Targeted RNA cleavage with CRISPR-Cas Patent Application (2025)

U.S. patent application number 17/628913 was filed with the patent office on 2022-08-25 for targeted rna cleavage with crispr-cas. The applicant listed for this patent is University of Rochester. Invention is credited to Douglas Matthew Anderson.

Targeted RNA cleavage with CRISPR-Cas

Abstract

The present invention provides proteins, nucleic acids, systemsand methods for modulating RNA.

Related U.S. Patent Documents

Claims

1. A CRISPR RNA (crRNA) comprising a guide sequence, wherein theguide sequence is substantially complementary to a Coronavirusgenomic mRNA sequence or a Coronavirus subgenomic mRNAsequence.

2. The crRNA of claim 1, wherein the guide sequence issubstantially complementary to a Coronavirus leader sequence,Coronavirus S sequence, Coronavirus E sequence, Coronavirus Msequence, N sequence, or Coronavirus S2M sequence.

3. The crRNA of claim 1 or claim 2, wherein the guide sequence issubstantially complementary to a sequence at least 80% homologousto a sequence selected from SEQ ID NOs: 308-314, 316-321, and326-327.

4. The crRNA of any of claims 1-3, wherein the guide sequencecomprises a sequence at least 80% homologous to a sequence selectedfrom SEQ ID NOs: 356-391.

5. The crRNA of any of claims 1-4, wherein the crRNA furthercomprises a direct repeat (DR) sequence.

6. The crRNA of claim 5, wherein the DR sequence is 3' from theguide sequence.

7. The crRNA of claim 5 or claim 6, wherein the DR sequencecomprises a sequence selected from SEQ ID NOs: 291-300.

8. A tandem array comprising at least two crRNA of any of claims1-7.

9. The tandem array of claim 8, wherein each crRNA comprises aguide sequence and a direct repeat (DR) sequence, wherein each DRsequence is different.

10. The tandem array of claim 8, wherein the tandem array comprisesa sequence at least 80% identical to SEQ ID NO:402.

11. A composition comprising the crRNA of any of claims 1-8 or thetandem array of any of claims 9-10.

12. The composition of claim 11, wherein the composition furthercomprises a Cas protein or a nucleic acid encoding a Casprotein.

13. The composition of claim 12, wherein the Cas protein isCas13.

14. The composition of claim 12 or claim 13, wherein the Casprotein comprises a sequence at least 80% identical to a sequenceselected from SEQ ID NOs:1-46.

15. The composition of any of claims 12-14, wherein the Cas proteinfurther comprises a localization signal or export signal.

16. The composition of claim 12, wherein the Cas protein comprisesan NES, wherein the NES comprises a sequence at least 80% identicalto SEQ ID NO:75-76.

17. The composition of claim 12, wherein the Cas protein comprisesn nuclear localization signal (NLS), wherein the NLS comprises asequence at least 80% identical to SEQ ID NO:67-74 and427-1039.

18. The composition of claim 12, wherein the Cas protein comprisesn localization signal, wherein the localization signal comprises asequence at least 80% identical to SEQ ID NO:77-83.

19. A CRISPR RNA (crRNA) comprising a guide sequence, wherein theguide sequence is substantially complementary to an influenza virusgenomic RNA sequence or an influenza virus subgenomic RNAsequence.

20. The crRNA of claim 19, wherein the guide sequence issubstantially complementary to an influenza virus PB2 sequence,influenza virus PB1 sequence, influenza virus PA sequence,influenza virus NP sequence, or influenza virus M sequence.

21. The crRNA of claim 19 or 20, wherein the guide sequence issubstantially complementary to a sequence at least 80% homologousto a sequence selected from SEQ ID NOs:328-347.

22. The crRNA of claim 19, wherein the guide sequence comprises asequence at least 80% homologous to a sequence selected from SEQ IDNOs: 392-401.

23. The crRNA of any of claims 19-22, wherein the crRNA furthercomprises a direct repeat (DR) sequence.

24. The crRNA of claim 23, wherein the DR sequence is 3' from theguide sequence.

25. The crRNA of claim 23 or claim 24, wherein the DR sequencecomprises a sequence selected from SEQ ID NOs: 291-300.

26. A tandem array comprising at least two crRNA of any of claims19-25.

27. The tandem array of claim 26, wherein each crRNA comprises aguide sequence and a direct repeat (DR) sequence, wherein each DRsequence is different.

28. The tandem array of claim 26, wherein the tandem arraycomprises a sequence at least 80% identical to SEQ ID NO:403 or404.

29. A composition comprising the crRNA of any of claims 19-25 orthe tandem array of any of claims 26-28.

30. The composition of claim 29, wherein the composition furthercomprises a Cas protein or a nucleic acid encoding a Casprotein.

31. The composition of claim 30, wherein the Cas protein isCas13.

32. The composition of claim 30 or claim 31, wherein the Casprotein comprises a sequence at least 80% identical to a sequenceselected from SEQ ID NOs:1-46.

33. The composition of any of claims 30-32, wherein the Cas proteinfurther comprises a localization signal.

34. The composition of claim 33, wherein Cas protein comprises anNES, wherein the NES comprises a sequence at least 80% identical toSEQ ID NO:75-76.

35. The composition of claim 33, wherein the Cas protein comprisesa nuclear localization signal (NLS), wherein the NLS comprises asequence at least 80% identical to SEQ ID NO:67-74 and427-1039.

36. The composition of claim 33, wherein the Cas protein comprisesan localization signal, wherein the localization signal comprises asequence at least 80% identical to SEQ ID NO:77-83.

37. A delivery system comprising: a packaging plasmid a transferplasmid, and an envelope plasmid, wherein the packaging plasmidcomprises a nucleic acid sequence encoding a gag-pol polyprotein;the transfer plasmid comprises a nucleic acid sequence encoding acrRNA sequence and a nucleic acid sequence encoding a Cas protein;and the envelope plasmid comprises a nucleic acid sequence encodingan envelope protein.

38. The delivery system of claim 37, wherein the envelope proteinis a coronavirus spike glycoprotein.

39. The delivery system of claim 37 or claim 38, wherein theenvelope protein comprises a sequence at least 80% identical to asequence selected from SEQ ID NO:172-183.

40. The delivery system of claim 37, wherein the envelope proteincomprises one or more proteins selected from influenza virus HAprotein and influenza virus NA protein.

41. A method for treating a coronavirus infection, the methodcomprising administering to the subject: a crRNA of any of claims1-7 or tandem array of any of claims 8-10 and a Cas protein ornucleic acid encoding a Cas protein.

42. The method of claim 41, wherein the crRNA binds to Coronavirusgenome RNA or Coronavirus subgenomic RNA and the Cas proteincleaves the Coronavirus genome RNA or Coronavirus subgenomicRNA.

43. A method for treating an influenza virus infection, the methodcomprising administering to the subject: a crRNA of any of claims19-25 or tandem array of any of claims 26-28 and a Cas protein ornucleic acid encoding a Cas protein.

44. The method of claim 43, wherein the crRNA binds to influenzagenome RNA or influenza subgenomic RNA and the Cas protein cleavesthe Coronavirus genome RNA or influenza subgenomic RNA.

45. A tandem array comprising two or more CRISPR RNAs (crRNAs).

46. The tandem array of claim 45, wherein each crRNA comprises aguide sequence and a direct repeat (DR) sequence, wherein each DRsequence is different.

47. The tandem array of claim 46, wherein each DR sequencecomprises a sequence individually selected from SEQ ID NOs:291-300.

48. A method for treating a viral infection, the method comprisingadministering to the subject: a tandem array of any of claims 45-47and a Cas protein or nucleic acid encoding a Cas protein, whereinthe tandem array comprises one or more crRNAs having substantialcomplementary to viral RNA.

49. A fusion protein comprising: a) a CRISPR-associated (Cas)protein; and b) a nuclear localization signal (NLS).

50. The fusion protein of claim 49, wherein the Cas protein isCas13.

51. The fusion protein of any of claims 49-50, wherein Cas13comprises a sequence selected from SEQ ID NOs: 1-46, or a variantthereof.

52. The fusion protein of any of claims 49-51, wherein NLScomprises a sequence selected from SEQ ID NOs: 67-74 and 427-1039,or a variant thereof.

53. The fusion protein of any of claims 49-52, wherein the fusionprotein comprises a sequence selected from SEQ ID NOs:150, 151,161, and 162, or a variant thereof.

54. A nucleic acid encoding the fusion protein of any of claims49-53.

55. A method of decreasing the number of a target RNA or cleaving atarget RNA in a subject, the method comprising administering to thesubject: a fusion protein of any of claims 49-53 or the nucleicacid molecule of claim 54 and a CRISPR RNA (crRNA) acid comprisinga sequence complimentary to a RNA sequence in the target RNA.

56. A fusion protein comprising: a) a CRISPR-associated (Cas)protein; and b) a florescent protein

57. The fusion protein of claim 56, wherein the Cas protein iscatalytically dead Cas13 (dCas13).

58. The fusion protein of claim 57, wherein dCas13 comprises asequence selected from SEQ ID NOs: 47-48, or a variant thereof.

59. The fusion protein of any of claims 56-58, wherein the fusionprotein further comprises a localization signal or exportsignal.

