium Azorhizobium Acidisphaera Actinomadura citreaAlbidovulum inexpectatum Aquabacterium commune Azorhizobiumcaulinodans Acidisphaera rubrifaciens Actinomadura coeruleaAlcaligenes Aquabacterium parvum Azorhizophilus AcidithiobacillusActinomadura echinospora Alcaligenes denitrificans Azorhizophiluspaspali Acidithiobacillus albertensis Actinomadura fibrosaAlcaligenes faecalis Azospirillum Acidithiobacillus caldusActinomadura formosensis Alcanivorax Azospirillum brasilenseAcidithiobacillus ferrooxidans Actinomadura hibisca Alcanivoraxborkumensis Azospirillum halopraeferens Acidithiobacillusthiooxidans Actinomadura kijaniata Alcanivorax jadensisAzospirillum irakense Acidobacterium Actinomadura latina AlgicolaAzotobacter Acidobacterium capsulatum Actinomadura livida Algicolabacteriolytica Azotobacter beijerinckii ActinomaduraAlicyclobacillus Azotobacter chroococcum luteofluorescensAlicyclobacillus Azotobacter nigricans Actinomadura macradisulfidooxidans Azotobacter salinestris Actinomadura maduraeAlicyclobacillus Azotobacter vinelandii Actinomadura oligosporasendaiensis Actinomadura pelletieri Alicyclobacillus vulcanalisActinomadura rubrobrunea Alishewanella Actinomadura rugatobisporaAlishewanella fetalis Actinomadura umbrina AlkalibacillusActinomadura Alkalibacillus verrucosospora haloalkaliphilusActinomadura vinacea Actinomadura viridilutea Actinomadura viridisActinomadura yumaensis Bacillus Bacteroides Bibersteinia BorreliaBrevinema [see below] Bacteroides caccae Bibersteinia trehalosiBorrelia afzelii Brevinema andersonii Bacteriovorax Bacteroidescoagulans Bifidobacterium Borrelia americana BrevundimonasBacteriovorax stolpii Bacteroides eggerthii Bifidobacteriumadolescentis Borrelia burgdorferi Brevundimonas alba Bacteroidesfragilis Bifidobacterium angulatum Borrelia carolinensisBrevundimonas aurantiaca Bacteroides galacturonicus Bifidobacteriumanimalis Borrelia coriaceae Brevundimonas diminuta Bacteroideshelcogenes Bifidobacterium asteroides Borrelia gariniiBrevundimonas intermedia Bacteroides ovatus Bifidobacterium bifidumBorrelia japonica Brevundimonas subvibrioides Bacteroidespectinophilus Bifidobacterium boum Bosea Brevundimonas vancanneytiiBacteroides pyogenes Bifidobacterium breve Boseaminatitlanensis

Brevundimonas variabilis Bacteroides salyersiae Bifidobacteriumcatenulatum Bosea thiooxidans Brevundimonas vesicularis Bacteroidesstercoris Bifidobacterium choerinum Brachybacterium BrochothrixBacteroides suis Bifidobacterium coryneforme BrachybacteriumBrochothrix campestris Bacteroides tectus Bifidobacterium cuniculialimentarium Brochothrix thermosphacta Bacteroides thetaiotaomicronBifidobacterium dentium Brachybacterium faecium BrucellaBacteroides uniformis Bifidobacterium gallicum BrachybacteriumBrucella canis Bacteroides ureolyticus Bifidobacterium gallinarumparaconglomeratum Brucella neotomae Bacteroides vulgatusBifidobacterium indicum Brachybacterium rhamnosum BryobacterBalnearium Bifidobacterium longum Brachybacterium Bryobacteraggregatus Balnearium lithotrophicum Bifidobacterium tyrofermentansBurkholderia Balneatrix magnumBifidobacterium BrachyspiraBurkholderia ambifaria Balneatrix alpica merycicum Brachyspiraalvinipulli Burkholderia andropogonis Balneola Bifidobacteriumminimum Brachyspira hyodysenteriae Burkholderia anthina Balneolavulgaris Bifidobacterium Brachyspira innocens Burkholderiacaledonica Barnesiella pseudocatenulatum Brachyspira murdochiiBurkholderia caryophylli Barnesiella viscericola BifidobacteriumBrachyspira Burkholderia cenocepacia Bartonella pseudolongumpilosicoli Burkholderia cepacia Bartonella alsatica Bifidobacteriumpullorum Bradyrhizobium Burkholderia cocovenenans Bartonellabacilliformis Bifidobacterium ruminantium Bradyrhizobium canarienseBurkholderia dolosa Bartonella clarridgeiae Bifidobacteriumsaeculare Bradyrhizobium elkanii Burkholderia fungorum Bartonelladoshiae Bifidobacterium subtile Bradyrhizobium japonicumBurkholderia glathei Bartonella elizabethae BifidobacteriumBradyrhizobium liaoningense Burkholderia glumae Bartonella grahamiithermophilum Brenneria Burkholderia graminis Bartonella henselaeBilophila Brenneria alni Burkholderia kururiensis Bartonellarochalimae Bilophila wadsworthia Brenneria nigrifluens Burkholderiamultivorans Bartonella vinsonii Biostraticola Brenneria quercinaBurkholderia phenazinium Bavariicoccus Biostraticola tofi Brenneriaquercina Burkholderia plantarii Bavariicoccus seileri BizioniaBrenneria salicis Burkholderia pyrrocinia Bdellovibrio Bizioniaargentinensis Brevibacillus Burkholderia silvatlantica Bdellovibriobacteriovorus Blastobacter Brevibacillus agri Burkholderia stabilisBdellovibrio exovorus Blastobacter capsulatus Brevibacillusborstelensis Burkholderia thailandensis Beggiatoa Blastobacterdenitrificans Brevibacillus brevis Burkholderia tropica Beggiatoaalba Blastococcus Brevibacillus centrosporus Burkholderia unamaeBeijerinckia Blastococcus aggregatus Brevibacillus choshinensisBurkholderia vietnamiensis Beijerinckia derxii Blastococcussaxobsidens Brevibacillus invocatus Buttiauxella Beijerinckiafluminensis Blastochloris Brevibacillus laterosporus Buttiauxellaagrestis Beijerinckia indica Blastochloris viridis Brevibacillusparabrevis Buttiauxella brennerae Beijerinckia mobilis BlastomonasBrevibacillus reuszeri Buttiauxella ferragutiae BelliellaBlastomonas natatoria Brevibacterium Buttiauxella gaviniaeBelliella baltica Blastopirellula Brevibacterium abidumButtiauxella izardii Bellilinea Blastopirellula marinaBrevibacterium album Buttiauxella noackiae Bellilinea caldifistulaeBlautia Brevibacterium aurantiacum Buttiauxella warmboldiaeBelnapia Blautia coccoides Brevibacterium celere ButyrivibrioBelnapia moabensis Blautia hansenii Brevibacterium epidermidisButyrivibrio fibrisolvens Bergeriella Blautia productaBrevibacterium Butyrivibrio hungatei Bergeriella denitrificansBlautia wexlerae frigoritolerans Butyrivibrio proteoclasticusBeutenbergia Bogoriella Brevibacterium halotolerans Beutenbergiacavernae Bogoriella caseilytica Brevibacterium iodinum BordetellaBrevibacterium linens Bordetella avium Brevibacterium lyticumBordetella bronchiseptica Brevibacterium mcbrellneri Bordetellahinzii Brevibacterium otitidis Bordetella holmesii Brevibacteriumoxydans Bordetella parapertussis Brevibacterium paucivoransBordetella pertussis Brevibacterium stationis Bordetella petriiBordetella trematum Bacillus B. acidiceler B. aminovorans B.glucanolyticus B. taeanensis B. lautus B. acidicola B. amylolyticusB. gordonae B. tequilensis B. lehensis B. acidiproducens B.andreesenii B. gottheilii B. thermantarcticus B. lentimorbus B.acidocaldarius B. aneurinilyticus B. graminis B. thermoaerophilusB. lentus B. acidoterrestris B. anthracis B. halmapalus B.thermoamylovorans B. licheniformis B. aeolius B. aquimaris B.haloalkaliphilus B. thermocatenulatus B. ligniniphilus B. aerius B.arenosi B. halochares B. thermocloacae B. litoralis B. aerophilusB. arseniciselenatis B. halodenitrificans B. thermocopriae B.locisalis B. agaradhaerens B. arsenicus B. halodurans B.thermodenitrificans B. luciferensis B. agri B. aurantiacus B.halophilus B. thermoglucosidasius B. luteolus B. aidingensis B.arvi B. halosaccharovorans B. thermolactis B. luteus B. akibai B.aryabhattai B. hemicellulosilyticus B. thermoleovorans B.macauensis B. alcalophilus B. asahii B. hemicentroti B.thermophilus B. macerans B. algicola B. atrophaeus B.herbersteinensis B. thermoruber B. macquariensis B. alginolyticusB. axarquiensis B. horikoshii B. thermosphaericus B. macyae B.alkalidiazotrophicus B. azotofixans B. horneckiae B.thiaminolyticus B. malacitensis B. alkalinitrilicus B. azotoformansB. horti B. thioparans B. mannanilyticus B. alkalisediminis B.badius B. huizhouensis B. thuringiensis B. marisflavi B.alkalitelluris B. barbaricus B. humi B. tianshenii B. marismortuiB. altitudinis B. bataviensis B. hwajinpoensis B. trypoxylicola B.marmarensis B. alveayuensis B. beijingensis B. idriensis B. tusciaeB. massiliensis B. alvei B. benzoevorans B. indicus B. validus B.megaterium B. amyloliquefaciens B. beringensis B. infantis B.vallismortis B. mesonae B. B. berkeleyi B. infernus B. vedderi B.methanolicus a. subsp. amyloliquefaciens B. beveridgei B. insolitusB. velezensis B. methylotrophicus B. a. subsp. plantarum B.bogoriensis B. invictae B. vietnamensis B. migulanus B.boroniphilus B. iranensis B. vireti B. mojavensis B. dipsosauri B.borstelensis B. isabeliae B. vulcani B. mucilaginosus B. drentensisB. brevis Migula B. isronensis B. wakoensis B. muralis B. edaphicusB. butanolivorans B. jeotgali B. weihenstephanensis B. murimartiniB. ehimensis B. canaveralius B. kaustophilus B. xiamenensis B.mycoides B. eiseniae B. carboniphilus B. kobensis B. xiaoxiensis B.naganoensis B. enclensis B. cecembensis B. kochii B. zhanjiangensisB. nanhaiensis B. endophyticus B. cellulosilyticus B.kokeshiiformis B. peoriae B. nanhaiisediminis B. endoradicis B.centrosporus B. koreensis B. persepolensis B. nealsonii B.farraginis B. cereus B. korlensis B. persicus B. neidei B.fastidiosus B. chagannorensis B. kribbensis B. pervagus B.neizhouensis B. fengqiuensis B. chitinolyticus B. krulwichiae B.plakortidis B. niabensis B. firmus B. chondroitinus B.laevolacticus B. pocheonensis B. niacini B. flexus B. choshinensisB. larvae B. polygoni B. novalis B. foraminis B. chungangensis B.laterosporus B. polymyxa B. oceanisediminis B. fordii B. cibi B.salexigens B. popilliae B. odysseyi B. formosus B. circulans B.saliphilus B. pseudalcalophilus B. okhensis B. fortis B. clarkii B.schlegelii B. pseudofirmus B. okuhidensis B. fumarioli B. clausiiB. sediminis B. pseudomycoides B. oleronius B. funiculus B.coagulans B. selenatarsenatis B. psychrodurans B. oryzaecorticis B.fusiformis B. coahuilensis B. selenitireducens B. psychrophilus B.oshimensis B. galactophilus B. cohnii B. seohaeanensis B.psychrosaccharolyticus B. pabuli B. galactosidilyticus B. compostiB. shacheensis B. psychrotolerans B. pakistanensis B. galliciensisB. curdlanolyticus B. shackletonii B. pulvifaciens B. pallidus B.gelatini B. cycloheptanicus B. siamensis B. pumilus B. pallidus B.gibsonii B. cytotoxicus B. silvestris B. purgationiresistens B.panacisoli B. ginsengi B. daliensis B. simplex B. pycnus B.panaciterrae B. ginsengihumi B. decisifrondis B. siralis B.qingdaonensis B. pantothenticus B. ginsengisoli B. decolorationisB. smithii B. qingshengii B. parabrevis B. globisporus (eg, B. B.deserti B. soli B. reuszeri B. paraflexus g. subsp. Globisporus; orB. B. solimangrovi B. rhizosphaerae B. pasteurii g. subsp. Marinus)B. solisalsi B. rigui B. patagoniensis B. songklensis B. ruris B.sonorensis B. safensis B. sphaericus B. salarius B.sporothermodurans B. stearothermophilus B. stratosphericus B.subterraneus B. subtilis (eg, B. s. subsp. Inaquosorum, or B. s.subsp. Spizizenr, or B. s. subsp. Subtilis) CaenimonasCampylobacter Cardiobacterium Catenuloplanes CurtobacteriumCaenimonas koreensis Campylobacter coli Cardiobacterium hominisCatenuloplanes atrovinosus Curtobacterium albidumCaldalkalibacillus Campylobacter concisus Carnimonas Catenuloplanescastaneus Curtobacterium citreus Caldalkalibacillus uzonensisCampylobacter curvus Carnimonas nigrificans Catenuloplanes crispusCaldanaerobacter Campylobacter fetus Carnobacterium Catenuloplanesindicus Caldanaerobacter subterraneus Campylobacter gracilisCarnobacterium alterfunditum Catenuloplanes japonicusCaldanaerobius Campylobacter helveticus Carnobacterium divergensCatenuloplanes nepalensis Caldanaerobius fijiensis Campylobacterhominis Carnobacterium funditum Catenuloplanes niger CaldanaerobiusCampylobacter hyointestinalis Carnobacterium gallinarumChryseobacterium polysaccharolyticus Campylobacter jejuniCarnobacterium Chryseobacterium Caldanaerobius zeae Campylobacterlari maltaromaticum balustinum Caldanaerovirga Campylobactermucosalis Carnobacterium mobile Citrobacter Caldanaerovirgaacetigignens Campylobacter rectus Carnobacterium viridans C.amalonaticus Caldicellulosiruptor Campylobacter showae CaryophanonC. braakii Caldicellulosiruptor bescii Campylobacter sputorumCaryophanon latum C. diversus Caldicellulosiruptor kristjanssoniiCampylobacter upsaliensis Caryophanon tenue C. farmeriCaldicellulosiruptor owensensis Capnocytophaga Catellatospora C.freundii Capnocytophaga canimorsus Catellatospora citrea C.gillenii Capnocytophaga cynodegmi Catellatospora C. koseriCapnocytophaga gingivalis methionotrophica C. murliniaeCapnocytophaga granulosa Catenococcus C. pasteurii.sup.[1]Capnocytophaga haemolytica Catenococcus thiocycli C. rodentiumCapnocytophaga ochracea C. sedlakii Capnocytophaga sputigena C.werkmanii C. youngae Clostridium (see below) CoccochlorisCoccochloris elabens Corynebacterium Corynebacterium flavescensCorynebacterium variabile Clostridium Clostridium absonum,Clostridium aceticum, Clostridium acetireducens, Clostridiumacetobutylicum, Clostridium acidisoli, Clostridium aciditolerans,Clostridium acidurici, Clostridium aerotolerans, Clostridiumaestuarii, Clostridium akagii, Clostridium aldenense, Clostridiumaldrichii, Clostridium algidicarni, Clostridiumalgidixylanolyticum, Clostridium algifaecis, Clostridiumalgoriphilum, Clostridium alkalicellulosi, Clostridium aminophilum,Clostridium aminovalericum, Clostridium amygdalinum, Clostridiumamylolyticum, Clostridium arbusti, Clostridium arcticum,Clostridium argentinense, Clostridium asparagiforme, Clostridiumaurantibutyricum, Clostridium autoethanogenum, Clostridium baratii,Clostridium barkeri, Clostridium bartlettii, Clostridiumbeijerinckii, Clostridium bifermentans, Clostridium bolteae,Clostridium