60. The fusion protein of claim 59, wherein localization signal orexport signal comprises a sequence selected from SEQ ID NOs:67-83and 427-1039, or a variant thereof.

61. The fusion protein of claim any of claims 56-60, wherein thefluorescent protein is selected from the group consisting of eGFP,mCherry, sfGFP, sfGFP(1-10), sfGFP(1-10)-L-(11), and 7xS11.

62. The fusion protein of claim any of claims 56-61, wherein thefluorescent protein comprises a sequence selected from SEQ ID NO:49-56, or a variant thereof.

63. The fusion protein of claim any of claims 56-62, wherein thefusion protein comprises a sequence selected from SEQ ID NOs:84-149, or a variant thereof.

64. A nucleic acid molecule encoding a fusion protein of any ofclaims 65-63.

65. A method of visualizing a target RNA in a subject, the methodcomprising administering to the subject: a fusion protein of any ofclaims 56-63 or the nucleic acid molecule of claim 64 and a CRISPRRNA (crRNA) comprising a guide sequence acid, the guide sequence issubstantially complementary to a RNA sequence in the target RNA;and visualizing the target RNA.

66. A fusion protein comprising: a) a CRISPR-associated (Cas)protein; and b) a localization or export signal.

67. The fusion protein of claim 66, wherein the Cas protein isCas13.

68. The fusion protein of claim 67, wherein Cas13 comprises asequence selected from SEQ ID NOs: 1-46, or a variant thereof.

69. The fusion protein of any of claims 66-68, wherein localizationor export signal comprises a sequence selected from SEQ IDNOs:67-83 and 427-1039, or a variant thereof.

70. The fusion protein of claim any of claims 66-69, wherein thefusion protein comprises a sequence selected from SEQ ID NOs:150-171, or a variant thereof.

71. A nucleic acid molecule encoding a fusion protein of any ofclaims 66-70.

72. A method of decreasing the number of a target RNA or cleaving atarget RNA in a subject, the method comprising administering to thesubject: a fusion protein of any of claims 66-70 or the nucleicacid molecule of claim 71 and a CRISPR RNA (crRNA) comprising aguide sequence acid, the guide sequence is substantiallycomplementary to a RNA sequence in the target RNA; and visualizingthe target RNA.

73. A synthetic coronavirus envelope protein, wherein the proteincomprises an amino acid sequence selected from SEQ ID NOs:172-183,or a variant thereof.

74. A nucleic acid molecule encoding the synthetic coronavirusenvelope protein of claim 73.

75. A delivery system for delivering a protein or nucleic acidcomprising: a packaging plasmid a transfer plasmid, and an envelopeplasmid, wherein the packaging plasmid comprises a nucleic acidsequence encoding a gag-pol polyprotein; the transfer plasmidcomprises a nucleic acid sequence encoding the protein or nucleicacid to be delivered; and the envelope plasmid comprises a nucleicacid sequence encoding a synthetic coronavirus envelope of claim73.

76. A method of delivering a gene or protein to a respiratory,vascular, renal, or cardiovascular cell type, the method comprisingadministering the delivery system of claim 75 to the cell.

77. A CRISPR RNA (crRNA) comprising a guide sequence, wherein theguide sequence is substantially complementary to an expanded RNArepeat.

78. The crRNA of claim 77, wherein the expanded repeat is selectedfrom the group consisting of a CTG repeat, CCTG repeat, GGGCCrepeat, CAG repeat, CGG repeat, ATTCT repeat, and TGGAA repeat.

79. The crRNA of claim 77 or claim 78, wherein the guide sequenceis substantially complementary to a sequence at least 80%homologous to a sequence selected from SEQ ID NOs: 301-306.

80. The crRNA of any of claims 77-79, wherein the guide sequencecomprises a sequence at least 80% homologous to a sequence selectedfrom SEQ ID NOs: 348-354.

81. The crRNA of any of claims 77-80, wherein the crRNA furthercomprises a direct repeat (DR) sequence.

82. The crRNA of claim 81, wherein the DR sequence is 3' from theguide sequence.

83. The crRNA of claim 81 or claim 82, wherein the DR sequencecomprises a sequence selected from SEQ ID NOs: 291-300.

84. A tandem array comprising at least two crRNA of any of claims77-83.

85. The tandem array of claim 84, wherein each crRNA comprises aguide sequence and a direct repeat (DR) sequence, wherein each DRsequence is different.

86. A composition comprising the crRNA of any of claims 77-83 orthe tandem array of any of claims 84-85.

87. The composition of claim 86, wherein the composition furthercomprises a Cas protein or a nucleic acid encoding a Casprotein.

88. The composition of claim 87, wherein the Cas protein isCas13.

89. The composition of claim 87 or claim 88, wherein the Casprotein comprises a sequence at least 80% identical to a sequenceselected from SEQ ID NOs:1-46.

90. The composition of any of claims 87-89, wherein the Cas proteinfurther comprises a localization signal or export signal.

91. The composition of claim 90, wherein the localization signal isan NES, wherein the NES comprises a sequence at least 80% identicalto SEQ ID NO:75-76.

92. The composition of claim 90, wherein the localization signal isa nuclear localization signal (NLS), wherein the NLS comprises asequence at least 80% identical to SEQ ID NO:67-74 and427-1039.

93. The composition of claim 90, wherein the Cas protein, whereinthe localization signal comprises a sequence at least 80% identicalto SEQ ID NO:77-83.

94. A method of treating a disease or disorder associated with anexpanded RNA repeat, the method comprising administering a crRNA ofany of claims 77-83 or tandem array of any of claims 84-85 and aCas protein or nucleic acid encoding a Cas protein.

95. The method of claim 94, wherein the disease or disorder isselected from the group consisting of Myotonic dystrophy type 1,Amyotrophic Lateral Sclerosis, Huntington's Disease, Huntington'sDisease-like 2, Fragile X-associated tremor ataxia syndrome,Spinocerebellar ataxia 1, Spinocerebellar ataxia 2, Spinocerebellarataxia 3, Spinocerebellar ataxia 6, Spinocerebellar ataxia 7,Spinocerebellar ataxia 17, Spinocerebellar ataxia 8,Spinocerebellar ataxia 10, Spinocerebellar ataxia 31, Spinal andbulbar muscular atrophy, and Dentatorubral-pallidoluysian atrophy.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority to U.S. ProvisionalApplication Ser. No. 62/877,415, filed on Jul. 23, 2019, U.S.Provisional Application Ser. No. 63/000,737, filed on Mar. 27,2020, U.S. Provisional Application Ser. No. 63/000,757, filed onMar. 27, 2020, and U.S. Provisional Application Ser. No.63/052,282, filed on Jul. 15, 2020, each of which is incorporatedby reference herein in its entirety.

BACKGROUND

[0002] Human monogenetic diseases can arise from the aberrantexpansion of tandem nucleotide repeat sequences, which whentranscribed into RNA, can misfold and aggregate into toxic nuclearfoci. Nuclear retention of repeat-containing RNAs can disrupt theirnormal expression and induce widespread splicing defects bysequestering essential RNA binding proteins. Among the mostprevalent of these disorders is Myotonic Dystrophy type 1 (DM1), adisease occurring from the expression of a noncoding CTG repeatexpansion in the 3'UTR of the human dystrophia myotonica-proteinkinase (DMPK) gene.

[0003] Despite intense effort, there are no currently approvedtherapies designed to treat DM1. Antisense oligonucleotides (ASOs)targeting CUG-repeats have been used to reduce the levels of toxicRNAs and disrupt binding and sequestration of MBNL proteins inanimal models. However, significant challenges remain for thedelivery of these molecules at therapeutically effective levels inhuman skeletal muscle. Genome editing approaches using bacterialderived CRISPR-Cas9 DNA endonucleases have been employed todirectly edit the DMPK gene locus. However, CRISPR-Cas9 editing ateither the 5' or 3' ends of CTG genomic repeats can induce largeand uncontrolled sequence deletions, and the use of doubleguide-RNAs flanking the repeat expansion can lead to frequentsequence inversions, which remain toxic. Since CRISPR-Cas9approaches for manipulating DNA remain inefficient andcontroversial due to the risk of germline editing, an alternativeapproach targeting the repeat RNAs using deactivated Cas9 (dCas9)fused to an active ribonuclease has recently been shown to beeffective in cells. However, this approach could be inefficient fora number of reasons: 1) dCas9 retains affinity for DNA, which couldcompete for its binding to RNA, 2) the large size of dCas9 fusionproteins may limit their delivery in vivo or nuclear localization,3) dCas9 utilizes short guide-RNAs which may increase the chance ofoff-target RNA cleavage and, 4) they require protospacer adjacentmotifs (PAM) for efficient binding, which are not present in mosthuman repeat expansion sequences. Thus, significant challengesremain for the development of efficient therapeutic strategies totarget toxic nuclear RNAs in DM1 patients.

[0004] Coronaviruses are enveloped, single-stranded RNA viruseswhich are widespread in nature and pathogenic in both animal andhuman populations. Bovine coronavirus is a major cause of calfscours, winter dysentery in adult cows and cause a significantpercentage of bovine respiratory disease. In humans, coronavirusesinduce pathogenic respiratory diseases, notably SARS, MERS and morerecently COVID-19, which have potential to become global pandemics.There are currently no vaccines available to treat humancoronavirus infections. In animals, factors limiting vaccineefficacy, such as age, vaccine non-responders and virus mutation,highlights a need for alternative targeted therapeutics to preventcoronavirus-related death and disease.