bornimense, Clostridium botulinum, Clostridium bowmanii,Clostridium bryantii, Clostridium butyricum, Clostridium cadaveris,Clostridium caenicola, Clostridium caminithermale, Clostridiumcarboxidivorans, Clostridium carnis, Clostridium cavendishii,Clostridium celatum, Clostridium celerecrescens, Clostridiumcellobioparum, Clostridium cellulofermentans, Clostridiumcellulolyticum, Clostridium cellulosi, Clostridium cellulovorans,Clostridium chartatabidum, Clostridium chauvoei, Clostridiumchromiireducens, Clostridium citroniae, Clostridium clariflavum,Clostridium clostridioforme, Clostridium coccoides, Clostridiumcochlearium, Clostridium colletant, Clostridium colicanis,Clostridium colinum, Clostridium collagenovorans, Clostridiumcylindrosporum, Clostridium difficile, Clostridium diolis,Clostridium disporicum, Clostridium drakei, Clostridium durum,Clostridium estertheticum, Clostridium estertheticum estertheticum,Clostridium estertheticum laramiense, Clostridium fallax,Clostridium felsineum, Clostridium fervidum, Clostridiumfimetarium, Clostridium formicaceticum, Clostridium frigidicarnis,Clostridium frigoris, Clostridium ganghwense, Clostridiumgasigenes, Clostridium ghonii, Clostridium glycolicum, Clostridiumglycyrrhizinilyticum, Clostridium grantii, Clostridiumhaemolyticum, Clostridium halophilum, Clostridium hastiforme,Clostridium hathewayi, Clostridium herbivorans, Clostridiumhiranonis, Clostridium histolyticum, Clostridium homopropionicum,Clostridium huakuii, Clostridium hungatei, Clostridiumhydrogeniformans, Clostridium hydroxybenzoicum, Clostridiumhylemonae, Clostridium jejuense, Clostridium indolis, Clostridiuminnocuum, Clostridium intestinale, Clostridium irregulare,Clostridium isatidis, Clostridium josui, Clostridium kluyveri,Clostridium lactatifermentans, Clostridium lacusfryxellense,Clostridium laramiense, Clostridium lavalense, Clostridiumlentocellum, Clostridium lentoputrescens, Clostridium leptum,Clostridium limosum, Clostridium litorale, Clostridiumlituseburense, Clostridium ljungdahlii, Clostridium lortetii,Clostridium lundense, Clostridium magnum, Clostridiummalenominatum, Clostridium mangenotii, Clostridium mayombei,Clostridium methoxybenzovorans, Clostridium methylpentosum,Clostridium neopropionicum, Clostridium nexile, Clostridiumnitrophenolicum, Clostridium novyi, Clostridium oceanicum,Clostridium orbiscindens, Clostridium oroticum, Clostridiumoxalicum, Clostridium papyrosolvens, Clostridium paradoxum,Clostridium paraperfringens (Alias: C. welchii), Clostridiumparaputrificum, Clostridium pascui, Clostridium pasteurianum,Clostridium peptidivorans, Clostridium perenne, Clostridiumperfringens, Clostridium pfennigii, Clostridium phytofermentans,Clostridium piliforme, Clostridium polysaccharolyticum, Clostridiumpopuleti, Clostridium propionicum, Clostridium proteoclasticum,Clostridium proteolyticum, Clostridium psychrophilum, Clostridiumpuniceum, Clostridium purinilyticum, Clostridium putrefaciens,Clostridium putrificum, Clostridium quercicolum, Clostridiumquinii, Clostridium ramosum, Clostridium rectum, Clostridiumroseum, Clostridium saccharobutylicum, Clostridium saccharogumia,Clostridium saccharolyticum, Clostridiumsaccharoperbutylacetonicum, Clostridium sardiniense, Clostridiumsartagoforme, Clostridium scatologenes, Clostridiumschirmacherense, Clostridium scindens, Clostridium septicum,Clostridium sordellii, Clostridium sphenoides, Clostridiumspiroforme, Clostridium sporogenes, Clostridium sporosphaeroides,Clostridium stercorarium, Clostridium stercorarium leptospartum,Clostridium stercorarium stercorarium, Clostridium stercorariumthermolacticum, Clostridium sticklandii, Clostridiumstraminisolvens, Clostridium subterminale, Clostridium sufflavum,Clostridium sulfidigenes, Clostridium symbiosum, Clostridiumtagluense, Clostridium tepidiprofundi, Clostridium termitidis,Clostridium tertium, Clostridium tetani, Clostridium tetanomorphum,Clostridium thermaceticum, Clostridium thermautotrophicum,Clostridium thermoalcaliphilum, Clostridium thermobutyricum,Clostridium thermocellum, Clostridium thermocopriae, Clostridiumthermohydrosulfuricum, Clostridium thermolacticum, Clostridiumthermopalmarium, Clostridium thermopapyrolyticum, Clostridiumthermosaccharolyticum, Clostridium thermosuccinogenes, Clostridiumthermosulfurigenes, Clostridium thiosulfatireducens, Clostridiumtyrobutyricum, Clostridium uliginosum, Clostridium ultunense,Clostridium villosum, Clostridium vincentii, Clostridium viride,Clostridium xylanolyticum, Clostridium xylanovoransDactylosporangium Deinococcus Delftia Echinicola Dactylosporangiumaurantiacum Deinococcus aerius Delftia acidovorans Echinicolapacifica Dactylosporangium fulvum Deinococcus apachensisDesulfovibrio Echinicola vietnamensis Dactylosporangiummatsuzakiense Deinococcus aquaticus Desulfovibrio desulfuricansDactylosporangium roseum Deinococcus aquatilis DiplococcusDactylosporangium thailandense Deinococcus caeni Diplococcuspneumoniae Dactylosporangium vinaceum Deinococcus radioduransDeinococcus radiophilus Enterobacter Enterobacter kobeiFaecalibacterium Flavobacterium E. aerogenes E. ludwigiiFaecalibacterium prausnitzii Flavobacterium antarcticum E.amnigemis E. mori Fangia Flavobacterium aquatile E. agglomerans E.nimipressuralis Fangia hongkongensis Flavobacterium aquidurense E.arachidis E. oryzae Fastidiosipila Flavobacterium balustinum E.asburiae E. pulveris Fastidiosipila sanguinis Flavobacteriumcroceum E. cancerogenous E. pyrinus Fusobacterium Flavobacteriumcucumis E. cloacae E. radicincitans Fusobacterium nucleatumFlavobacterium daejeonense E. cowanii E. taylorae Flavobacteriumdefluvii E. dissolvens E. turicensis Flavobacterium degerlachei E.gergoviae E. sakazakii Enterobacter soli Flavobacterium E.helveticus Enterococcus denitrificans E. hormaechei Enterococcusdurans Flavobacterium filum E. intermedins Enterococcus faecalisFlavobacterium flevense Enterococcus faecium Flavobacteriumfrigidarium Erwinia Flavobacterium mizutaii Erwinia haponticiFlavobacterium Escherichia okeanokoites Escherichia coliGaetbulibacter Haemophilus Ideonella Janibacter Gaetbulibactersaemankumensis Haemophilus aegyptius Ideonella azotifigensJanibacter anophelis Gallibacterium Haemophilus aphrophilusIdiomarina Janibacter corallicola Gallibacterium anatis Haemophilusfelis Idiomarina abyssalis Janibacter limosus Gallicola Haemophilusgallinarum Idiomarina baltica Janibacter melonis Gallicola barnesaeHaemophilus haemolyticus Idiomarina fontislapidosi Janibacterterrae Garciella Haemophilus influenzae Idiomarina loihiensisJannaschia Garciella nitratireducens Haemophilus paracuniculusIdiomarina ramblicola Jannaschia cystaugens Geobacillus Haemophilusparahaemolyticus Idiomarina seosinensis Jannaschia helgolandensisGeobacillus thermoglucosidasius Haemophilus parainfluenzaeIdiomarina zobellii Jannaschia Geobacillus stearothermophilusHaemophilus Ignatzschineria pohangensis Geobacterparaphrohaemolyticus Ignatzschineria Jannaschia rubra Geobacterbemidjiensis Haemophilus parasuis larvae JanthinobacteriumGeobacter bremensis Haemophilus pittmaniae IgnavigranumJanthinobacterium Geobacter chapellei Hafnia Ignavigranum ruoffiaeagaricidamnosum Geobacter grbiciae Hafnia alvei IlumatobacterJanthinobacterium lividum Geobacter hydrogenophilus HahellaIlumatobacter fluminis Jejuia Geobacter lovleyi Hahella ganghwensisIlyobacter Jejuia pallidilutea Geobacter metallireducensHalalkalibacillus Ilyobacter delafieldii Jeotgalibacillus Geobacterpelophilus Halalkalibacillus halophilus Ilyobacter insuetusJeotgalibacillus Geobacter pickeringii Helicobacter Ilyobacterpolytropus alimentarius Geobacter sulfurreducens Helicobacterpylori Ilyobacter tartaricus Jeotgalicoccus GeodermatophilusJeotgalicoccus halotolerans Geodermatophilus obscurusGluconacetobacter Gluconacetobacter xylinus Gordonia Gordoniarubripertincta Kaistia Labedella Listeria ivanovii MicrococcusNesterenkonia Kaistia adipata Labedella gwakjiensis L. marthiiMicrococcus luteus Nesterenkonia holobia Kaistia soli Labrenzia L.monocytogenes Micrococcus lylae Nocardia Kangiella Labrenziaaggregata L. newyorkensis Moraxella Nocardia argentinensisKangiella aquimarina Labrenzia alba L. riparia Moraxella bovisNocardia corallina Kangiella Labrenzia alexandrii L. rocourtiaeMoraxella nonliquefaciens Nocardia koreensis Labrenzia marina L.seeligeri Moraxella osloensis otitidiscaviarum Kerstersia Labrys L.weihenstephanensis Nakamurella Kerstersia gyiorum Labrysmethylaminiphilus L. welshimeri Nakamurella multipartita KiloniellaLabrys miyagiensis Listonella Nannocystis Kiloniella laminariaeLabrys monachus Listonella anguillarum Nannocystis pusiliaKlebsiella Labrys okinawensis Macrococcus Natranaerobius K.gramilomatis Labrys Macrococcus bovicus Natranaerobius K. oxytocaportucalensis Marinobacter thermophilus K. pneumoniae LactobacillusMarinobacter algicola Natranaerobius trueperi K. terrigena [seebelow] Marinobacter bryozoorum Naxibacter K. variicola LaceyellaMarinobacter flavimaris Naxibacter alkalitolerans KluyveraLaceyella putida Meiothermus Neisseria Kluyvera ascorbataLechevalieria Meiothermus ruber Neisseria cinerea KocuriaLechevalieria aerocolonigenes Methylophilus Neisseria denitrificansKocuria roasea Legionella Methylophilus methylotrophus Neisseriagonorrhoeae Kocuria varians [see below] Microbacterium Neisserialactamica Kurthia Listeria Microbacterium Neisseria mucosa Kurthiazopfii L. aquatica ammoniaphilum Neisseria sicca L. booriaeMicrobacterium arborescens Neisseria subflava L. cornellensisMicrobacterium liquefaciens Neptunomonas L. fleischmanniiMicrobacterium oxydans Neptunomonas japonica L. floridensis L.grandensis L. grayi L. innocua Lactobacillus L. acetotolerans L.catenaformis L. mali L. parakefiri L. sakei L. acidifarinae L. cetiL. manihotivorans L. paralimentarius L. salivarius L. acidipiscisL. coleohominis L. mindensis L. paraplantarum L. sanfranciscensisL. acidophilus L. collinoides L. mucosae L. pentosus L. satsumensisLactobacillus agilis L. composti L. murinus L. perolens L.secaliphilus L. algidus L. concavus L. nagelii L. plantarum L.sharpeae L. alimentarius L. coryniformis L. namurensis L. pontis L.siliginis L. amylolyticus L. crispatus L. nantensis L. protectus L.spicheri L. amylophilus L. crustorum L. oligofermentans L. psittaciL. suebicus L. amylotrophicus L. curvatus L. oris L. rennini L.thailandensis L. amylovorus L. delbrueckii subsp. bulgaricus L.panis L. reuteri L. ultunensis L. animalis L. delbrueckii subsp. L.pantheris L. rhamnosus L. vaccinostercus L. antri delbrueckii L.parabrevis L. rimae L. vaginalis L. apodemi L. delbrueckii subsp.lactis L. parabuchneri L. rogosae L. versmoldensis L. aviarius L.dextrinicus L. paracasei L. rossiae L. vini L. bifermentans L.diolivorans L. paracollinoides L. ruminis L. vitulinus L. brevis L.equi L. parafarraginis L. saerimneri L. zeae L. buchneri L.equigenerosi L. homohiochii L. jensenii L. zymae L. camelliae L.farraginis L. iners L. johnsonii L. gastricus L. casei L.farciminis L. ingluviei L. kalixensis L. ghanensis L. kitasatonisL. fermentum L. intestinalis L. kefiranofaciens L. graminis L.kunkeei L. fornicalis L. fuchuensis L. kefiri L. hammesii L.leichmannii L. fructivorans L. gallinarum L. kimchii L. hamsteri L.lindneri L. frumenti L. gasseri L. helveticus L. harbinensis L.malefermentans L. hilgardii L. hayakitensis Legionella Legionellaadelaidensis Legionella drancourtii Candidatus Legionella jeoniiLegionella quinlivanii Legionella anisa Legionella dresdenensisLegionella jordanis Legionella rowbothamii Legionella beliardensisLegionella drozanskii Legionella lansingensis Legionellarubrilucens Legionella birminghamensis Legionella dumoffiiLegionella londiniensis Legionella sainthelensi Legionellabozemanae Legionella erythra Legionella longbeachae Legionellasanticrucis Legionella brunensis Legionella fairfieldensisLegionella lytica Legionella shakespearei Legionella busanensisLegionella fallonii Legionella maceachernii Legionella spiritensisLegionella cardiaca Legionella feeleii Legionella massiliensisLegionella steelei Legionella cherrii Legionella geestianaLegionella micdadei Legionella steigerwaltii Legionellacincinnatiensis Legionella genomospecies Legionella monrovicaLegionella taurinensis Legionella clemsonensis Legionella gormaniiLegionella moravica Legionella tucsonensis Legionella donaldsoniiLegionella gratiana Legionella nagasakiensis Legionella tunisiensisLegionella gresilensis Legionella nautarum Legionella wadsworthiiLegionella hackeliae Legionella norrlandica Legionella waltersiiLegionella impletisoli Legionella oakridgensis Legionellaworsleiensis Legionella israelensis Legionella parisiensisLegionella yabuuchiae Legionella jamestowniensis Legionellapittsburghensis Legionella pneumophila Legionella quateirensisOceanibulbus Paenibacillus Prevotella Quadrisphaera Oceanibulbusindolifex Paenibacillus thiaminolyticus Prevotella albensisQuadrisphaera Oceanicaulis Pantoea Prevotella amnii granulorum