[0005] Mammalian guide-RNA expression cassettes are generallycreated by cloning annealed oligonucleotides comprising the guidesequence into a cassette comprised of a mammalian Pol III promoter,a Direct Repeat and a terminator of 6 or more Ts. Commonly,multiple guide-RNAs are expressed by adding addition Pol IIIpromoter cassettes, however this can significantly increase thecomplexity and size of the vector. Generation of tandem crRNAarrays would significantly decrease the size requirements of thevector; however, nucleotide synthesis of long arrays is prohibiteddue to size and the repeat nature of DR sequences. Thus, there is aneed in the art for compositions, delivery systems and methods formodulating and/or cleaving RNA.

SUMMARY OF THE INVENTION

[0006] In one aspect, the disclosure provides CRISPR RNAs (crRNAs).In one embodiment, the crRNA comprises a guide sequence, whereinthe guide sequence is substantially complementary to a Coronavirusgenomic mRNA sequence or a Coronavirus subgenomic mRNA sequence. Inone embodiment, the guide sequence is substantially complementaryto a Coronavirus leader sequence, Coronavirus S sequence,Coronavirus E sequence, Coronavirus M sequence, N sequence, orCoronavirus S2M sequence. In one embodiment, the guide sequence issubstantially complementary to a sequence at least 80% homologousto a sequence selected from SEQ ID NOs: 308-314, 316-321, and326-327. In one embodiment, the guide sequence comprises a sequenceat least 80% homologous to a sequence selected from SEQ ID NOs:356-391.

[0007] In one embodiment, the crRNA further comprises a directrepeat (DR) sequence. In one embodiment, the the DR sequence is 3'from the guide sequence. In one embodiment, the DR sequencecomprises a sequence selected from SEQ ID NOs: 291-300.

[0008] In one embodiment, the disclosure provides a tandem arraycomprising at least two crRNA comprising guide sequences of thedisclosure which are substantially complementary to a Coronavirusgenomic mRNA sequence or a Coronavirus subgenomic mRNA. In oneembodiment, each crRNA comprises a guide sequence and a directrepeat (DR) sequence, wherein each DR sequence is different. In oneembodiment, the tandem array comprises a sequence at least 80%identical to SEQ ID NO:402.

[0009] In one embodiment, the crRNA comprises a guide sequence,wherein the guide sequence is substantially complementary to aninfluenza virus genomic RNA sequence or an influenza virussubgenomic RNA sequence. In one embodiment, the guide sequence issubstantially complementary to an influenza virus PB2 sequence,influenza virus PB1 sequence, influenza virus PA sequence,influenza virus NP sequence, or influenza virus M sequence. In oneembodiment, the guide sequence is substantially complementary to asequence at least 80% homologous to a sequence selected from SEQ IDNOs:328-34.

[0010] In one embodiment, the crRNA further comprises a directrepeat (DR) sequence. In one embodiment, the the DR sequence is 3'from the guide sequence. In one embodiment, the DR sequencecomprises a sequence selected from SEQ ID NOs: 291-300.

[0011] In one embodiment, the disclosure provides a tandem arraycomprising at least two crRNA comprising guide sequences of thedisclosure which are substantially complementary to an influenzavirus genomic RNA sequence or an influenza virus subgenomic RNAsequence. In one embodiment, each crRNA comprises a guide sequenceand a direct repeat (DR) sequence, wherein each DR sequence isdifferent. In one embodiment, the tandem array comprises a sequenceat least 80% identical to SEQ ID NO:403 or 404.

[0012] In one embodiment the crRNA comprises a guide sequence,wherein the guide sequence is substantially complementary to anexpanded RNA repeat. In one embodiment, the expanded repeat is aCTG repeat, CCTG repeat, GGGCC repeat, CAG repeat, CGG repeat,ATTCT repeat, or a TGGAA repeat. In one embodiment, the the guidesequence is substantially complementary to a sequence at least 80%homologous to a sequence selected from SEQ ID NOs: 301-306. In oneembodiment, the the guide sequence comprises a sequence at least80% homologous to a sequence selected from SEQ ID NOs: 348-354.

[0013] In one embodiment, the crRNA further comprises a directrepeat (DR) sequence. In one embodiment, the the DR sequence is 3'from the guide sequence. In one embodiment, the DR sequencecomprises a sequence selected from SEQ ID NOs: 291-300.

[0014] In one embodiment, the disclosure provides a tandem arraycomprising at least two crRNA comprising guide sequences of thedisclosure which are substantially complementary to an expanded RNArepeat. In one embodiment, each crRNA comprises a guide sequenceand a direct repeat (DR) sequence, wherein each DR sequence isdifferent.

[0015] In one embodiment, the disclosure provides a compositioncomprising a crRNA or tandem array of the disclosure. In oneembodiment, the composition further comprise a Cas protein or anucleic acid encoding a Cas protein. In one embodiment, the Casprotein is Cas13. In one embodiment, the Cas protein comprises asequence at least 80% identical to a sequence selected from SEQ IDNOs:1-46.

[0016] In one embodiment, the Cas protein further comprises alocalization signal. In one embodiment, the localization signal isan NES, wherein the NES comprises a sequence at least 80% identicalto SEQ ID NO:75-76. In one embodiment, the localization signal is anuclear localization signal (NLS), wherein the NLS comprises asequence at least 80% identical to SEQ ID NO:67-74 and 427-1039. Inone embodiment, the localization signal comprises a sequence atleast 80% identical to SEQ ID NO:77-83.

[0017] In one aspect, the disclosure provides a delivery system fortargeted RNA cleavage. In one embodiment, the delivery systemcomprises a packaging plasmid a transfer plasmid, and an envelopeplasmid, wherein the packaging plasmid comprises a nucleic acidsequence encoding a gag-pol polyprotein; the transfer plasmidcomprises a nucleic acid sequence encoding a crRNA sequence and anucleic acid sequence encoding a Cas protein; and the envelopeplasmid comprises a nucleic acid sequence encoding an envelopeprotein. In one embodiment, the envelope protein is a coronavirusspike glycoprotein. In one embodiment, the envelope proteincomprises a sequence at least 80% identical to a sequence selectedfrom SEQ ID NO:172-183. In one embodiment, envelope proteincomprises one or more proteins selected from influenza virus HAprotein and influenza virus NA protein.

[0018] In one aspect, the disclosure provides a method for treatinga coronavirus infection. In one embodiment, the method comprisesadministering to the subject (1) a crRNA comprising guide sequencethat is substantially complementary to a Coronavirus genomic mRNAsequence or a Coronavirus subgenomic mRNA sequence or a tandemarray comprising two or more crRNA each comprising a guide sequencethat is substantially complementary to a Coronavirus genomic mRNAsequence or a Coronavirus subgenomic mRNA sequence; and (2) a Casprotein or nucleic acid encoding a Cas protein. In one embodiment,the crRNA binds to Coronavirus genome RNA or Coronavirus subgenomicRNA and the Cas protein cleaves the Coronavirus genome RNA orCoronavirus subgenomic RNA.

[0019] In one aspect, the disclosure provides a method for treatingan influenza virus infection. In one embodiment, the methodcomprises administering to the subject (1) a crRNA comprising guidesequence that is substantially complementary to an influenza virusgenomic RNA sequence or an influenza virus subgenomic RNA sequenceor a tandem array comprising two or more crRNA each comprising aguide sequence that is substantially complementary to an influenzavirus genomic RNA sequence or an influenza virus subgenomic RNAsequence; and (2) a Cas protein or nucleic acid encoding a Casprotein. In one embodiment, the crRNA binds to influenza genome RNAor influenza subgenomic RNA and the Cas protein cleaves theCoronavirus genome RNA or influenza subgenomic RNA.

[0020] In one aspect, the disclosure provides a method for treatinga disease or disorder associated with an expanded RNA repeat, themethod comprising administering (1) a crRNA comprising a guidesequence substantially complementary to an expanded RNA repeat ortandem array comprising two or more crRNA each comprising a guidesequence that is substantially complementary to an expanded RNArepeat; and (2) a Cas protein or nucleic acid encoding a Casprotein. In one embodiment, the disease or disorder is selectedfrom the group consisting of Myotonic dystrophy type 1, AmyotrophicLateral Sclerosis, Huntington's Disease, Huntington's Disease-like2, Fragile X-associated tremor ataxia syndrome, Spinocerebellarataxia 1, Spinocerebellar ataxia 2, Spinocerebellar ataxia 3,Spinocerebellar ataxia 6, Spinocerebellar ataxia 7, Spinocerebellarataxia 17, Spinocerebellar ataxia 8, Spinocerebellar ataxia 10,Spinocerebellar ataxia 31, Spinal and bulbar muscular atrophy, andDentatorubral-pallidoluysian atrophy.

[0021] In one aspect, the disclosure provides a tandem arraycomprising two or more crRNAs. In one embodiment, each crRNAcomprises a guide sequence and a direct repeat (DR) sequence,wherein each DR sequence is different. In one embodiment, each DRsequence comprises a sequence individually selected from SEQ IDNOs: 291-300.