Oceanicaulis alexandrii Pantoea Prevotella bergensisQuatrionicoccus Oceanicola agglomerans Prevotella biviaQuatrionicoccus Oceanicola batsensis Paracoccus Prevotella brevisaustraliensis Oceanicola granulosus Paracoccus alcaliphilusPrevotella bryantii Quinella Oceanicola nanhaiensis PaucimonasPrevotella buccae Quinella Oceanimonas Paucimonas lemoigneiPrevotella buccalis ovalis Oceanimonas baumannii PectobacteriumPrevotella copri Ralstonia Oceaniserpentilla Pectobacteriumaroidearum Prevotella dentalis Ralstonia eutropha Oceaniserpentillahaliotis Pectobacterium atrosepticum Prevotella denticola Ralstoniainsidiosa Oceanisphaera Pectobacterium betavasculorum Prevotelladisiens Ralstonia mannitolilytica Oceanisphaera donghaensisPectobacterium cacticida Prevotella histicola Ralstonia pickettiiOceanisphaera litoralis Pectobacterium carnegieana Prevotellaintermedia Ralstonia Oceanithermus Pectobacterium carotovorumPrevotella maculosa pseudosolanacearum Oceanithermus desulfuransPectobacterium chrysanthemi Prevotella marshii Ralstonia syzygiiOceanithermus profundus Pectobacterium cypripedii Prevotellamelaninogenica Ralstonia solanacearum Oceanobacillus Pectobacteriumrhapontici Prevotella micans Ramlibacter Oceanobacillus caeniPectobacterium wasabiae Prevotella multiformis Ramlibacterhenchirensis Oceanospirillum Planococcus Prevotella nigrescensRamlibacter Oceanospirillum linum Planococcus citreus Prevotellaoralis tataouinensis Planomicrobium Prevotella oris RaoultellaPlanomicrobium okeanokoites Prevotella oulorum Raoultellaornithinolytica Plesiomonas Prevotella pallens Raoultellaplanticola Plesiomonas shigelloides Prevotella salivae Raoultellaterrigena Proteus Prevotella stercorea Rathayibacter Proteusvulgaris Prevotella tannerae Rathayibacter caricis Prevotellatimonensis Rathayibacter festucae Prevotella veroralisRathayibacter iranicus Providencia Rathayibacter rathayiProvidencia stuartii Rathayibacter toxicus PseudomonasRathayibacter tritici Pseudomonas aeruginosa RhodobacterPseudomonas alcaligenes Rhodobacter sphaeroides Pseudomonasanguillispetica Ruegeria Pseudomonas fluorescens Ruegeriagelatinovorans Pseudoalteromonas haloplanktis Pseudomonas mendocinaPseudomonas pseudoalcaligenes Pseudomonas putida Pseudomonastutzeri Pseudomonas syringae Psychrobacter Psychrobacter faecalisPsychrobacter phenylpyruvicus Saccharococcus Sagittula SanguibacterStenotrophomonas Tatlockia Saccharococcus thermophilus Sagittulastellata Sanguibacter keddieii Stenotrophomonas Tatlockiamaceachernii Saccharomonospora Salegentibacter Sanguibactersuarezii maltophilia Tatlockia micdadei Saccharomonospora azureaSalegentibacter salegens Saprospira Streptococcus TenacibaculumSaccharomonospora cyanea Salimicrobium Saprospira grandis [also seebelow] Tenacibaculum Saccharomonospora viridis Salimicrobium albumSarcina Streptomyces amylolyticum Saccharophagus SalinibacterSarcina maxima Streptomyces Tenacibaculum discolor Saccharophagusdegradans Salinibacter ruber Sarcina ventriculi achromogenesTenacibaculum Saccharopolyspora Salinicoccus SebaldellaStreptomyces gallaicum Saccharopolyspora erythraea Salinicoccusalkaliphilus Sebaldella cesalbus Tenacibaculum Saccharopolysporagregorii Salinicoccus hispanicus termitidis Streptomycescescaepitosus lutimaris Saccharopolyspora hirsuta Salinicoccusroseus Serratia Streptomyces cesdiastaticus TenacibaculumSaccharopolyspora hordei Salinispora Serratia fonticolaStreptomyces cesexfoliatus mesophilum Saccharopolysporarectivirgula Salinispora arenicola Serratia marcescens Streptomycesfimbriatus Tenacibaculum Saccharopolyspora spinosa Salinisporatropica Sphaerotilus Streptomyces fradiae skagerrakenseSaccharopolyspora taberi Salinivibrio Sphaerotilus natansStreptomyces fulvissimus Tepidanaerobacter SaccharothrixSalinivibrio costicola Sphingobacterium Streptomyces griseoruberTepidanaerobacter Saccharothrix australiensis SalmonellaSphingobacterium multivorum Streptomyces griseus syntrophicusSaccharothrix coeruleofusca Salmonella bongori StaphylococcusStreptomyces lavendulae Tepidibacter Saccharothrix espanaensisSalmonella enterica [see below] Streptomyces TepidibacterSaccharothrix longispora Salmonella subterranea phaeochromogenesformicigenes Saccharothrix mutabilis Salmonella typhi StreptomycesTepidibacter thalassicus Saccharothrix syringae thermodiastaticusThermus Saccharothrix tangerinus Streptomyces tubercidicus Thermusaquaticus Saccharothrix texasensis Thermus filiformis Thermusthermophilus Staphylococcus S. arlettae S. equorum S. microti S.schleiferi S. agnetis S. felis S. muscae S. sciuri S. aureus S.fleurettii S. nepalensis S. simiae S. auricularis S. gallinarum S.pasteuri S. simulans S. capitis S. haemolyticus S. petrasii S.stepanovicii S. caprae S. hominis S. pettenkoferi S. succinus S.carnosus S. hyicus S. piscifermentans S. vitulinus S. caseolyticusS. intermedius S. pseudintermedius S. warneri S. chromogenes S.kloosii S. pseudolugdunensis S. xylosus S. cohnii S. leei S.pulvereri S. condimenti S. lentus S. rostri S. delphini S.lugdunensis S. saccharolyticus S. devriesei S. lutrae S.saprophyticus S. epidermidis S. lyticans S. massiliensisStreptococcus Streptococcus agalactiae Streptococcus infantariusStreptococcus orisratti Streptococcus thermophilus Streptococcusanginosus Streptococcus iniae Streptococcus parasanguinisStreptococcus sanguinis Streptococcus bovis Streptococcusintermedius Streptococcus peroris Streptococcus sobrinusStreptococcus canis Streptococcus lactarius Streptococcuspneumoniae Streptococcus suis Streptococcus constellatusStreptococcus milleri Streptococcus Streptococcus uberisStreptococcus downei Streptococcus mitis pseudopneumoniaeStreptococcus vestibularis Streptococcus dysgalactiae Streptococcusmutans Streptococcus pyogenes Streptococcus viridans Streptococcusequines Streptococcus oralis Streptococcus ratti StreptococcusStreptococcus faecalis Streptococcus tigurinus Streptococcussalivariu zooepidemicus Streptococcus ferus UliginosibacteriumVagococcus Vibrio Virgibacillus Xanthobacter UliginosibacteriumVagococcus carniphilus Vibrio aerogenes Virgibacillus Xanthobacteragilis gangwonense Vagococcus elongatus Vibrio aestuarianushalodenitrificans Xanthobacter Ulvibacter Vagococcus fessus Vibrioalbensis Virgibacillus aminoxidans Ulvibacter litoralis Vagococcusfluvialis Vibrio alginolyticus pantothenticus XanthobacterUmezawaea Vagococcus lutrae Vibrio campbellii Weissellaautotrophicus Umezawaea tangerina Vagococcus salmoninarum Vibriocholerae Weissella cibaria Xanthobacter flavus UndibacteriumVariovorax Vibrio cincinnatiensis Weissella confusa Xanthobactertagetidis Undibacterium pigrum Variovorax boronicumulans Vibriocoralliilyticus Weissella halotolerans Xanthobacter viscosusUreaplasma Variovorax dokdonensis Vibrio cyclitrophicus Weissellahellenica Xanthomonas Ureaplasma Variovorax paradoxus Vibriodiazotrophicus Weissella kandleri Xanthomonas urealyticumVariovorax soli Vibrio fluvialis Weissella koreensis albilineansUreibacillus Veillonella Vibrio furnissii Weissella minorXanthomonas alfalfae Ureibacillus composti Veillonella atypicaVibrio gazogenes Weissella Xanthomonas Ureibacillus suwonensisVeillonella caviae Vibrio halioticoli paramesenteroides arboricolaUreibacillus terrenus Veillonella criceti Vibrio harveyi Weissellasoli Xanthomonas Ureibacillus thermophilus Veillonella disparVibrio ichthyoenteri Weissella thailandensis axonopodisUreibacillus thermosphaericus Veillonella montpellierensis Vibriomediterranei Weissella viridescens Xanthomonas Veillonella parvulaVibrio metschnikovii Williamsia campestris Veillonella ratti Vibriomytili Williamsia marianensis Xanthomonas citri Veillonellarodentium Vibrio natriegens Williamsia maris Xanthomonas codiaeiVenenivibrio Vibrio navarrensis Williamsia serinedens XanthomonasVenenivibrio stagnispumantis Vibrio nereis Winogradskyellacucurbitae Verminephrobacter Vibrio nigripulchritudoWinogradskyella Xanthomonas Verminephrobacter eiseniae Vibrioordalii thalassocola euvesicatoria Verrucomicrobium Vibrioorientalis Wolbachia Xanthomonas fragariae Verrucomicrobiumspinosum Vibrio parahaemolyticus Wolbachia persica Xanthomonasfuscans Vibrio pectenicida Wolinella Xanthomonas gardneri Vibriopenaeicida Wolinella succinogenes Xanthomonas hortorum Vibrioproteolyticus Zobellia Xanthomonas hyacinthi Vibrio shiloniiZobellia galactanivorans Xanthomonas perforans Vibrio splendidusZobellia uliginosa Xanthomonas phaseoli Vibrio tubiashii ZoogloeaXanthomonas pisi Vibrio vulnificus Zoogloea ramigera Xanthomonaspopuli Zoogloea resiniphila Xanthomonas theicola Xanthomonastranslucens Xanthomonas vesicatoria Xylella Xylella fastidiosaXylophilus Xylophilus ampelinus Xenophilus Yangia Yersiniamollaretii Zooshikella Zobellella Xenophilus azovorans Yangiapacifica Yersinia philomiragia Zooshikella ganghwensis Zobellelladenitrificans Xenorhabdus Yaniella Yersinia pestis ZunongwangiaZobellella taiwanensis Xenorhabdus beddingii Yaniella flavaYersinia pseudotuberculosis Zunongwangia profunda ZeaxanthinibacterXenorhabdus bovienii Yaniella halotolerans Yersinia rohdeiZymobacter Zeaxanthinibacter Xenorhabdus cabanillasii YeosuanaYersinia ruckeri Zymobacter palmae enoshimensis Xenorhabdusdoucetiae Yeosuana aromativorans Yokenella Zymomonas ZhihengliuellaXenorhabdus griffiniae Yersinia Yokenella regensburgei Zymomonasmobilis Zhihengliuella Xenorhabdus hominickii Yersinia aldovaeYonghaparkia Zymophilus halotolerans Xenorhabdus koppenhoeferiYersinia bercovieri Yonghaparkia alkaliphila Zymophilus paucivoransXylanibacterium Xenorhabdus nematophila Yersinia enterocoliticaZavarzinia Zymophilus raffinosivorans Xylanibacterium ulmiXenorhabdus poinarii Yersinia entomophaga Zavarzinia compransorisXylanibacter Yersinia frederiksenii Xylanibacter oryzae Yersiniaintermedia Yersinia kristensenii