[0022] In one aspect, the disclosure provides method for treating aviral infection. In one embodiment, the method comprisesadministering to the subject: a tandem array of any of claims 45-47and a Cas protein or nucleic acid encoding a Cas protein, whereinthe tandem array comprises one or more crRNAs having substantialcomplementary to viral RNA.

[0023] In one aspect, the disclosure provides a fusion protein. Inone embodiment, the fusion protein comprises (a) aCRISPR-associated (Cas) protein; and (b) nuclear localizationsignal (NLS). In one embodiment, the Cas protein is Cas13. In oneembodiment, Cas13 comprises a sequence selected from SEQ IDNOs:1-46, or a variant thereof. In one embodiment, the NLScomprises a sequence selected from SEQ ID NOs: 67-74 and 427-1039,or a variant thereof. In one embodiment, the fusion proteincomprises a sequence selected from SEQ ID NOs:150, 151, 161, and162, or a variant thereof. In one embodiment, the disclosureprovides a nucleic acid encoding a fusion protein of the disclosurecomprising a Cas protein and a localization signal.

[0024] In one aspect, the disclosure provides a method fordecreasing the number of a target RNA or cleaving a target RNA in asubject. In one embodiment, the method comprises administering tothe subject: a fusion protein of the disclosure comprising a Casprotein and an NLS or the nucleic acid molecule of the disclosureencoding Cas protein and an NLS and a CRISPR RNA (crRNA) acidcomprising a sequence complimentary to a RNA sequence in the targetRNA.

[0025] In one aspect, the disclosure provides a fusion protein. Inone embodiment, the fusion protein comprises (a) aCRISPR-associated (Cas) protein; and (b) a florescent protein. Inone embodiment, the Cas protein is dCas13. In one embodiment, Cas13comprises a sequence selected from SEQ ID NOs:47-48, or a variantthereof. In one embodiment, the fusion protein further comprises alocalization signal or export signal. In one embodiment, thelocalization signal is an NLS and the NLS comprises a sequenceselected from SEQ ID NOs: 67-74 and 427-1039, or a variant thereof.In one embodiment, the localization signal is a nuclear exportsignal (NES) and the NES comprises a sequence selected from SEQ IDNOs: 74-75, or a variant thereof. In one embodiment, thelocalization signal comprises a sequence selected from SEQ ID NOs:67-83 or 427-1039, or a variant thereof. In one embodiment, thefluorescent protein is selected from the group consisting of eGFP,mCherry, sfGFP, sfGFP(1-10), sfGFP(1-10)-L-(11), and 7xS11. IN oneembodiment, the fluorescent protein comprises a sequence selectedfrom SEQ ID NO: 49-56, or a variant thereof. In one embodiment, thefusion protein comprises a sequence selected from SEQ ID NOs:84-149, or a variant thereof. In one embodiment, the disclosureprovides a nucleic acid encoding a fusion protein of the disclosurecomprising a Cas protein, fluorescent protein and optionally alocalization signal.

[0026] In one aspect, the disclosure provides a method ofvisualizing a target RNA in a subject. In one embodiment, themethod comprises administering to the subject: a fusion protein ofthe disclosure comprising a Cas protein and a fluorescent proteinor the nucleic acid molecule of the disclosure encoding a Casprotein and a fluorescent protein and a CRISPR RNA (crRNA) acidcomprising a sequence complimentary to a RNA sequence in the targetRNA.

[0027] In one aspect, the disclosure provides a fusion protein. Inone embodiment, the fusion protein comprises (a) aCRISPR-associated (Cas) protein; and (b) a localization signal. Inone embodiment, the Cas protein is Cas13. In one embodiment, Cas13comprises a sequence selected from SEQ ID NOs:1-46, or a variantthereof. In one embodiment, the localization signal is an NLS andthe NLS comprises a sequence selected from SEQ ID NOs: 67-74 and427-1039, or a variant thereof. In one embodiment, the localizationsignal is a nuclear export signal (NES) and the NES comprises asequence selected from SEQ ID NOs: 74-75, or a variant thereof. Inone embodiment, the localization signal comprises a sequenceselected from SEQ ID NOs: 67-83 or 427-1039, or a variant thereof.In one embodiment, the disclosure provides a nucleic acid encodinga fusion protein of the disclosure comprising a Cas protein and alocalization signal.

[0028] In one aspect, the disclosure provides a method fordecreasing the number of a target RNA or cleaving a target RNA in asubject. In one embodiment, the method comprises administering tothe subject: a fusion protein of the disclosure comprising a Casprotein and an localization signal or the nucleic acid molecule ofthe disclosure encoding Cas protein and an localization signal anda CRISPR RNA (crRNA) acid comprising a sequence complimentary to aRNA sequence in the target RNA.

[0029] In one aspect, the disclosure provides a syntheticcoronavirus envelope protein. In one embodiment, the proteincomprises an amino acid sequence selected from SEQ ID NOs:172-183,or a variant thereof. In one embodiment the disclosure provides anucleic acid molecule encoding a synthetic coronavirus envelopeprotein of the disclosure.

[0030] In one aspect, the disclosure provides a delivery system fordelivering a protein or nucleic acid comprising. In one embodiment,the delivery system comprises a packaging plasmid a transferplasmid, and an envelope plasmid, wherein the packaging plasmidcomprises a nucleic acid sequence encoding a gag-pol polyprotein;the transfer plasmid comprises a nucleic acid sequence encoding theprotein or nucleic acid to be delivered; and the envelope plasmidcomprises a nucleic acid sequence encoding a synthetic coronavirusenvelope of the disclosure.

[0031] In one aspect, the disclosure provides a method ofdelivering a gene or protein to a respiratory, vascular, renal, orcardiovascular cell type. In one embodiment, the method comprisesadministering the delivery system of the disclosure to thecell.

BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIG. 1, comprising FIG. 1A through FIG. 1D, depictsexperimental results demonstrating the development of a robustnuclear localized CRISPR-Cas13 fusion protein for the visualizationof toxic RNA foci. FIG. 1A depicts the design of a catalyticallydead PspCas13b (dPspCas13b) encoding an N-terminal 3.times.FLAG andTy1 NLS and C-terminal eGFP. F--3.times.FLAG epitope; NLS--Ty1nuclear localization sequence; pA--SV40 polyadenylation sequence.FIG. 1B depicts a diagram depicting the components of the DT960vector, which encodes a C-terminal genomic fragment of human DMPK(exons 11-15) with 960 CTG repeat expansion. FIG. 1C depicts thedesign of the CAGx9 crRNA and its predicted targeting withCUG.sup.exp RNA. FIG. 1D depicts representative images showing thecellular localization of hilightR green targeted with either anon-targeting or CAGx9 crRNA in COS7 cells expressing CUG.sup.expRNA. Scale bars, 10 .mu.m.

[0033] FIG. 2, comprising FIG. 2A and FIG. 2B, depicts experimentalresults demonstrating co-localization of hilightR green withCUG.sup.exp foci and MBNL1. FIG. 2A depicts immunohistochemistryusing an anti-FLAG antibody was used to detect hilightR red, whichco-localized with CUG.sup.exp RNA detected using FISH, whentargeted with the CAGx9 crRNA. FIG. 2B depicts HilightR greenco-localized with mCherry-MBNL1 in COS7 cells expressingCUG.sup.exp RNA foci when targeted with the CAGx9 crRNA, but notwith a non-targeting crRNA. Scale bars, 10 .mu.m.

[0034] FIG. 3, comprising FIG. 3A and FIG. 3B, depicts experimentalresults demonstrating degradation of toxic RNA foci byCRISPR-Cas13. FIG. 3A depicts co-expression of active PspCas13bencoding a Ty1 NLS (eraseR) significantly decreased the number ofRNA foci in cells expressing CUG.sup.exp RNA, when targeted withCAG crRNAs designed with target sequences in all three frames,detected by mCherry-MBNL1. FIG. 24B depicts representativemicrographs of cells targeted by eraseR showing foci detected bymCherry-MBNL1, which are significantly decreased in number andappear fainter. Scale bars, 10 .mu.m. **=p-value<0.01,***=p-value<0.001, ****=p-value<0.0001.

[0035] FIG. 4, comprising FIG. 4A through FIG. 4C, depictsexperimental results demonstrating detection of induced CUG.sup.expRNA foci in COS7 cells. FIG. 4A depicts COS7 cells expressing 960copies of CUG repeats induced RNA foci as detected using FISH witha CAG repeat antisense probe. AF488--Alexa Fluor 488. FIG. 4Bdepicts expression of CUG.sup.exp RNA induces the localization ofMBNL1 to foci, as detected using an mCherry-MBNL1 fusion protein.FIG. 4C depicts localization of dPspCas13b-mCherry (hilightR red)guided by either a non-targeting or CAGx9 crRNA in COS7 cellsexpressing CUG.sup.exp RNA. Scale bars, 10 .mu.m.

[0036] FIG. 5 depicts experimental results demonstratingco-localization of hilightR green with splicing speckles. Inagreement with previous reports, CUG.sup.exp RNA foci marked byhilightR green targeted with a CAGx9 crRNA, co-localized withsplicing speckles, as detected using an anti-SC-35 antibody. Scalebars, 10 .mu.m.