TABLE-US-00006 TABLE 6 Sequences: SEQ ID NO: 1 Salcr7-1 Sequencewritten 5' to 3'. Underlined: direct repeat Between direct repeats:spacer region corresponding (in 5' to 3' direction) to selectedtarget sequencesTGAAACACGCATTGATTTGAGTCAGCTAGGAGGTGACTGAAGTATATTTTAGATGAAGATTATTTCTTAATAA-CTAAAAATATGGTATAATACTCTTAATAAATGCAGTAATACAGGGGCTTTTCAAGACTGAAGTCTAGCTGAGACAAATAGTGCGATTACGAAATTTTTTAGACAAAAATAGTCTACGAGGTTTTAGAGCTATGCTG-TTTTGAATGGTCCCAAAACCGCTTTGGGTATACGCATTTTGAAGTACGGGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACTGTCAACGGGTGTACTATATGTCTGTCATGGTTTTAGAGCTATGCTGTTTT-GAATGGTCCCAAAACGCAAACCAGTACCGAAGAAGAGGCGCTCACGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACTGCCGTTCTGGTCATCCTGCTCGAAGCCGCGTTTTAGAGCTATGCTGTTTTGAAT-GGTCCCAAAACCCAGAAATGAATCGCCTGGCTTCATTATCGGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACATCAGCAGGAAGCGCTCAAAAACATACTGCGTTTTAGAGCTATGCTGTTTTGAATGGTC-CCAAAACAAGTGCGCCTGGTAGTCTTCCGGATAGCGGGTTTTAGAGCTATGCTGTTTTGAATGGACTCCATTCTTCAGCACACTGAGACTTGTTGAGTTCCATGTTTTAGAGCTATGCTGTTTTGAATGGACTCCA-TTCAACATTGCCGATGATAACTTGAGAAAGAGGGTTAATACCAGCAGTCGGATACCTTCCTATTCTTTCTGTTAAAGCGTTTTCATGTTATAATAGGCAAAAGAAGAGTAGTGTGAT 2 Salcr7-2Sequence written 5' to 3'. Underlined: direct repeat Between directrepeats: spacer region corresponding (in 5' to 3' direction) toselected target sequences of pipA, pipB, pipC, hilA, marT, sicP andsopB.TGAAACACGCATTGATTTGAGTCAGCTAGGAGGTGACTGAAGTATATTTTAGATGAAGATTATTTCTTAATAA-CTAAAAATATGGTATAATACTCTTAATAAATGCAGTAATACAGGGGCTTTTCAAGACTGAAGTCTAGCTGAGACAAATAGTGCGATTACGAAATTTTTTAGACAAAAATAGTCTACGAGGTTTTAGAGCTATGCTG-TTTTGAATGGTCCCAAAACTCTTTTTCATATGCGTAATTCATCAGTCTGGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACTATAACCGAGGATGGTTTTCTGAACCTGCGGTTTTAGAGCTATGCTGTTTT-GAATGGTCCCAAAACTATTAAATCGTTTATATGACGCGTTAGGCCGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACCACAATAATCCACAAGCTTTAGGATTACTGGTTTTAGAGCTATGCTGTTTTGAAT-GGTCCCAAAACTCTATTTCCCTTCCAGCAGTCGCACCCCAGGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACTTATCGCCTGTTTGTGGCGATTCTATCTGGGTTTTAGAGCTATGCTGTTTTGAATGGTC-CCAAAACTACTCACCGCGTCGAATATTTTCGGCAAAGGTTTTAGAGCTATGCTGTTTTGAATGGACTCCATTCTTCAGCACACTGAGACTTGTTGAGTTCCATGTTTTAGAGCTATGCTGTTTTGAATGGACTCCA-TTCAACATTGCCGATGATAACTTGAGAAAGAGGGTTAATACCAGCAGTCGGATACCTTCCTATTCTTTCTGTTAAAGCGTTTTCATGTTATAATAGGCAAAAGAAGAGTAGTGTGAT 3 Salcr7-3Sequence written 5' to 3'. Underlined: direct repeat Between directrepeats: spacer region corresponding (in 5' to 3' direction) toselected target sequences of pipA, pipB, pipC, hilA, marT, sicP andsopB.TGAAACACGCATTGATTTGAGTCAGCTAGGAGGTGACTGAAGTATATTTTAGATGAAGATTATTTCTTAATAA-CTAAAAATATGGTATAATACTCTTAATAAATGCAGTAATACAGGGGCTTTTCAAGACTGAAGTCTAGCTGAGACAAATAGTGCGATTACGAAATTTTTTAGACAAAAATAGTCTACGAGGTTTTAGAGCTATGCTG-TTTTGAATGGTCCCAAAACCTATTTATTGAAGATGTAGACCATTCTGGGGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACAGAAGCAATGAAAAGTGCAACTTCACCACGGTTTTAGAGCTATGCTGTTTT-GAATGGTCCCAAAACATCGCTTGCCGCAAACCAGTACCGAAGAAGGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACTTCGATTGACAGTACTATGGTTTACTTACGGTTTTAGAGCTATGCTGTTTTGAAT-GGTCCCAAAACATTGATTTGTCAGCAACCTTATAAAACGCGGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACGAAGCAATCTTATAAAAGATATAATTCAAGGTTTTAGAGCTATGCTGTTTTGAATGGTC-CCAAAACTAACCTGGAGATTCAGAAACAAAATACGGGGTTTTAGAGCTATGCTGTTTTGAATGGACTCCATTCTTCAGCACACTGAGACTTGTTGAGTTCCATGTTTTAGAGCTATGCTGTTTTGAATGGACTCCA-TTCAACATTGCCGATGATAACTTGAGAAAGAGGGTTAATACCAGCAGTCGGATACCTTCCTATTCTTTCTGTTAAAGCGTTTTCATGTTATAATAGGCAAAAGAAGAGTAGTGTGAT 4tracrRNA-Cas9 fragment sequence based on pCas9 Bold: tracrRNAUnderlined: Cas9 coding sequenceCGAAATCATCCTGTGGAGCTTAGTAGGTTTAGCAAGATGGCAGCGCCTAAATGTAGAATGATAAAAGGATTAA-GAGATTAATTTCCCTAAAAATGATAAAACAAGCGTTTTGAAAGCGCTTTTTTTGGTTTGCAGT##STR00001## ##STR00002##TGAAGAGATATTTTGAAAAAGAAAAATTAAAGCATATTAAACTAATTTCGGAGGTCATTAAAACTATTATTGA-AATCATCAAACTCATTATGGATTTAATTTAAACTTTTTATTTTAGGAGGCAAAAATGGATAAGAAATACTCAATAGGCTTAGATATCGGCACAAATAGCGTCGGATGGGCGGTGATCACTGATGAATATAAGGTTC-CGTCTAAAAAGTTCAAGGTTCTGGGAAATACAGACCGCCACAGTATCAAAAAAAATCTTATAGGGGCTCTTTTATTTGACAGTGGAGAGACAGCGGAAGCGACTCGTCTCAAACGGACAGCTCGTAGAAGGTATAC-ACGTCGGAAGAATCGTATTTGTTATCTACAGGAGATTTTTTCAAATGAGATGGCGAAAGTAGATGATAGTTTCTTTCATCGACTTGAAGAGTCTTTTTTGGTGGAAGAAGACAAGAAGCATGAACGTCATCCTATT-TTTGGAAATATAGTAGATGAAGTTGCTTATCATGAGAAATATCCAACTATCTATCATCTGCGAAAAAAATTGGTAGATTCTACTGATAAAGCGGATTTGCGCTTAATCTATTTGGCCTTAGCGCATATGATTAAGT-TTCGTGGTCATTTTTTGATTGAGGGAGATTTAAATCCTGATAATAGTGATGTGGACAAACTATTTATCCAGTTGGTACAAACCTACAATCAATTATTTGAAGAAAACCCTATTAACGCAAGTGGAGTAGATGCTAA-AGCGATTCTTTCTGCACGATTGAGTAAATCAAGACGATTAGAAAATCTCATTGCTCAGCTCCCCGGTGAGAAGAAAAATGGCTTATTTGGGAATCTCATTGCTTTGTCATTGGGTTTGACCCCTAATTTTAAATCA-AATTTTGATTTGGCAGAAGATGCTAAATTACAGCTTTCAAAAGATACTTACGATGATGATTTAGATAATTTATTGGCGCAAATTGGAGATCAATATGCTGATTTGTTTTTGGCAGCTAAGAATTTATCAGATGCTA-TTTTACTTTCAGATATCCTAAGAGTAAATACTGAAATAACTAAGGCTCCCCTATCAGCTTCAATGATTAAACGCTACGATGAACATCATCAAGACTTGACTCTTTTAAAAGCTTTAGTTCGACAACAACTTCCAGA-AAAGTATAAAGAAATCTTTTTTGATCAATCAAAAAACGGATATGCAGGTTATATTGATGGGGGAGCTAGCCAAGAAGAATTTTATAAATTTATCAAACCAATTTTAGAAAAAATGGATGGTACTGAGGAATTATTG-GTGAAACTAAATCGTGAAGATTTGCTGCGCAAGCAACGGACCTTTGACAACGGCTCTATTCCCCATCAAATTCACTTGGGTGAGCTGCATGCTATTTTGAGAAGACAAGAAGACTTTTATCCATTTTTAAAAGACA-ATCGTGAGAAGATTGAAAAAATCTTGACTTTTCGAATTCCTTATTATGTTGGTCCATTGGCGCGTGGCAATAGTCGTTTTGCATGGATGACTCGGAAGTCTGAAGAAACAATTACCCCATGGAATTTTGAAGAAGT-TGTCGATAAAGGTGCTTCAGCTCAATCATTTATTGAACGCATGACAAACTTTGATAAAAATCTTCCAAATGAAAAAGTACTACCAAAACATAGTTTGCTTTATGAGTATTTTACGGTTTATAACGAATTGACAAAG-GTCAAATATGTTACTGAAGGAATGCGAAAACCAGCATTTCTTTCAGGTGAACAGAAGAAAGCCATTGTTGATTTACTCTTCAAAACAAATCGAAAAGTAACCGTTAAGCAATTAAAAGAAGATTATTTCAAAAAAA-TAGAATGTTTTGATAGTGTTGAAATTTCAGGAGTTGAAGATAGATTTAATGCTTCATTAGGTACCTACCATGATTTGCTAAAAATTATTAAAGATAAAGATTTTTTGGATAATGAAGAAAATGAAGATATCTTAGA-GGATATTGTTTTAACATTGACCTTATTTGAAGATAGGGAGATGATTGAGGAAAGACTTAAAACATATGCTCACCTCTTTGATGATAAGGTGATGAAACAGCTTAAACGTCGCCGTTATACTGGTTGGGGACGTTTG-TCTCGAAAATTGATTAATGGTATTAGGGATAAGCAATCTGGCAAAACAATATTAGATTTTTTGAAATCAGATGGTTTTGCCAATCGCAATTTTATGCAGCTGATCCATGATGATAGTTTGACATTTAAAGAAGACA-TTCAAAAAGCACAAGTGTCTGGACAAGGCGATAGTTTACATGAACATATTGCAAATTTAGCTGGTAGCCCTGCTATTAAAAAAGGTATTTTACAGACTGTAAAAGTTGTTGATGAATTGGTCAAAGTAATGGGGCG-GCATAAGCCAGAAAATATCGTTATTGAAATGGCACGTGAAAATCAGACAACTCAAAAGGGCCAGAAAAATTCGCGAGAGCGTATGAAACGAATCGAAGAAGGTATCAAAGAATTAGGAAGTCAGATTCTTAAAGAG-CATCCTGTTGAAAATACTCAATTGCAAAATGAAAAGCTCTATCTCTATTATCTCCAAAATGGAAGAGACATGTATGTGGACCAAGAATTAGATATTAATCGTTTAAGTGATTATGATGTCGATCACATTGTTCCAC-AAAGTTTCCTTAAAGACGATTCAATAGACAATAAGGTCTTAACGCGTTCTGATAAAAATCGTGGTAAATCGGATAACGTTCCAAGTGAAGAAGTAGTCAAAAAGATGAAAAACTATTGGAGACAACTTCTAAACGC-CAAGTTAATCACTCAACGTAAGTTTGATAATTTAACGAAAGCTGAACGTGGAGGTTTGAGTGAACTTGATAAAGCTGGTTTTATCAAACGCCAATTGGTTGAAACTCGCCAAATCACTAAGCATGTGGCACAAATT-TTGGATAGTCGCATGAATACTAAATACGATGAAAATGATAAACTTATTCGAGAGGTTAAAGTGATTACCTTAAAATCTAAATTAGTTTCTGACTTCCGAAAAGATTTCCAATTCTATAAAGTACGTGAGATTAACA-ATTACCATCATGCCCATGATGCGTATCTAAATGCCGTCGTTGGAACTGCTTTGATTAAGAAATATCCAAAACTTGAATCGGAGTTTGTCTATGGTGATTATAAAGTTTATGATGTTCGTAAAATGATTGCTAAGTC-TGAGCAAGAAATAGGCAAAGCAACCGCAAAATATTTCTTTTACTCTAATATCATGAACTTCTTCAAAACAGAAATTACACTTGCAAATGGAGAGATTCGCAAACGCCCTCTAATCGAAACTAATGGGGAAACTGGA-GAAATTGTCTGGGATAAAGGGCGAGATTTTGCCACAGTGCGCAAAGTATTGTCCATGCCCCAAGTCAATATTGTCAAGAAAACAGAAGTACAGACAGGCGGATTCTCCAAGGAGTCAATTTTACCAAAAAGAAATT-CGGACAAGCTTATTGCTCGTAAAAAAGACTGGGATCCAAAAAAATATGGTGGTTTTGATAGTCCAACGGTAGCTTATTCAGTCCTAGTGGTTGCTAAGGTGGAAAAAGGGAAATCGAAGAAGTTAAAATCCGTTAA-AGAGTTACTAGGGATCACAATTATGGAAAGAAGTTCCTTTGAAAAAAATCCGATTGACTTTTTAGAAGCTAAAGGATATAAGGAAGTTAAAAAAGACTTAATCATTAAACTACCTAAATATAGTCTTTTTGAGTTA-GAAAACGGTCGTAAACGGATGCTGGCTAGTGCCGGAGAATTACAAAAAGGAAATGAGCTGGCTCTGCCAAGCAAATATGTGAATTTTTTATATTTAGCTAGTCATTATGAAAAGTTGAAGGGTAGTCCAGAAGATA-ACGAACAAAAACAATTGTTTGTGGAGCAGCATAAGCATTATTTAGATGAGATTATTGAGCAAATCAGTGAATTTTCTAAGCGTGTTATTTTAGCAGATGCCAATTTAGATAAAGTTCTTAGTGCATATAACAAACA-TAGAGACAAACCAATACGTGAACAAGCAGAAAATATTATTCATTTATTTACGTTGACGAATCTTGGAGCTCCCGCTGCTTTTAAATATTTTGATACAACAATTGATCGTAAACGATATACGTCTACAAAAGAAGTT-TTAGATGCCACTCTTATCCATCAATCCATCACTGGTCTTTATGAAACACGCATTGATTTGAGTCAGCTAGGAGGTGACTGA 5 Salcr3.2 (crRNA-pipC-hilA-marT) Sequencewritten 5' to 3'. Underlined: direct repeat Between direct repeats:spacer region corresponding (in 5' to 3' direction) to selectedtarget sequences of pipC-hilA-marTTGTCGACGGTATATTTTAGATGAAGATTATTTCTTAATAACTAAAAATATGGTATAATACTCTTAATAAATGC-AGTAATACAGGGGCTTTTCAAGACTGAAGTCTAGCTGAGACAAATAGTGCGATTACGAAATTTTTTAGACAAAAATAGTCTACGAGGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACATCGCTTGCCGCAA-ACCAGTACCGAAGAAGGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACTTCGATTGACAGTACTATGGTTTACTTACGGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACATTGATTTGTCAGCAACC-TTATAAAACGCGGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACTTCAGCACACTGAGACTTGTTGAGTTCCATGTTTTAGAGCTATGCTGTTTTGAATGGTCTCCATTCAACATTGCCGATGATAACTTGA-GAAAGAGGGTTAATACCAGCAGTCGGATACCTTCCTATTCTTTCTGTTAAAGCGTTTTCATGTTATAATAGGCAAAAGAAGAGTAGTGTGAT 6 mob (oriT)TTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTA-TCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAA 7 pZA31MCSATCCCATGGTACGCGTGCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTA-TCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCCCTAGACCTAGGGATATATTCCGCTTCCTCGCTCACTGACTCGCTACGCTCGGTCGTTCGACTGCGGCGAGCGGAAATGGCTTACGAA-CGGGGCGGAGATTTCCTGGAAGATGCCAGGAAGATACTTAACAGGGAAGTGAGAGGGCCGCGGCAAAGCCGTTTTTCCATAGGCTCCGCCCCCCTGACAAGCATCACGAAATCTGACGCTCAAATCAGTGGTGGCG-AAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGCGGCTCCCTCGTGCGCTCTCCTGTTCCTGCCTTTCGGTTTACCGGTGTCATTCCGCTGTTATGGCCGCGTTTGTCTCATTCCACGCCTGACACT-CAGTTCCGGGTAGGCAGTTCGCTCCAAGCTGGACTGTATGCACGAACCCCCCGTTCAGTCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGAAAGACATGCAAAAGCACCACTGGCAGCA-GCCACTGGTAATTGATTTAGAGGAGTTAGTCTTGAAGTCATGCGCCGGTTAAGGCTAAACTGAAAGGACAAGTTTTGGTGACTGCGCTCCTCCAAGCCAGTTACCTCGGTTCAAAGAGTTGGTAGCTCAGAGAACC-TTCGAAAAACCGCCCTGCAAGGCGGTTTTTTCGTTTTCAGAGCAAGAGATTACGCGCAGACCAAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTACTAGATTTCAGTGCAATTTATCTCTTCAA-ATGTAGCACCTGAAGTCAGCCCCATACGATATAAGTTGTTACTAGTGCTTGGATTCTCACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTCTGAACAAATCCAGATGGAGTTCTGAGGTCATTACTGGATCTAT-CAACAGGAGTCCAAGCGAGCTCGATATCAAATTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAGACGGCATGATGAACCTGAATCGCCAGCGG-CATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTC-TCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGA-AAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTT-CTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATT-TTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAGATAT-CGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAC 8 spCas9-6 forward primer ATTGTTTGTGGAGCAGCATAAGC 9mob2 reverse primer GCCTCTAGCACGCGTACCATGGGAT 10 trfA module forgenomic insertion DH10B (written 5' to 3') Bracketed sequence:encodes trfA mRNA (complement strand) Capital letters at 5':bi-directional synthetic rho-independent terminator to preventread-through from the trfA gene as well as upstream gene on thechromosome Lower case letters at 3': J23105 promoter, a weak tointermediate strength promoter (capital T indicates transcriptionstart site)CTTAATAAAAACCCGCTTGGGCAAGCGGGTTTTATTGTGCAATTAGGCC[CTAGCGTTTGCAATGCACCAGGT-CATCATTGACCCAGGCGTGTTCCACCAGGCCGCTGCCTCGCAACTCTTCGCAGGCTTCGCCGACCTGCTCGCGCCACTTCTTCACGCGGGTGGAATCCGATCCGCACATGAGGCGGAAGGTTTCCAGCTTGAGCGG-GTACGGCTCCCGGTGCGAGCTGAAATAGTCGAACATCCGTCGGGCCGTCGGCGACAGCTTGCGGTACTTCTCCCATATGAATTTCGTGTAGTGGTCGCCAGCAAACAGCACGACGATTTCCTCGTCGATCAGGACC-TGGCAACGGGACGTTTTCTTGCCACGGTCCAGGACGCGGAAGCGGTGCAGCAGCGACACCGATTCCAGGTGCCCAACGCGGTCGGACGTGAAGTCCATCGCCGTCGCCTGTAGGCGCGACAGGCATTCCTCGGCCT-TCGTGTAATACCGGCCATTGATCGACCAGCCCAGGTCCTGGCAAAGCTCGTAGAACGTGAAGGTGATCGGCTCGCCGATAGGGGTGCGCTTCGCGTACTCCAACACCTGCTGCCACACCAGTTCGTCATCGTCGGC-CCGCAGCTCGACGCCGGTGTAGGTGATCTTCACGTCCTTGTTGACGTGGAAAATGACCTTGTTTTGCAGCGCCTCGCGCGGGATTTTCTTGTTGCGCGTGGTGAACAGGGCAGAGCGGGCCGTGTCGTTTGGCATC-GCTCGCATCGTGTCCGGCCACGGCGCAATATCGAACAAGGAAAGCTGCATTTCCTTGATCTGCTGCTTCGTGTGTTTCAGCAACGCGGCCTGCTTGGCCTCGCTGACCTGTTTTGCCAGGTCCTCGCCGGCGGTTT-TTCGCTTCTTGGTCGTCATAGTTCCTCGCGTGTCGATGGTCATCGACTTCGCCAAACCTGCCGCCTCCTGTTCGAGACGACGCGAACGCTCCACGGCGGCCGATGGCGCGGGCAGGGCAGGGGGAGCCAGTTGCAC-GCTGTCGCGCTCGATCTTGGCCGTAGCTTGCTGGACCATCGAGCCGACGGACTGGAAGGTTTCGCGGGGCGCACGCATGACGGTGCGGCTTGCGATGGTTTCGGCATCCTCGGCGGAAAACCCCGCGTCGATCAGT-TCTTGCCTGTATGCCTTCCGGTCAAACGTCCGATTCATTCACCCTCCTTGCGGGATTGCCCCGACTCACGCCGGGGCAATGTGCCCTT]gTagctagcatagtacctaggactgagctagccgtaaa 11aroA coding sequenceATGGAATCCCTGACGTTACAACCCATCGCTCGTGTCGATGGCACTATTAATCTGCCCGGTTCCAAGAGCGTTT-CTAACCGCGCTTTATTGCTGGCGGCATTAGCACACGGCAAAACAGTATTAACCAATCTGCTGGATAGCGATGACGTGCGCCATATGCTGAATGCATTAACAGCGTTAGGGGTAAGCTATACGCTTTCAGCCGATCG-TACGCGTTGCGAAATTATCGGTAACGGCGGTCCATTACACGCAGAAGGTGCCCTGGAGTTGTTCCTCGGTAACGCCGGAACGGCAATGCGTCCGCTGGCGGCAGCTCTTTGTCTGGGTAGCAATGATATTGTGCTG-ACCGGTGAGCCGCGTATGAAAGAACGCCCGATTGGTCATCTGGTGGATGCGCTGCGCCTGGGCGGGGCGAAGATCACTTACCTGGAACAAGAAAATTATCCGCCGTTGCGTTTACAGGGCGGCTTTACTGGCGGCA-ACGTTGACGTTGATGGCTCCGTTTCCAGCCAATTCCTCACCGCACTGTTAATGACTGCGCCTCTTGCGCCGGAAGATACGGTGATTCGTATTAAAGGCGATCTGGTTTCTAAACCTTATATCGACATCACACTCAA-TCTGATGAAGACGTTTGGTGTTGAAATTGAAAATCAGCACTATCAACAATTTGTCGTAAAAGGCGGGCAGTCTTATCAGTCTCCGGGTACTTATTTGGTCGAAGGCGATGCATCTTCGGCTTCTTACTTTCTGGCA-GCAGCAGCAATCAAAGGCGGCACTGTAAAAGTGACCGGTATTGGACGTAACAGTATGCAGGGTGATATTCGCTTTGCTGATGTGCTGGAAAAAATGGGCGCGACCATTTGCTGGGGCGATGATTATATTTCCTGCA-CGCGTGGTGAACTGAACGCTATTGATATGGATATGAACCATATTCCTGATGCGGCGATGACCATTGCCACGGCGGCGTTATTTGCAAAAGGCACCACCACGCTGCGCAATATCTATAACTGGCGTGTTAAAGAGAC-CGATCGCCTGTTTGCGATGGCAACAGAACTGCGTAAAGTCGGCGCGGAAGTGGAAGAGGGGCACGATTACATTCGTATCACTCCTCCGGAAAAACTGAACTTTGCCGAGATCGCGACATACAATGATCACCGGATG-GCGATGTGTTTCTCGCTGGTGGCGTTGTCAGATACACCAGTGACGATTCTTGATCCCAAATGCACGGCCAAAACATTTCCGGATTATTTCGAGCAGCTGGCGCGGATTAGCCAGGCAGCCTGA 12oriV RK2Tgacacttgaggggcgtttagagcgagccaggaaagccgaccccctccttggagtaaaaacccttgcggcgtt-gcagccggcacggatcttccgatcgggcgcggtggtggccgcgtctgtgacctaaaaaggggggagtccagaggggcgcagcccctttgggcatagcgcagcgtaatcggagacgtaattgagcatttccaggc-gcttgcgcctggtcaacgaaagagtcagcgccgtaggcgctgccatttttggggtgaggccgttcgcggccgaggggcgcagcccctggggggatgggaggcccgcgttagcgggccgggagggttcgagaaggg-