[0037] FIG. 6 depicts experimental results demonstratingcatalytically dead Cas13 (dCas13) does not significantly reduce thenumber of CUG.sup.exp RNA foci. Expression of dPspCas13b targetedwith CAGx9 crRNAs does not significantly reduce the number ofCUG.sup.exp RNA foci per cell, as detected by mCherry-MBNL1.ns--not significant.

[0038] FIG. 7, comprising FIG. 7A through FIG. 7D, depicts adiagram demonstrating therapeutic modulation of DM1 byCRISPR-Cas13. FIG. 7A depicts that myotonic Dystrophy Type1 iscaused by the expansion and expression of a CUG repeat in the 3'noncoding UTR of the human DMPK gene. This CUG expansion formsstable hairpin structures, which bind and sequester the MBNL familyof RNA binding proteins, resulting in widespread defects inalternative splicing and polyadenylation. FIG. 7B depicts CUGrepeats are resistant to cleavage induced by AntisenseOligonucleotides (ASO), however, ASOs have been successfully usedto block binding of MBNL1 proteins. However, many challenges remainto deliver therapeutically effective levels of ASOs to humantissues. FIG. 7C depicts specific binding of dCas13 guide by acrRNA, or potentially the crRNA alone, can serve to block MBNLproteins and rescue splicing and polyadenylation defects, or whencombined with a fluorescent protein, highlight CUG repeat RNA foci.FIG. 7D depicts catalytically active Cas13 can be used to cleaveand degrade CUG repeat RNA to prevent MBNL sequestration, as wellas other potential CUG repeat-induced pathologies, such as RANdependent translation of toxic peptides.

[0039] FIG. 8 depicts a schematic showing myotonic dystrophy type 1(DM1) is an inherited multi-system, progressively debilitatingdisease occurring in 1 in 8,000 individuals, with an incidence ashigh as 1 in 500 in specific populations Cardiac complicationsdevelop in .about.80% of DM1 patients and is the primary cause ofdeath. DM1 arises from the expansion and expression of a CUGtrinucleotide repeat in the noncoding 3' untranslated region of thehuman Dystrophia myotonica protein kinase (DMPK) gene. Mutant DMPKmRNAs with greater than .about.50 CUG repeats form toxic nuclearRNA foci, which prevent normal DMPK expression and inducewidespread defects in alternative splicing by sequestering membersof the muscleblind-like (MBNL) family of RNA binding proteins. Dueto the multitude of disrupted muscle genes underlying DM1pathogenesis, patients often present with a variety of clinicalcardiac phenotypes, including atrial and ventricular arrhythmias,dilated cardiomyopathy, and myocardial fibrosis. RNA bindingCRISPR-Cas13, when localized with a robust non-classical nuclearlocalization signal (hilightR and eraseR), can be used to visualizeand degrade toxic nuclear RNA foci in cells.

[0040] FIG. 9, comprising FIG. 9A through FIG. 9E, depictsexperimental results demonstrating therapeutic rescue of heartfunction in a mouse model of DM1. FIG. 9A depicts the generation ofCUG960 cardiac DM1 mouse model. FIG. 9B depicts the generation ofCUG960 cardiac DM1 mouse model. FIG. 9C depicts a diagram of eraseRAAV construct. FIG. 9D depicts experimental results demonstratingheart-specific gene delivery and expression using AAV9. FIG. 9Edepicts delivery of eraseR AAV targeting CUGexp RNA reversal of thecellular and electrical abnormalities in DM1 hearts.

[0041] FIG. 10, comprising FIG. 10A through FIG. 10D, depictsstrategies to enhance RNA visualization and fusion proteinlocalization with dCas13. FIG. 10A depicts a schematic depictingfusion of single Green Fluorescent Protein (GFP) to catalyticallyinactive Cas13 (dCas13), which can be used for specificvisualization of nuclear RNA repeat foci in cells. FIG. 10B depictsa schematic depicting fluorescent complementation inherent influorescent proteins (for example GFP, superfolder GFP, orsuperfolder Cherry) could be harnessed to reconstitute fluorescentproteins to dCas13 (for example, the complement pair sfGFP 1-10 andsfGFP11). FIG. 10C depicts a schematic depicting tandem assembly ofsmall non-fluorescent components can be used to reconstitute alarge tandem array of fluorescent proteins to dCas13, which has thepotential to increase the signal to noise ratio of dCas13 targetedRNAs. FIG. 10D depicts a schematic depicting this approach could besimilarly useful for targeting fusion proteins (Protein `X`) whenco-expressed as a fusion to a complementary fluorescent fusionprotein (for example, sfGFP1-10).

[0042] FIG. 11 depicts a schematic of the Coronavirus genomic andsubgenomic mRNAs.

[0043] FIG. 12 depicts a schematic of the eraseR platform.

[0044] FIG. 13 depicts a schematic of delivery via pseudotypedintegration-deficient lentiviral vectors.

[0045] FIG. 14, comprising FIG. 14A through FIG. 14C, depicts aschematic of guide-RNA testing, lentiviral production and cellulartargeting. FIG. 14A depicts a schematic of the design of luciferasereport construct encoding 5' and 3' CoV target sequences. FIG. 14Bdepict a schematic demonstrating the lentiviral constructs encodingCRISPR-Cas13 components can be packaged into non-integratinglentiviral particles pseudotyped with viral envelope proteins, forexample, the Spike glycoprotein from SARS-CoV-2 coronavirus, whichprovides specificity for entry into ACE2 receptor expressing cells.This allows for specific targeting of `coronavirus-targeted` celltypes. FIG. 14C depicts a schematic demonstrating thatpost-transduction, processing and formation of non-integratinglentiviral episomes allows for transient expression of CRISPR-Cas13components for acute targeted degradation of CoV genomic andsubgenomic viral mRNAs.

[0046] FIG. 15 depicts SARS-CoV-2 leader sequence conservation andtargeting sites.

[0047] FIG. 16 depicts tiling of SARS-CoV-2 Leader crRNAs.

[0048] FIG. 17, comprising FIG. 17A through FIG. 17C, depictsvalidated CRISPR-Cas13 guide-RNAs targeting the SARS-CoV-2 LeaderSequence. FIG. 17A depicts a schematic depicting the Luciferasereporter containing the SARS-2-CoV Leader sequence and crRNA targetsites locations. FIG. 17B depicts a sequence alignment of tilingcrRNAs targeting SARS-CoV-2 Leader sequence. TranscriptionalRegulatory Sequence (TRS) is highlighted in yellow.

[0049] FIG. 17C depicts cell-based luciferase assays demonstratingrobust knockdown of CoV Leader Luc reporter activity in cells withcrRNAs targeting SARS-CoV-2 leader sequence (crRNAs A through G) orLuciferase coding sequence (Luc), relative to a non-targetingcrRNA.

[0050] FIG. 18, comprising FIG. 18A through FIG. 18C depicts,validated CRISPR-Cas13 guide-RNAs targeting the SARS-CoV-2Stem-loop Like-2 (S2M) Sequence. FIG. 18A depicts a schematicdepicting the Luciferase reporter containing the SARS-2-CoV S2Msequence and crRNA target sites locations. FIG. 18B depicts asequence alignment of tiling crRNAs targeting SARS-CoV-2 S2Msequence. FIG. 18C depicts cell-based luciferase assaysdemonstrating robust knockdown of CoV S2M Luc reporter activity incells with crRNAs targeting SARS-CoV-2 S2M sequence (crRNAs Athrough F) or Luciferase coding sequence (Luc), relative to anon-targeting crRNA.

[0051] FIG. 19, comprising FIG. 19A through FIG. 19E, depictsone-step directional assembly of CRISPR-Cas13 crRNA arrays. FIG.19A is a schematic depicting the genomic organization of abacterial CRISPR-Cas13 locus, which typically consists of a singleCas13 protein and CRISPR array containing multiple Spacer andDirect Repeat (DR) sequences. FIG. 19B is a schematic demonstratingthat each functional CRISPR guide RNA is processed to include aSpacer and Direct Repeat. Spacer sequences are anti-sense to Targetsequences and provide target specificity, whereas the DR sequenceacts as a handle for binding to Cas13 protein. FIG. 19C is aschematic depicting that mammalian crRNA expression cassettes aretypically constructed by annealing and ligating oligonucleotidescomprising a desired spacer sequence. FIG. 19D is a schematicdemonstrating that harnessing tolerable nucleotide substitutionswithin the loop region of the DR, multiple guide-RNAs areefficiently generated in an ordered array FIG. 19E depictspotential tolerable nucleotide substitutions within the loop regionof PspCas13b DR which could be harnessed for array assembly.

[0052] FIG. 20, comprising FIG. 20A through FIG. 20C, depicts theidentification and validation of non-essential loop residues inCas13b Direct Repeat (DR). FIG. 20A depicts all possible mutationsat positions T17 and T18 of the PspCas13b Direct Repeat. FIG. 20Bis a schematic depicting the Luciferase reporter and crRNA targetsites locations. FIG. 20C depicts experimental resultsdemonstrating CRISPR-Cas13b knockdown of Luciferase activity withtwo independent guide RNAs containing individual DR loopmutations.

[0053] FIG. 21, comprising FIG. 21A through FIG. 21C, depictstargeted knockdown of a SARS-CoV-2 Luciferase Reporter with aGuide-RNA array. FIG. 21A is a schematic depicting the lentiviralgene transfer plasmids encoding CRISPR-Cas13 expression cassettesencoding either single or triple guide RNA arrays. FIG. 21B is aschematic of a Luciferase reporter containing multiple SARS-CoV-2viral sequences within the 5' and 3' UTRs. FIG. 21C depictsexperimental results demonstrating relative luciferase activityknockdown through expression of CRISPR-Cas13 RNA targetingcomponents driven by single (LDR-D) or triple guide-RNAs(LDR-D/N-B/S2M-D) targeting the SARS-CoV-2 luciferase reporter,relative to negative control non-targeting crRNA (NC).

[0054] FIG. 22 is a schematic of the CRISPR-Cas13 expressioncassette encoding triple guide RNAs can be packaged in AAV viralvectors.

[0055] FIG. 23, comprising FIG. 23A and FIG. 23B, is a schematic ofthe influenza virus. FIG. 23A is a schematic of Influenza viralRNAs (vRNAs). Influenza is an enveloped, negative-sense RNA viruswhich is composed of 8 vRNA segments. FIG. 23A is a schematic ofinfluenza virus particles. All eight vRNAs are packed within anenveloped virus which utilizes viral proteins HA and NA for hostcell binding and fusion.

[0056] FIG. 24, comprising FIG. 24A and FIG. 24B, is a schematic ofthe Packaging and Delivery CRISPR-Cas13 RNA editing components totarget Influenza. FIG. 24A is a schematic demonstrating that theCRISPR-Cas13 editing components, including a CRISPR guide RNA arrayand Cas13 protein, can be packaged into viral gene therapy vectors,for example, integration deficient lentiviral vectors. Pseudotypingof lentiviral vectors with Influenza NA and HA envelope proteins isone method for delivery to host cells targeted by Influenza virus.FIG. 24A is a schematic demonstrating that upon viral vector fusionand delivery, expression of CRISPR-Cas13 components will result intargeted degradation of vRNAs or viral mRNAs. For targeting ofvRNAs, robust nuclear localization of Cas13 protein may benecessary.

[0057] FIG. 25, comprising FIG. 25A and FIG. 26B depictsexperimental results demonstrating comparative knockdown of a DM1luciferase reporter between CRISPR-Cas13a,-b, and -d subtypes. FIG.25A is a schematic depicting the DM1 Luciferase reporter(pGL3P-DT960) which contains human DMPK Exon15 sequence encoding a960 CUG repeat located in the 3' UTR of the luciferase reporterpGL3P. Relative target sites for Luciferase (Luc) and CAG crRNAstargeting CUG repeats are depicted. FIG. 25B depicts the relativeluciferase reporter activities for knockdown of pGL3P-DT960targeting Luciferase and CUG repeats are shown for eraseR(PspCas13b-Ty1NLS), RfxCas13d (CasRx-NLS) and LwCas13a.

[0058] FIG. 26, comprising FIG. 26A through FIG. 26C, depictsexperimental results demonstrating targeted clearance of toxicnuclear RNA foci by CRISPR-Cas13 subtypes. FIG. 26A depicts therelative knockdown of toxic nuclear RNA foci, induced by expressionof an RNA containing 960 copies of a CUG expansion repeat,PspCas13b-Ty1NLS. FIG. 26B the relative knockdown knockdown oftoxic nuclear RNA foci, induced by expression of an RNA containing960 copies of a CUG expansion repeat, RfxCas13d(CasRx-NLS). FIG.26C the relative knockdown knockdown of toxic nuclear RNA foci,induced by expression of an RNA containing 960 copies of a CUGexpansion repeat, LwCas13a. Nuclear foci were labeled byco-expression of an mCherry-MBNL1 fusion protein and imaged usingconfocal microscopy

[0059] FIG. 27, comprising FIG. 27A and FIG. 27B, depictsexperimental results demonstrating pseudotyping lentiviral vectorswith SARS-CoV spike envelope proteins. FIG. 27A is a schematicdemonstrating that N and C-terminal modifications (4LV) arerequired for pseudotyping lentivirus with CoV Spike proteins fromSARS-Cov-1 and SARS-CoV-2. FIG. 27B depicts experimental resultsdemonstrating that wild type (WT) CoV spike proteins are notsuitable for pseudotyping lentivirus for transduction of HEK293Tcells or HEK293T cells expressing human ACE2 (ACE2-HEK293T).Expression of the human ACE2 receptor in HEK293T cells is bothnecessary and sufficient for transduction by 4LV pseudotypedlentiviral vectors. VSV-G envelopes allow for pseudotypinglentivirus for broad transduction of many cell types in vitro,independent of ACE2 expression.

DETAILED DESCRIPTION

[0060] In one aspect, the disclosure provides novel CRISPR RNAs(crRNAs) for targeting a viral RNA such as a coronavirus or aninfluenza virus. For example, in one embodiment, the crRNAcomprises a guide sequence that is substantially complementary to acoronavirus genomic mRNA, coronavirus sub-genomic mRNA, influenzavirus genomic RNA, or influenza virus sub-genomic RNA. In oneembodiment, the crRNA comprises a guide sequence that issubstantially complementary to a Coronavirus leader sequence,Coronavirus S sequence, Coronavirus E sequence, Coronavirus Msequence, N sequence, or Coronavirus S2M sequence. In oneembodiment, the the crRNA comprises a guide sequence issubstantially complementary to an influenza virus PB2 sequence,influenza virus PB1 sequence, influenza virus PA sequence,influenza virus NP sequence, or influenza virus M sequence.

[0061] In one aspect, the disclosure provides a crRNA tandem array.In one embodiment, the tandem array comprises two or more, three ormore, four or more, five or more six or more, seven or more oreight or more crRNA sequences. In one embodiment, each crRNA in thetandem crRNA array comprises a direct repeat (DR) sequence. The DRsequence of each crRNA array can be different. For example, in oneembodiment, at least one of the DR sequences includes a singlemutation in the poly T stretch.

[0062] In one aspect, the disclosure is based on the development ofnovel proteins which provide targeted RNA cleavage. In oneembodiment, the fusion protein comprises a Cas protein, andoptionally a localization signal. These proteins allow for specificlocalization of Cas proteins providing targeted RNA cleavage. Inone embodiment, the Cas protein has RNA binding activity. In oneembodiment, Cas protein is Cas13. In one embodiment, thelocalization signal is a nuclear localization signal, nuclearexport signal or other localization signal that localizes theprotein to an extracellularly or to an organelle such as thenucleolus, ribosome, vesicle, rough endoplasmic reticulum, Golgiapparatus, cytoskeleton, smooth endoplasmic reticulum,mitochondria, vacuole, cytosol, lysosome, or centriole.

[0063] In one aspect, the disclosure is based on the development ofnovel fusion proteins which provide targeted RNA visualization. Inone embodiment, the fusion protein comprises a catalytically deadCas protein, a fluorescent protein, and optionally a localizationsignal. In one embodiment, the fusion protein combines thevisualization capability of the fluorescent protein and theprogrammable DNA targeting capability of catalytically dead Cas.These fusion proteins allow for specific localization of Casproteins providing for targeted RNA visualization. In oneembodiment, the Cas protein has RNA binding activity. In oneembodiment, Cas protein is dCas13. In one embodiment, thelocalization signal is a nuclear localization signal, nuclearexport signal or other localization signal that localizes theprotein to an extracellularly or to an organelle such as thenucleolus, ribosome, vesicle, rough endoplasmic reticulum, Golgiapparatus, cytoskeleton, smooth endoplasmic reticulum,mitochondria, vacuole, cytosol, lysosome, or centriole.

Definitions

[0064] Unless defined otherwise, all technical and scientific termsused herein have the same meaning as commonly understood by one ofordinary skill in the art to which this invention belongs.

[0065] Generally, the nomenclature used herein and the laboratoryprocedures in cell culture, molecular genetics, organic chemistry,and nucleic acid chemistry and hybridization are those well-knownand commonly employed in the art.

[0066] Standard techniques are used for nucleic acid and peptidesynthesis. The techniques and procedures are generally performedaccording to conventional methods in the art and various generalreferences (e.g., Sambrook and Russell, 2012, Molecular Cloning, ALaboratory Approach, Cold Spring Harbor Press, Cold Spring Harbor,N.Y., and Ausubel et al., 2012, Current Protocols in MolecularBiology, John Wiley & Sons, NY), which are provided throughoutthis document.

[0067] The nomenclature used herein, and the laboratory proceduresused in analytical chemistry and organic syntheses described beloware those well-known and commonly employed in the art. Standardtechniques or modifications thereof are used for chemical synthesesand chemical analyses.

[0068] The term "a," "an," "the" and similar terms used in thecontext of the present invention (especially in the context of theclaims) are to be construed to cover both the singular and pluralunless otherwise indicated herein or clearly contradicted by thecontext. "About" as used herein when referring to a measurablevalue such as an amount, a temporal duration, and the like, ismeant to encompass variations of .+-.20%, or .+-.10%, or .+-.5%, or.+-.1%, or .+-.0.1% from the specified value, as such variationsare appropriate to perform the disclosed methods.