ggggcaccccccttcggcgtgcgcggtcacgcgccagggcgcagccctggttaaaaacaaggtttataaatattggtttaaaagcaggttaaaagacaggttagcggtggccgaaaaacgggcggaaacc-cttgcaaatgctggattttctgcctgtggacagcccctcaaatgtcaataggtgcgcccctcatctgtcatcactctgcccctcaagtgtcaaggatcgcgcccctcatctgtcagtagtcgcgcccctcaagtgtcaat-accgcagggcacttatccccaggcttgtccacatcatctgtgggaaactcgcgtaaaatcaggcgttttcgccgatttgcgaggctggccagctccacgtcgccggccgaaatcgagcctgcccctcatctgtcaacgcc-gcgccgggtgagtcggcccctcaagtgtcaacgtccgcccctcatctgtcagtgagggccaagttttccgcgtggtatccacaacgccggcggccgcggtgtctcgcacacggcttcgacggcgtttctggcgcgt-ttgcagggccatagacggccgccagcccagcggcgagggcaaccagcccggtgagcgtcggaaaggcgctggaagccccgtagcgacgcggagaggggcgagacaagccaagggcgcaggctcgatgcgcagca-cgacatagccggttctcgcaaggacgagaatttccctgcggtgcccctcaagtgtcaa 13 tra2module trbB-L RK2ttgcaggctaaacactttcggtatatcgtttgcctgtgcgataatgttgctaatgatttgttgcgtaggggtt-actgaaaagtgagcgggaaagaagagtttcagaccatcaaggagcgggccaagcgcaagctggaacgcgacatgggtgcggacctgttggccgcgctcaacgacccgaaaaccgttgaagtcatgctcaacgcggacgg-caaggtgtggcacgaacgccttggcgagccgatgcggtacatctgcgacatgcggcccagccagtcgcaggcgattatagaaacggtggccggattccacggcaaagaggtcacgcggcattcgcccatcctg-gaaggcgagttccccttggatggcagccgctttgccggccaattgccgccggtcgtggccgcgccaacctttgcgatccgcaagcgcgcggtcgccatcttcacgctggaacagtacgtcgaggcgggcatcatg-acccgcgagcaatacgaggtcattaaaagcgccgtcgcggcgcatcgaaacatcctcgtcattggcggtactggctcgggcaagaccacgctcgtcaacgcgatcatcaatgaaatggtcgccttcaacccgtctg-agcgcgtcgtcatcatcgaggacaccggcgaaatccagtgcgccgcagagaacgccgtccaataccacaccagcatcgacgtctcgatgacgctgctgctcaagacaacgctgcgtatgcgccccgaccgcatcc-tggtcggtgaggtacgtggccccgaagcccttgatctgttgatggcctggaacaccgggcatgaaggaggtgccgccaccctgcacgcaaacaaccccaaagcgggcctgagccggctcgccatgcttatcagcat-gcacccggattcaccgaaacccattgagccgctgattggcgaggcggttcatgtggtcgtccatatcgccaggacccctagcggccgtcgagtgcaagaaattctcgaagttcttggttacgagaacggccagta-catcaccaaaaccctgtaaggagtatttccaatgacaacggctgttccgttccgtctgaccatgaatcgcggcattttgttctaccttgccgtgttcttcgttctcgctctcgcgttatccgcgcatccggcgatggcc-tcggaaggcaccggcggcagcttgccatatgagagctggctgacgaacctgcgcaactccgtaaccggcccggtggccttcgcgctgtccatcatcggcatcgtcgtcgccggcggcgtgctgatcttcggcggcgaact-caacgccttcttccgaaccctgatcttcctggttctggtgatggcgctgctggtcggcgcgcagaacgtgatgagcaccttcttcggtcgtggtgccgaaatcgcggccctcggcaacggggcgctgcaccaggtgca-agtcgcggcggcggatgccgtgcgtgcggtagcggctggacggctcgcctaatcatggctctgcgcacgatccccatccgtcgcgcaggcaaccgagaaaacctgttcatgggtggtgatcgtgaactggtgat-gttctcgggcctgatggcgtttgcgctgattttcagcgcccaagagctgcgggccaccgtggtcggtctgatcctgtggttcggggcgctctatgcgttccgaatcatggcgaaggccgatccgaagatgcggttcg-tgtacctgcgtcaccgccggtacaagccgtattacccggcccgctcgaccccgttccgcgagaacaccaatagccaagggaagcaataccgatgatccaagcaattgcgattgcaatcgcgggcctcggcgcgcttc-tgttgttcatcctctttgcccgcatccgcgcggtcgatgccgaactgaaactgaaaaagcatcgttccaaggacgccggcctggccgatctgctcaactacgccgctgtcgtcgatgacggcgtaatcgtgggcaaga-acggcagctttatggctgcctggctgtacaagggcgatgacaacgcaagcagcaccgaccagcagcgcgaagtagtgtccgcccgcatcaaccaggccctcgcgggcctgggaagtgggtggatgatccatgtg-gacgccgtgcggcgtcctgctccgaactacgcggagcggggcctgtcggcgttccctgaccgtctgacggcagcgattgaagaagagcgccggcggcatttcgagagcctgggaacgatgtacgagggctatt-tcgtcctcaccttgacctggttcccgccgctgctcgcccagcgcaagttcgtcgagctgatgtttgacgacgacgcgaccgcaccggatcgcaaggcgcgcacgcggggcctcatcgaccaattcaagcgtgacgtgc-gcagcatcgagtcgcgcctgtcgtcggccgtgtcgctcactcgcttgaaggggcacaagatcgtcaacgaggacggcacgaccgtcacgcatgacgacttcctgcgctggctgcaattctgcgtgacgggcct-gcaccatccggtgcagctccccagcaacccgatgtacctggacgccctggtcggcggacaggaaatgtggggcggggtagtgcccaaggtcggccgcaagttcgtccaggtggtcgctctcgaaggcttcccctt-ggagtcctatcccggcatcctgacggcgctcggcgagctgccctgcgagtatcggtggtcgagccggttcatcttcatggaccagcacgaagccgtgaagcacctcgacaagttccgcaagaagtggcggcagaag-attcgcggcttcttcgaccaggtgttcaacacgaacaccggcccggtcgatcaggacgcgctttcgatggtggccgatgctgaggcggccattgccgaagtcaacagcggcatcgtggccgtgggctactacacca-gcgtcgtcgtgctgatggatgaggaccgcacgcgcctggaagctgcggcccgcgatgttgaaaaggccgtcaaccggttgggctttgccgcgcgcatcgagtccatcaacaccctggacgccttccttggtagt-ttgccgggccacggcgtggaaaacgtccgccggccgctcatcaacacgatgaacctggccgacctgctgccgaccagcaccatctggaccggcaacgcgaacgcgccatgcccgatgtacccgccgctgtcgccgg-cgctcatgcactgcgtcacgcaaggatcaacgccgttccggctgaacctgcacgtgcgcgacctcggccacacctttatgttcgggccgaccggcgcaggtaaatcgacgcacctggcgatcctcgccgcgcag-ctccgtcgctatgccggcatgtcgatcttcgcctttgacaagggcatgtcgatgtacccgctggccgccggcatccgtgcggccacgaagggcaccagcggcctgcacttcaccgtggcggccgacgacgaacgcct-ggcgttctgcccgttgcagttcctgagcaccaagggcgaccgtgcttgggcgatggagtggatcgacaccatcctggcgttgaacggcgtcgaaacgaccccggcccagcgcaacgaaatcggcaacgcgatc-atgagcatgcacgccagcggcgcgcgcacgctctccgagttcagcgtgacgattcaggatgaggcgatccgcgaggcgatccgccagtacaccgtcgatggcgcaatgggccatctgctcgacgccgaagagg-acggcttggcgctgtccgactttacagtgttcgagatcgaagagctgatgaacctcggcgagaaattcgccctgcctgtgttgctctacctgttccgccgtatcgagcgcgccctgacgggccagccggccgtc-atcatcctggacgaagcctggttgatgctcggccacccggcattccgcgcgaagatcagggaatggctcaaggtgctgcgtaaggccaactgccttgtgctgatggcaacgcagagcctgtccgacgccgccaacag-cggcatcctggacgtgatcgtggaatcgaccgcgaccaagattttcctgccgaatatttacgccagggatgaggacacggcggccctgtaccgccgcatgggcctgaacgctcgccagatcgagattctggcccagg-ccgttcccaagcgtcagtactactacgtgtcggaaaacggccgccgtctctacgacctggcacttggcccgctcgcgctcgcgttcgtcggcgcatccgacaaggaatccgtcgccatcatcaagaacctggaag-ccaagttcggcgaccagtgggtggatgaatggctgcgtggccggggcctcgcccttgatgaatacctggaggcagcatgagttttgcagacacgatcaagggcttgatcttcaagaagaagcccgcaacggccgca-gcagcggcgacgccggccgcgaccggcccgcaaaccgacaacccgtacctgacggcgcggcgcacctggaacgaccacgttggttccgttgtgtcgcaaaagcagacctggcaggttgtcggcatcctttcg-ctgatgatcgtcctcgcggcggtcggcggcatcatccacatcggcagccagtcgaagttcgtgccctatgtctacgaggtagacaagctcgggcagacggccgccgtggggccgatgaccagggcgtcgaaagccga-tccgcgtgtcattcacgcctcggtggctgagttcgtcggcgatgctcgcctggtgacgccggacgtagctttgcagcgcaaggccgtctaccgcctctatgccaagctcgggccgaatgacccggccaccgcca-agatgaacgaatggctcaacggcaccgccgacgccagcccgttcgctcgcgcggccgtcgaaacggtcagcaccgaaatcacttccgtaatcccgcagacgcccgacacctggcaggtcgattgggtcgagac-gacgcgcgacaggcaaggcgtggtgaaaggccagcccgtgcgcatgcgggccttggtgacggtctacgtcgtcgagccgacggcggacaccaaggaagaacaactgcgaaacaacccggccgggatctacgtc-cgggacttctcctggtcgagacttctgtgaggcactgaattatgaaaaaggaactgtttgctttggtcctggccgcgtccgttagcgtgcctgcatttgccgccgatcccggcgcggacctgactgacctctatttt-tccggcaagaacccggagctgaccgcgcaagagcgggcggccatcgccatcgccaagaagtgggaggcgggtaccgccggcatgcggccggtggccggccccggtggttcggtgcgcttcctgttcggcgcgcag-cagccgagcatcgtatgcgccgtgctgcaagtgtgcgacgtggccctgcaacccggcgagcaagtcaactcgatcaacctgggcgacaccgcccgttggacggtcgagccggccattaccggcagcggcgcg-aacgaaacccagcacctcatcatcaagccgatggatgtgggcctggaaaccagcctggtcgtgaccacggaccgccgcagctaccacatgcgcctgcgctcgcatcgcacgcagtacatgccgcaggtgtcgt-tcacctacccggaagatgcccttgcgaagtgggacgccatcaagaaccgcgaacagcgggatcgcgtcgagaaaaccattccgcagaccggcgagtacctgggcaacctgagcttcaactactccgtcagcgg-gtccacgtcgtggaagccggtgcgcgtctacaacgacggcaagaaaaccatcatccagatgccgcactcgatggaacagaccgaagcgccgacgctcctggtcgttcgcagggagggcggcctgttctccgacga-tgaaacggtgatggtcaactaccgggtccagggcgaccgctacatcgtcgatacgattttcgacaaggccatcctcatcgcgggcgtgggcagcagccaggaccgcgtgaccatttcaagggggaactaaaccat-gcgtaagattctgaccgtcatcgcactcgcggccacgttggccggctgcgcgacctccaagtacggcagcttcgtccaggacgcgccggccgcctacaaccagaccattgcgaccgacgcggtgaagcagctcgt-caagctctacccgccggcgcaaaccaagctggaattgcagcaggctacgcccgatccgttcggcattgccctggtcactgaccttcgcgcccagggctatgctgtcatggagtacaagcccgacggcaacgcgg-ccgcagctccggctgctgcgtcctcggccgctgcgaagccggcaacgccgcaagcccagggcggctatccgctgcgctacgtgctggaccaattcagcgacagcaacctgtatcgcctgaccgtcatggtcgg-ctctcaatcgctcacgcgcgcctacctcgcccaaaacaacacgatggtcccggccggcgcatgggttcggaaggagtaagccaatgagcgaagatcaaatggcaccggacgcatcgccagatgcggtcaagccgaa-aagcggggttcgccgcgtcaacaacatgccgatgtacctcatcggcggtgtgctcggcatcttcctgctggtgatggccctggttgctgcggatcgcgctgcgcagcagaaccagccgggagctgcgaaggctg-agaaggccggcagcaccagcatgtttgccgacgaaattgccggcaaacagcaggacggcatcatcaaggccaagccgctggagattccgccggaacaaaccgcccagcaaccgacgacggagctgacgccagc-cccggcgcagggaacgactatcacggtcgcacggcccgagaacctggaccagcccccgacgccgccgcagggtgcgcgcaacgaggacctggaccgcatccgcatggcgaagttgcagatgctggaagag-gcgatcaaggccaagacgacggtgcgcatcgacgcgccgcgcagccagggcagcgccggcggcggtgctccgcagggccgcgaggaaacccttgcgcgcatccaggagctgcgtcggcaggctgagaac-gcccgcgccaccgatccgaccgccgcctatcaggccgcgcttgcgcaggctcgcacgatgggcggcgcggcagggggtggcggtatgggcggctcgggtgcgccgaccctcgtgcagacctcgaaccgcag-tggtggcggcgctggctatgggtcgttcgacaaccgcagcgagggcgaccgttggcggctcgactcccagccggaagcacctgcaacgccctatgtgctgcgcgctggcttcgtcgttccggctacgctta-tctcgggcatcaactccgatctgccaggccaaatcatggcccaggtatcgcagtcggtgtacgacacggcgaccggcaagcacatgctcatcccccaaggctcgcgcctggtgggcagctactcgaacgatgtggcct-acgggcagaagcgcgttctggtggcatggcagcgcatcatcttccccgacggcaaggcaatggacattggggccatgccgggcggcgatagcgctgggtatgcaggcttcaacgacaaggtcaacaaccactac-ttccgcaccttcgcatcggcattcctcatgtcgggcgtcgttgcgggcatcagcttgagtcaggaccgtggcaacagcaacagcggttacggacgacaagacgcgggttccgcgatgagtgaagcgttgggtcaac-agctcggccaagtaacggcgcagatgatcgccaaaaacttgaatatcgcgccgacgctggaaatccgtccgggctatcgcttcaacgtcattgtcacgaaagacatgacgttttctaagccctaccaggcgtt-tgactattaactccaaggagtaacttatgaagaagctcgctaagaatgttttagccgctaaagtagctctggtgctggccctctcggtcggcaccttggcggtcacgcctgcgcaagcgggcattccggtcatcgacgg-caccaacctgtcacaaaccactgtcaccgcgattcagcaggttgcgcaggtccagaagcaaatcgaggaataccggacgcagttgcagcagtacgaaaacatgctgcaaaacacggtggccccggccgcctacgtgtgg-gaccaggcgcagtccaccatcaacggcctgatgagcgccgttgataccctgaactactacaagaaccaggcgggcagcatcgacgcttacctgggcaagttcaaggacgtgtcctactacaaggggtcgccgtg-cttctccctgtcgggctgctcggaaagcgagcgcaaggcgatggaagagaaccgccgcctggcgtccgaatcgcagaaaaaggccaacgatgcgctgttccgtggcctcgatcagcagcagagcaacctcaagt-ccgacgccgccacgctggagcaattgaagggcaaggcgacgacggcgcagggccagttggaagccctcggctacgccaaccagttcgccagccagcaggccaaccagctcatgcaaatccgtggccttctgc-ttgcgcagcagaacgccatcgccacgcagatgcaggcccagcaggaccggcaggcccagcaggacgctgcgggcgcgaagctgcgcgagggttcgtaccgcgcaagcccgtctaagacctggtgaggggaggc-gcgatgaagaaatccaacttcatcgcagttgccgcgctggccgccgtcatggcggccagcctggcaggctgcgacaacaagcccgacaccgacaagctgacctgcgccgatctgccgaaggtcacggatgcc-gctcaacgcgcggagctgttgaagaagtgcccgcgcggagaaccgggaggcttcaagcccagcgaaaagaaagagtggtgatgacgtatgaaaatccagactagagctgccgcgctcgcggtcctgatgctg-gccttgatgccggtagcggcatacgcccaaatcgacaattcgggcatcctcgacaacgtattgcagcgctaccagaacgccgcgagcggctgggccactgtcgtccagaacgccgcaacctggctgttctggacct-tgaccgtgattagcatggtctggaccttcggcatgatggcactgcgcaaggccgacattggcgagttcttcgccgagttcgtgcggttcaccatcttcaccggcttcttctggtggctgctgaccaacggcccga-atttcgcgtcgtccatctatgcgtccctgcggcagattgcaggccaggcaacggggttggggcaggggctttcgccgtccggcatcgtcgatgttggcttcgagattttcttcaaggtgatggacgaaacctcgtactg-gtcgccggtcgatagcttcgtcggtgcctcgttggcggccgccatcctctgcatcctggccctggtcggcgtgaatatgcttctgctcctggcgtccggatggattcttgcctacggcggtgtgttcttcctgggcttcgg-cggctcgcgctggacctcggacatggcgatcaactactacaagaccgtcctcggggtcgccgcgcagctcttcgcaatggtgctgctcgtaggcatcggcaagaccttcctcgatgactactacagccgcatgagcgaa-ggcatcaacttcaaggaacttggagtgatgctgatcgtcggcctgatcctgctcgttctggtcaacaaggtgccgcagctcatcgccggcatcatcaccggcgcgagcgtcggcggtgctggtatcggccagttcggcgc-tggcacgctcgtcggtgcggccgcgacggccggcgcggcaatcgcaactggcggcgcatctatcgcggccggcgctgcggcggcggccggtggcgcgcaggccatcatggcggccgcgtcgaaggccagcga-taacgtctctgccggcactgacattctgtcgagcatgatgggcggcggcggtggcggcggcggtggtagcgccggcaccagcggcggcgacggcggcggctcgggtggcggcggtggctcgggcggcggtga-aaccccgatggcctcggccgccggcgacaacagcagcggcgcacgcggcggcagttcgggcggcggctcgggtggtggccgttcgtctggcggtatcggtgccacggcggccaagggcggccggatcg-cggccgataccgtcgccaacctggcgaaaggtgccggctcgattgccaaggccaaggccggcgaaatgcgcgcatcggcccaggaacgcatcggcgataccgtaggcggcaagatcgcgcaggcaattcgcg-gcgcgggtgcggcggcgcagaccgctgcaaccgtcgccgatagcaacagccaggcgcaggaacaacctgcaccggcacccgcaccgtcgttcgacgacaacagcctttccgcaagcaacaacagggaagc-ggccgccgacgcggattccgaagtggcgagcttcgtcaacaagcccgcccaatcctga 14 tra1module traFG-traJXIH-traKLM RK2tcaccaggtcagaaccggcctgatgacggtgatgatttgcgaacgattgacaggcccgaagtagcggccgtcg-aaagacgtgtcgcttacgtcggacataagcagaacctcggcggtccccagggtgtagctgtcggactgataacgaggcagcggccgtcctgatggatcggccttgatgagcgcgctgtgaggcagcagcccgcca-ttcacgcgcacgccggcgtcggtgatggcaacctcgtcgcctttagcggctaaaactcgcttcatcatgtagccgtagtcgccggggcagaaaccgccggcgatgtagccccgctccttggcgtccgaaaacacg-ccgacttgcggcgggcagaacatgacgtaagcccccttctccaccggcgcattcgatttccagtacaggccgaccggaatgcttttggtggtgttgaccttcgcgccggcgagataggccgcgccggcgagcaac-aaggccgcgccgcctccgatggcgacgtacttggtgaggcgctggaagcggctcatatcgtgatcccctccccttcctcgacggtggccgtctggatcagcttgtcgctgaccttcggagccggtacggccgcg-cgggcctggaatatcgggtctttgaagtagagcggctgcttgccgtagatcgcgggatagccggcgacgtacacaaccatgtcgcccgcctcttcaatgctgccgtcggcgctcttcttcggccccggcatgcgcag-gcattcatcgggggtcagcaatggccgctgcacttcctggaaggtccgcgagacgttgcccaacagcgccgacgtgcggcggccgctcgtcgtgatctgctccttcacgatggtcgtggtgcctgtcagttttgaca-ggtgctcggccgtctccacgcggttcggcgggtaggcgttctgcacgtggcagttcgacgtgatgctttcgtcgtggccgtagccggtttcgcggctcttgagctggttaatgtcctggcagatgaggtagcacttga-tgccgtagccggcgacgaaggcaagggactcttgcaggatttcgagcttgcccaggctggggaactcgtcgagcatcatcagcagacgatgcttgtagtgcgcgacaggacggccgttctcgaagtccatcttgtcgg-ccagcagccggacgatcatgttgaccatgacgcgcaccagaggccgcagacgggccttgtcgttgggctgcgtcacgatgaacaggcttaccgggtcgtcgtggtgcatcagttgcttgatgcggaagtcggactt-gctgacgttgcgggccacaaccgggtcgcggtacagggccaggtaggacttggcggtggacagcacggaaccggattcttcctccgggcggtccatcatgtcgcgggccgcagagccgaccgcagggtggttctg-cccgtcaacgtggccgtaggtggtcatttccatccaaagctcgcccacgtcgcggttcgggtcggcaagcatgccgtccaccgacggcagggtggccggcgtaccctcgttcttagccttgtagagcgcgtgcagg-atgacgccgacaagcagcgcctggctggttttctgccagtgcgattccaggcccttgccgtccggatcgacgatcagggtggcaaggttctgcacgtcgccaacctcgtactcggtccccaagcggatttcatcga-gcgggttccagcacgcgctaccctgcgcggatgccggctcaaagcgcacgaccttgttgcgggcatgcttcttccgccagccggcggtcagcgcccacaactcgcctttcaggtcggtgatgacggcgctgtgcg-cccaggaaagcagcgtcggaacgaccaggccgacgcccttgccggagcgcgtcggcgcgtaggtcaagacgtgctcggggccgttgtgccgcaggtagtggaacttgccgtccttgtcctgccagccgcccac-atagacgccgctggaagtgggcgggtgtttgcctgacaccagctcgacgacggtgcgcggccggggcagcaggccggcggcctgtatgtccttcttgtcggcccagcgggccgaaccgtgcagatagtcgttcgc-cttgccggtgttcgccttgaccatctgcgtgacggccgtgcccagcaggcccacggtcgaaacgaccatacccatgctggccgcgcgcatgaaatcgtcgggatattggccgtaccacttgccggcccattgaag-gatcgaccagggcgtgtagacgtggttgatattccagccaagtccggcctgatactggaaggaatgggcgaaatattgcgtcgcggtctgcaagcctgccccaagggacaggccggcgaggatgggaacggtcttg-ctggccttcggttttttcgcccgtatctgtggccccacggcgttgtttcggttcttcatctactcctacctcgggtagttttaagggagcctcgcggggtcacggtgacgggatcaccgatggcgaggcgcttcatgcgt-tgcaccgtggccttatcgacgggcagcaccagaatctcgtcgttttctttcctcaacagggccagcgcctggtcctcgacgttccgggtgcctgcataggacagcgcaccaacataatcagtatatcgtgcatgctt-cggtatatcgaagccgtttagccgcttttgctcgcgctcggcaacatatttctcggccgccgcgatctgttcgggctttagccctcttcctggcccagaaactccccgtcgcagtgcgtgagctggttcggctccttgct-gctccacgtgaccaggaacatcacgcggcaatagcatttcagctccgccggcgatgcgaaccacaccgagttgggacagcgctcgcaaacggttttggctttggggcggcggctttcgtccaatgcgtccaacgttgg-gcttgcggagtgcgacggttccgccggcgctgacggcgcgagcgtcccgtcggtcgccgtcgccgcctgtggcgttgagggtggttctggctgcggcaggtcgaatgcctccatcgccgccgcgatctcttcgtc-cgtcatttcgttcgggttgctcatgtgcttgctccttcgtcagtagttcttgacggcggcgctcaagggcggcgtcgtcaaaggtgattgccagacggccagcggcggccgcctgcgcgatccgctccttgaactctgctg-tgccgttgacggtgatccggtcgccgaagcgctccattgccaggcgcagggcggcgtccaggccgtccgtggtggcctcgcgcgagacttgcaggcggtcgccgtcgtcgcggacggcgctgctgccgacgcga-tagatgatggttcccttcttcgtgatgttgtccgtcacggccgcatggcccggcttggcctcgccgctgccctggatggtgttgcccttgaggtcgctgcggccctcgcgtgcgcgcagcgcggccagggccttgt-cgtcgcccttcatcgcctcggccttgagccagtcggcccacgcgcggcgctgcgtgcgctcctggaccgcctgacggccctgccggtactcgcggttgatcttgtccaggtcggcgcgcagagccttgtgcgcctg-cgcgtacatcagtcgctttgcaatgcgcccctcgcccagcagcttgatagcggcgcggcgcagccggttgctgcgcatcgcggcttcaatcaggcggtcacgacgccggcgcagcgtgtccagctcgcccttgcg-cacggcccccatttcctggcgttcagactgataccgggcgtatagctcggtggtgtcgatgcgggtcttgagcggcttcgctcgatactcccgccgccggggggcttcgccgccctcggctggcgtgaatgccccg-aatcgggcttcgagcttcggcttggacaggtcgcgcgaaacggtgctggccttgaccgtcgtgccgtcgccggcctcgaagatgaagccgtttccgcgctcgcgcagcttaagcccgttttcccgcaggacgcggt-gcaggtcctcccaggattgcgccgcttgcagctccggcaggcattcgcgcttgatccagccgaccaggctttccacgcccgcgtgccgctccatgtcgttcgcgcggttctcggaaacgcgctgccgcgtttcgtg-attgtcacgctcaagcccgtagtcccgttcgagcgtcgcgcagaggtcagcgagggcgcggtaggcccgatacggctcatggatggtgtttcgggtcgggtgaatcttgttgatggcgatatggatgtgcaggttg-tcggtgtcgtgatgcacggcactgacgcgctgatgctcggcgaagccaagcccagcgcagatgcggtcctcaatcgcgcgcaacgtctccgcgtcgggcttctctcccgcgcggaagctaaccagcaggtgataggt-cttgtcggcctcggaacgggtgttgccgtgctgggtcgccatcacctcggccatgacagcgggcagggtgtttgcctcgcagttcgtgacgcgcacgtgacccaggcgctcggtcttgccttgctcgtcggtgatg-tacttcaccagctccgcgaagtcgctcttcttgatggagcgcatggggacgtgcttggcaatcacgcgcaccccccggccgttttagcggctaaaaaagtcatggctctgccctcgggcggaccacgcccatcatgacc-ttgccaagctcgtcctgcttctcttcgatcttcgccagcagggcgaggatcgtggcatcaccgaaccgcgccgtgcgcgggtcgtcggtgagccagagtttcagcaggccgcccaggcggcccaggtcgccattgatg-cgggccagctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagcaggtaggccgacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtctgg-aaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcg-aataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaa-aggatggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaagcgctgcttccctgctgttttgtggaatatctaccgactggaaacaggcaaatgcaggaaattactgaactgagg-ggacaggcgagagacgatgccaaagagctacaccgacgagctggccgagtgggttgaatcccg