[0069] "Antisense" refers particularly to the nucleic acid sequenceof the non-coding strand of a double stranded DNA molecule encodinga protein, or to a sequence which is substantially homologous tothe non-coding strand. As defined herein, an antisense sequence iscomplementary to the sequence of a double stranded DNA moleculeencoding a protein. It is not necessary that the antisense sequencebe complementary solely to the coding portion of the coding strandof the DNA molecule. The antisense sequence may be complementary toregulatory sequences specified on the coding strand of a DNAmolecule encoding a protein, which regulatory sequences controlexpression of the coding sequences.

[0070] A "disease" is a state of health of an animal wherein theanimal cannot maintain homeostasis, and wherein if the disease isnot ameliorated then the animal's health continues todeteriorate.

[0071] In contrast, a "disorder" in an animal is a state of healthin which the animal is able to maintain homeostasis, but in whichthe animal's state of health is less favorable than it would be inthe absence of the disorder. Left untreated, a disorder does notnecessarily cause a further decrease in the animal's state ofhealth.

[0072] A disease or disorder is "alleviated" if the severity of asign or symptom of the disease or disorder, the frequency withwhich such a sign or symptom is experienced by a patient, or both,is reduced.

[0073] "Encoding" refers to the inherent property of specificsequences of nucleotides in a polynucleotide, such as a gene, acDNA, or an mRNA, to serve as templates for synthesis of otherpolymers and macromolecules in biological processes having either adefined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or adefined sequence of amino acids and the biological propertiesresulting therefrom. Thus, a gene encodes a protein iftranscription and translation of mRNA corresponding to that geneproduces the protein in a cell or other biological system. Both thecoding strand, the nucleotide sequence of which is identical to themRNA sequence and is usually provided in sequence listings, and thenon-coding strand, used as the template for transcription of a geneor cDNA, can be referred to as encoding the protein or otherproduct of that gene or cDNA.

[0074] The terms "patient," "subject," "individual," and the likeare used interchangeably herein, and refer to any animal or cellwhether in vitro or in vivo, amenable to the methods describedherein. In one embodiment, the subjects include vertebrates andinvertebrates. Invertebrates include, but are not limited to,Drosophila melanogaster and Caenorhabditis elegans. Vertebratesinclude, but are not limited to, primates, rodents, domesticanimals or game animals. Primates include, but are not limited to,chimpanzees, cynomologous monkeys, spider monkeys, and macaques(e.g., Rhesus). Rodents include, but are not limited to, mice,rats, woodchucks, ferrets, rabbits and hamsters. Domestic and gameanimals include, but are not limited to, cows, horses, pigs, deer,bison, buffalo, feline species (e.g., domestic cat), canine species(e.g., dog, fox, wolf), avian species (e.g., chicken, emu,ostrich), and fish (e.g., zebrafish, trout, catfish and salmon). Insome embodiments, the subject is a mammal, e.g., a primate, e.g., ahuman. In certain non-limiting embodiments, the patient, subject orindividual is a human.

[0075] By the term "specifically binds," as used herein withrespect to an antibody, is meant an antibody which recognizes aspecific antigen, but does not substantially recognize or bindother molecules in a sample. For example, an antibody thatspecifically binds to an antigen from one species may also bind tothat antigen from one or more species. But, such cross-speciesreactivity does not itself alter the classification of an antibodyas specific. In another example, an antibody that specificallybinds to an antigen may also bind to different allelic forms of theantigen. However, such cross reactivity does not itself alter theclassification of an antibody as specific.

[0076] In some instances, the terms "specific binding" or"specifically binding," can be used in reference to the interactionof an antibody, a protein, or a peptide with a second chemicalspecies, to mean that the interaction is dependent upon thepresence of a particular structure (e.g., an antigenic determinantor epitope) on the chemical species; for example, an antibodyrecognizes and binds to a specific protein structure rather than toproteins generally. If an antibody is specific for epitope "A", thepresence of a molecule containing epitope A (or free, unlabeled A),in a reaction containing labeled "A" and the antibody, will reducethe amount of labeled A bound to the antibody.

[0077] A "coding region" of a gene consists of the nucleotideresidues of the coding strand of the gene and the nucleotides ofthe non-coding strand of the gene which are homologous with orcomplementary to, respectively, the coding region of an mRNAmolecule which is produced by transcription of the gene.

[0078] A "coding region" of a mRNA molecule also consists of thenucleotide residues of the mRNA molecule which are matched with ananti-codon region of a transfer RNA molecule during translation ofthe mRNA molecule or which encode a stop codon. The coding regionmay thus include nucleotide residues comprising codons for aminoacid residues which are not present in the mature protein encodedby the mRNA molecule (e.g., amino acid residues in a protein exportsignal sequence).

[0079] "Complementary" as used herein to refer to a nucleic acid,refers to the broad concept of sequence complementarity betweenregions of two nucleic acid strands or between two regions of thesame nucleic acid strand. It is known that an adenine residue of afirst nucleic acid region is capable of forming specific hydrogenbonds ("base pairing") with a residue of a second nucleic acidregion which is antiparallel to the first region if the residue isthymine or uracil. Similarly, it is known that a cytosine residueof a first nucleic acid strand is capable of base pairing with aresidue of a second nucleic acid strand which is antiparallel tothe first strand if the residue is guanine. A first region of anucleic acid is complementary to a second region of the same or adifferent nucleic acid if, when the two regions are arranged in anantiparallel fashion, at least one nucleotide residue of the firstregion is capable of base pairing with a residue of the secondregion. In one embodiment, the first region comprises a firstportion and the second region comprises a second portion, whereby,when the first and second portions are arranged in an antiparallelfashion, at least about 50%, at least about 75%, at least about90%, or at least about 95% of the nucleotide residues of the firstportion are capable of base pairing with nucleotide residues in thesecond portion. In one embodiment, all nucleotide residues of thefirst portion are capable of base pairing with nucleotide residuesin the second portion.

[0080] The term "DNA" as used herein is defined as deoxyribonucleicacid.

[0081] The term "expression" as used herein is defined as thetranscription and/or translation of a particular nucleotidesequence driven by its promoter.

[0082] The term "expression vector" as used herein refers to avector containing a nucleic acid sequence coding for at least partof a gene product capable of being transcribed. In some cases, RNAmolecules are then translated into a protein, polypeptide, orpeptide. In other cases, these sequences are not translated, forexample, in the production of antisense molecules, siRNA,ribozymes, and the like. Expression vectors can contain a varietyof control sequences, which refer to nucleic acid sequencesnecessary for the transcription and possibly translation of anoperatively linked coding sequence in a particular host organism.In addition to control sequences that govern transcription andtranslation, vectors and expression vectors may contain nucleicacid sequences that serve other functions as well.

[0083] As used herein the term "wild type" is a term of the artunderstood by skilled persons and means the typical form of anorganism, strain, gene or characteristic as it occurs in nature asdistinguished from mutant or variant forms.

[0084] The term "homology" refers to a degree of complementarity.There may be partial homology or complete homology (i.e.,identity). Homology is often measured using sequence analysissoftware (e.g., Sequence Analysis Software Package of the GeneticsComputer Group. University of Wisconsin Biotechnology Center. 1710University Avenue. Madison, Wis. 53705). Such software matchessimilar sequences by assigning degrees of homology to varioussubstitutions, deletions, insertions, and other modifications.Conservative substitutions typically include substitutions withinthe following groups: glycine, alanine; valine, isoleucine,leucine; aspartic acid, glutamic acid, asparagine, glutamine;serine, threonine; lysine, arginine; and phenylalanine,tyrosine.

[0085] By "nucleic acid" is meant any nucleic acid, whethercomposed of deoxyribonucleosides or ribonucleosides, and whethercomposed of phosphodiester linkages or modified linkages such asphosphotriester, phosphoramidate, siloxane, carbonate,carboxymethylester, acetamidate, carbamate, thioether, bridgedphosphoramidate, bridged methylene phosphonate, phosphorothioate,methylphosphonate, phosphorodithioate, bridged phosphorothioate orsulfone linkages, and combinations of such linkages. The termnucleic acid also specifically includes nucleic acids composed ofbases other than the five biologically occurring bases (adenine,guanine, thymine, cytosine and uracil). The term "nucleic acid"typically refers to large polynucleotides.

[0086] Conventional notation is used herein to describepolynucleotide sequences: the left-hand end of a single-strandedpolynucleotide sequence is the 5'-end; the left-hand direction of adouble-stranded polynucleotide sequence is referred to as the5'-direction.

[0087] The direction of 5' to 3' addition of nucleotides to nascentRNA transcripts is referred to as the transcription direction. TheDNA strand having the same sequence as an mRNA is referred to asthe "coding strand"; sequences on the DNA strand which are located5' to a reference point on the DNA are referred to as "upstreamsequences"; sequences on the DNA strand which are 3' to a referencepoint on the DNA are referred to as "downstream sequences."

[0088] In the context of the present invention, the followingabbreviations for the commonly occurring nucleic acid bases areused. "A" refers to adenosine, "C" refers to cytosine, "G" refersto guanosine, "T" refers to thymidine, and "U" refers touridine.