cgcggccaagaagcgccggcgtgatgaggctgcggttgcgttcctggcggtgagggcggatgtcgaggcggcg-ttagcgtccggctatgcgctcgtcaccatttgggagcacatgcgggaaacggggaaggtcaagttctcctacgagacgttccgctcgcacgccaggcggcacatcaaggccaagcccgccgatgtgcccgcac-cgcaggccaaggctgcggaacccgcgccggcacccaagacgccggagccacggcggccgaagcaggggggcaaggctgaaaagccggcccccgctgcggccccgaccggcttcaccttcaacccaacaccg-gacaaaaaggatctactgtaatggcgaaaattcacatggttttgcagggcaagggcggggtcggcaagtcggccatcgccgcgatcattgcgcagtacaagatggacaaggggcagacacccttgtgcatcga-caccgacccggtgaacgcgacgttcgagggctacaaggccctgaacgtccgccggctgaacatcatggccggcgacgaaattaactcgcgcaacttcgacaccctggtcgagctgattgcgccgaccaaggat-gacgtggtgatcgacaacggtgccagctcgttcgtgcctctgtcgcattacctcatcagcaaccaggtgccggctctgctgcaagaaatggggcatgagctggtcatccataccgtcgtcaccggcggccaggctctc-ctggacacggtgagcggcttcgcccagctcgccagccagttcccggccgaagcgcttttcgtggtctggctgaacccgtattgggggcctatcgagcatgagggcaagagctttgagcagatgaaggcgtacacgg-ccaacaaggcccgcgtgtcgtccatcatccagattccggccctcaaggaagaaacctacggccgcgatttcagcgacatgctgcaagagcggctgacgttcgaccaggcgctggccgatgaatcgctcacgatca-tgacgcggcaacgcctcaagatcgtgcggcgcggcctgtttgaacagctcgacgcggcggccgtgctatgagcgaccagattgaagagctgatccgggagattgcggccaagcacggcatcgccgtcggccgcg-acgacccggtgctgatcctgcataccatcaacgcccggctcatggccgacagtgcggccaagcaagaggaaatccttgccgcgttcaaggaagagctggaagggatcgcccatcgttggggcgaggacgccaag-gccaaagcggagcggatgctgaacgcggccctggcggccagcaaggacgcaatggcgaaggtaatgaaggacagcgccgcgcaggcggccgaagcgatccgcagggaaatcgacgacggccttggccgcc-agctcgcggccaaggtcgcggacgcgcggcgcgtggcgatgatgaacatgatcgccggcggcatggtgttgttcgcggccgccctggtggtgtgggcctcgttatgaatcgcagaggcgcagatgaaaaa-gcccggcgttgccgggcttgttttt 15 Sal-crRNA Array 1 (522bp)TTTGAAAACAAAGAATTAGCTGATCTTTAATAATAAGGAAATGTTACATTAAGGTTGGTGGGTTGTTTTTATG-GGAAAAAATGCTTTAAGAACAAATGTATACTTTTAGAGAGTTCCCCGCGCCAGCGGGGATAAACCGGCTTTAAGCGTTAGCTCCCCATTCTGCTCCCCGAGTTCCCCGCGCCAGCGGGGATAAACCGGTACGTTAGCGT-ATATTGATGCCGCAGAGACGGAGTTCCCCGCGCCAGCGGGGATAAACCGGCGATAACTGGACAGTTTTATCCGCCGAGCATGAGTTCCCCGCGCCAGCGGGGATAAACCGGGCGCACTGGATGCGATGATGGATATC-ACTTGGAGTTCCCCCGCCTCTGCGGTAGAACTCCCAGCTCCCATTTTCAAACCCATCAAGACGCCTTCGCCAACTCCTTCACCAGAGGTAGCATTATCCGCATAACGTCACGGCAGCGACGTTCTATTCTTCCAGGAA-GAGCCTTATCAATATGTTGGTGATTATCCAGTCTT 16 Repeat SequenceGAGTTCCCCGCGCCAGCGGGGATAAACCG 17 Spacer Sequence for targeting theSalmonella invB gene GCTTTAAGCGTTAGCTCCCCATTCTGCTCCCC 18 SpacerSequence for targeting the Salmonella sicP geneGTACGTTAGCGTATATTGATGCCGCAGAGACG 19 Spacer Sequence for targetingthe Salmonella seeE gene GCGATAACTGGACAGTTTTATCCGCCGAGCAT 20 invBfrom Salmonella enterica subsp. enterica serovar Typhimurium str.LT2; spacer sequence in boldatgcaacatttggatatcgctgaattagttcgttccgcactggaagtaagtggttgcgatccttcattaattg-gaggaatagatagccattcaacaattgttctggatttatttgcattgccaagtatctgtatcagcgtcaaggacgatgatgtatggatctgggcgcaattgggtgctgacagcatggtggtattacaacagcgg-gcttatgaaatcttaatgaccataatggaaggatgccattttgcccgcggcgggcaattactactgggggagcagaatggggagctaacgcttaaagccttagtgcatccggattttttatctgacg-gtgaaaagttctctactgccttgaatgggttttacaactatctggaagtttttagtcggtcgctaatgagatga 21 sicP from Salmonella enterica subsp. entericaserovar Typhimurium str. LT2; spacer sequence in boldttgcaagcacaccaggatattatcgctaatattggtgagaaattgggtttaccgctcacttttgacgacaaca-atcagtgcttattattactcgatagcgatatttttacgtctattgaagctaaagatgatatctggttattgaacggtatgattataccgttatcgcctgtttgtggcgattctatctggcggcagattatggtg-attaatggtgaactggctgcgaataatgaaggtacgttagcgtatattgatgccgcagagacgttgttgatatacatgcaattaccgatagacaaatacttaccatattatatcgcagcttgagtcattt-gtgaatcagcaggaagcgctcaaaaacatactgcaggaatatgctaaagtatga 22 seeE fromSalmonella enterica subsp. enterica serovar Typhimurium str. LT2;spacer sequence in boldatggtgcaagaaatagagcaatggttacgtcggcatcaggtgtttactgagcctgcatatttaggggagaccg-ccatattacttgggcagcagtttatattatcgccttacctggtgatctatcgtattgaggcaaaagaaatgattatttgtgagttcaggcgcctgacgcccgggcaacctcgaccacagcaattgtttcac-ttactgggacttttacgcgggatatttgtgcatcacccgcagttaacatgtttaaagatgttgataatcaccgacgttctggatgaaaaaaaagccatgctacgcaggaaattattgcgcatcctgacag-taatgggagcgacctttacacagcttgatggcgataactggacagttttatccgccgagcatcttatccagcgacgtttttaa

TABLE-US-00007 TABLE 7 Function and origin of each genetic elementof the pFS-Sal- 09-proAB-rm plasmid containing a Type I CRISPR/Cassystem. Size Component Location (bp) Origin Function J23114 1-29 29Synthetic Initiates transcription of Cas3 promoter promoter andCas3 cascade Cas3 cascade 105-4455 4351 E. coli K12 Recruits Cas3and recognition (casABCDE) of PAM Cas3 4472-7138 2667 E. coli K12Nuclease activity; cleavage of DNA Promoter- 7182-7210 29 E. coliK12 Initiates transcription of pre- crRNA array crRNA array tomature crRNA array invB-cr4 7278-7309 32 Synthetic Spacer sequenceof guide sequence RNA. Binds to the complementary target DNAsequence of invB gene in Salmonella enterica sicP-cr1 7339-7370 32Synthetic Spacer sequence of guide sequence RNA. Binds to thecomplementary target DNA sequence of sicP gene in Salmonellaenterica sseE-cr2 7400-7431 32 Synthetic Spacer sequence of guidesequence RNA. Binds to the complementary target DNA sequence ofsseE gene in Salmonella enterica oriT 7661-7781 121 RP4 plasmidOrigin of transfer. Transfer of CRISPR/CAS3 system to recipientrrnB T1 7809-7895 87 E. coli rrnB gene Transcription terminationterminator p15A ori 8064-8609 546 pZA31MCS Plasmid replicationvector Lambda T0 8723-8817 95 Phage lambda Transcriptiontermination terminator proA 8837-10090 1254 E. coli K12 Prolinebiosynthesis proB 10102-11205 1104 E. coli K12 Proline biosynthesisproAB promoter 11250-11278 29 E. coli K12 Initiates transcriptionof proAB

TABLE-US-00008 TABLE 8 Conjugation results in JM109. Conjugationfrom S17-1::pFS-EcoCas3-01- rm, S17-1::pFS-Sal-09-rm,S17-1::pFS-EcoCas3-03-rm and S17-1::pFS- Sal-08-rm, in E. coliJM109 strain showed a comparable efficiency between the twoconstructs and the respective control plasmids. Conjugationefficiency is calculated dividing the number (CFU/mL) oftransconjugants by the number of recipients. Conjugation DonorRecipient CFU/mL Efficiency S17-1::pFS-EcoCas3-01-rm JM109 1.2.times. 107 1.4 .times. 10-2 S17-1::pFS-Sal-09-rm JM109 7.0 .times.106 7.4 .times. 10-3 S17-1::pFS-EcoCas3-03-rm JM109 8.1 .times. 1063.4 .times. 10-2 S17-1::pFS-Sal-08-rm JM109 1.5 .times. 107 2.9.times. 10-2

TABLE-US-00009 TABLE 9 Conjugation results in FS26. Conjugationfrom S17-1::pFS-EcoCas3-01-rm, S17-1::pFS-Sal-09-rm,S17-1::pFS-EcoCas3-03-rm and S17-1::pFS-Sal-08-rm in S. Enteritidisstrain FS26 were carried out in two biological replicates. Resultsshowed significant reduction in S. Enteritidis strain FS26 byconjugation with the active constructs, when compared to therespective control plasmids. Conjugation efficiency is calculateddividing the number (CFU/mL) of transconjugants by the number ofrecipients. Transconjugants Conjugation Replicate Donor Recipient(CFU/mL) Efficiency 1st S17-1::pFS-EcoCas3-01-rm FS26 7.6 .times.106 1.2 .times. 10-2 S17-1::pFS-Sal-09-rm FS26 7.0 .times. 102 2.7.times. 10-6 2nd S17-1::pFS-EcoCas3-01-rm FS26 1.3 .times. 107 1.0.times. 10-2 S17-1::pFS-Sal-09-rm FS26 1.0 .times. 103 1.2 .times.10-6 1st S17-1::pFS-EcoCas3-03-rm FS26 3.0 .times. 106 1.0 .times.10-2 S17-1::pFS-Sal-08-rm FS26 3.7 .times. 102 2.7 .times. 10-6 2ndS17-1::pFS-EcoCas3-03-rm FS26 1.0 .times. 107 2.9 .times. 10-2S17-1::pFS-Sal-08-rm FS26 2.0 .times. 103 5.6 .times. 10-6

TABLE-US-00010 TABLE 10 Selected spacer conservation in Salmonellaconservation level # hits in in Salmonella non-Salmonella SpacerPAM S. enterica 100 .gtoreq.95 .gtoreq.90 <90 hits invB AAG10613 96 2 2 23 sicP AAG 10610 74.5 20.7 4.7 <1 46 sseE ATG10604 68.1 30 1.9 52

TABLE-US-00011 TABLE 11 Under Ambient temperature Relative Age(days) lamp (.degree. C.) in room (.degree. C.) humidity (%) Up to1 35 25-30 60-80 1-7 32 22-27 60-80 7-14 29 19-25 40-80 14-21 2618-25 40-80 21-28 24 18-25 40-80 28-35 -- 18-25 40-80 Over 35 --15-25 40-80

TABLE-US-00012 TABLE 12 Plating protocol Plating for SalmonellaEnrichment for Salmonella XLD + Nalidixic acid Selenite broth,Plate onto XLD + (25 .mu.g/mL) Nalidixic acid (25 .mu.g/mL) Directcounts - Salmonella Enriched counts - Salmonella

* * * * *

References

• eucast.org