[0089] As used herein, the terms "peptide," "polypeptide," and"protein" are used interchangeably, and refer to a compoundcomprised of amino acid residues covalently linked by peptidebonds. A protein or peptide must contain at least two amino acids,and no limitation is placed on the maximum number of amino acidsthat can comprise a protein's or peptide's sequence. Polypeptidesinclude any peptide or protein comprising two or more amino acidsjoined to each other by peptide bonds. As used herein, the termrefers to both short chains, which also commonly are referred to inthe art as peptides, oligopeptides and oligomers, for example, andto longer chains, which generally are referred to in the art asproteins, of which there are many types. "Polypeptides" include,for example, biologically active fragments, substantiallyhomologous polypeptides, oligopeptides, homodimers, heterodimers,variants of polypeptides, modified polypeptides, derivatives,analogs, fusion proteins, among others. The polypeptides includenatural peptides, recombinant peptides, synthetic peptides, or acombination thereof.

[0090] The term "RNA" as used herein is defined as ribonucleicacid.

[0091] "Variant" as the term is used herein, is a nucleic acidsequence or a peptide sequence that differs in sequence from areference nucleic acid sequence or peptide sequence respectively,but retains essential biological properties of the referencemolecule. Changes in the sequence of a nucleic acid variant may notalter the amino acid sequence of a peptide encoded by the referencenucleic acid, or may result in amino acid substitutions, additions,deletions, fusions and truncations. Changes in the sequence ofpeptide variants are typically limited or conservative, so that thesequences of the reference peptide and the variant are closelysimilar overall and, in many regions, identical. A variant andreference peptide can differ in amino acid sequence by one or moresubstitutions, additions, deletions in any combination. A variantof a nucleic acid or peptide can be a naturally occurring such asan allelic variant, or can be a variant that is not known to occurnaturally. Non-naturally occurring variants of nucleic acids andpeptides may be made by mutagenesis techniques or by directsynthesis.

[0092] A "vector" is a composition of matter which comprises anisolated nucleic acid and which can be used to deliver the isolatednucleic acid to the interior of a cell. Numerous vectors are knownin the art including, but not limited to, linear polynucleotides,polynucleotides associated with ionic or amphiphilic compounds,plasmids, and viruses. Thus, the term "vector" includes anautonomously replicating plasmid or a virus. The term should alsobe construed to include non-plasmid and non-viral compounds whichfacilitate transfer of nucleic acid into cells, such as, forexample, polylysine compounds, liposomes, and the like. Examples ofviral vectors include, but are not limited to, adenoviral vectors,adeno-associated virus vectors, retroviral vectors, and thelike.

[0093] Ranges: throughout this disclosure, various aspects of theinvention can be presented in a range format. It should beunderstood that the description in range format is merely forconvenience and brevity and should not be construed as aninflexible limitation on the scope of the invention. Accordingly,the description of a range should be considered to havespecifically disclosed all the possible subranges as well asindividual numerical values within that range. For example,description of a range such as from 1 to 6 should be considered tohave specifically disclosed subranges such as from 1 to 3, from 1to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., aswell as individual numbers within that range, for example, 1, 2,2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth ofthe range.

Proteins

[0094] In one aspect, the present disclosure is based on thedevelopment of novel editing proteins which provide targeted RNAcleavage. In some embodiment, the proteins comprise a localizationsignal. In one embodiment, the localization signal localizes theprotein to the site in which a target RNA is located. In oneembodiment, the protein comprises a nuclear localization signal(NLS), to target RNA in the nucleus. In one embodiment, the proteincomprises an nuclear export signal (NES), to target RNA in thecytoplasm. Other localization signals can be used (and which areknown in the art) to target RNA in organelles, such asmitochondria. In other embodiments, the protein does not comprisean NLS, to target RNA in the cytoplasm. In one embodiment, theprotein comprises a purification and/or detection tag.

[0095] The present disclosure also provides novel fusions of anediting protein and a fluorescent protein. In one embodiment, thefusion protein combines the visualization capability of thefluorescent protein and the programmable nucleic acid targetingcapability of catalytically dead Cas. In one embodiment, the fusionprotein comprises a nuclear localization signal, to target RNA inthe nucleus. In some embodiments, the fusion protein comprises anuclear export signal (NES), to target RNA in the cytoplasm. Inother embodiments, the fusion protein does not comprise an NLS, totarget RNA in the cytoplasm. Other localization signals can be used(and which are known in the art) to target RNA in organelles, suchas mitochondria. In one embodiment, the fusion protein comprises alinker. In one embodiment, the linker links the Cas protein andfluorescent protein. In one embodiment, the fusion proteincomprises a purification and/or detection tag.

EraseR

[0096] In one aspect, the present disclosure is based on thedevelopment of novel editing proteins which provide targeted RNAcleavage and are effectively delivered. In some embodiment, theproteins comprise a localization signal. In one embodiment, thelocalization signal localizes the protein to the site in which atarget RNA is located. In one embodiment, the protein comprises apurification and/or detection tag. In one embodiment, the proteincomprises a purification and/or detection tag.

[0097] Editing Protein

[0098] In one embodiment, the editing protein includes, but is notlimited to, a CRISPR-associated (Cas) protein, a zinc fingernuclease (ZFN) protein, and a protein having a DNA or RNA bindingdomain.

[0099] Non-limiting examples of Cas proteins include Cas1, Cas1B,Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2,Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5,Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14,Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4,SpCas9, StCas9, NmCas9, SaCas9, CjCas9, CjCas9, AsCpf1, LbCpf1,FnCpf1, VRER SpCas9, VQR SpCas9, xCas9 3.7, homologs thereof,orthologs thereof, or modified versions thereof. In someembodiments, the Cas protein has DNA or RNA cleavage activity. Insome embodiments, the Cas protein directs cleavage of one or bothstrands of a nucleic acid molecule at the location of a targetsequence, such as within the target sequence and/or within thecomplement of the target sequence. In some embodiments, the Casprotein directs cleavage of one or both strands within about 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or morebase pairs from the first or last nucleotide of a target sequence.In one embodiment, the Cas protein is Cas9, Cas13, or Cpf1. In oneembodiment, Cas protein is catalytically deficient (dCas).

[0100] In one embodiment, the Cas protein has RNA binding activity.In one embodiment, Cas protein is Cas13. In one embodiment, the Casprotein is PspCas13b, PspCas13b Truncation, AdmCas13d, AspCas13b,AspCas13c, BmaCas13a, BzoCas13b, CamCas13a, CcaCas13b, Cga2Cas13a,CgaCas13a, EbaCas13a, EreCas13a, EsCas13d, FbrCas13b, FnbCas13c,FndCas13c, FnfCas13c, FnsCas13c, FpeCas13c, FulCas13c, HheCas13a,LbfCas13a, LbmCas13a, LbnCas13a, LbuCas13a, LseCas13a, LshCas13a,LspCas13a, Lwa2cas13a, LwaCas13a, LweCas13a, PauCas13b, PbuCas13b,PgiCas13b, PguCas13b, Pin2Cas13b, Pin3Cas13b, PinCas13b, Pprcas13a,PsaCas13b, PsmCas13b, RaCas13d, RanCas13b, RcdCas13a, RcrCas13a,RcsCas13a, RfxCas13d, UrCas13d, dPspCas13b, PspCas13b_A133H,PspCas13b_A1058H, dPspCas13b truncation, dAdmCas13d, dAspCas13b,dAspCas13c, dBmaCas13a, dBzoCas13b, dCamCas13a, dCcaCas13b,dCga2Cas13a, dCgaCas13a, dEbaCas13a, dEreCas13a, dEsCas13d,dFbrCas13b, dFnbCas13c, dFndCas13c, dFnfCas13c, dFnsCas13c,dFpeCas13c, dFulCas13c, dHheCas13a, dLbfCas13a, dLbmCas13a,dLbnCas13a, dLbuCas13a, dLseCas13a, dLshCas13a, dLspCas13a,dLwa2cas13a, dLwaCas13a, dLweCas13a, dPauCas13b, dPbuCas13b,dPgiCas13b, dPguCas13b, dPin2Cas13b, dPin3Cas13b, dPinCas13b,dPprCas13a, dPsaCas13b, dPsmCas13b, dRaCas13d, dRanCas13b,dRcdCas13a, dRcrCas13a, dRcsCas13a, dRfxCas13d, or dUrCas13d.Additional Cas proteins are known in the art (e.g., Konermann etal., Cell, 2018, 173:665-676 e14, Yan et al., Mol Cell, 2018,7:327-339 e5; Cox, D. B. T., et al., Science, 2017, 358: 1019-1027;Abudayyeh et al., Nature, 2017, 550: 280-284, Gootenberg et al.,Science, 2017, 356: 438-442; and East-Seletsky et al., Mol Cell,2017, 66: 373-383 e3, which are herein incorporated byreference).

[0101] In one embodiment, the Cas protein comprises a sequence atleast 70%, at least 71%, at least 72%, at least 73%, at least 74%,at least 75%, at least 76%, at least 77%, at least 78%, at least79%, at least 80%, at least 81%, at least 82%, at least 83%, atleast 84%, at least 85%, at least 86%, at least 87%, at least 88%,at least 89%, at least 90%, at least 91%, at least 92%, at least93%, at least 94%, at least 95%, at least 96%, at least 97%, atleast 98%, or at least 99% identical to one of SEQ ID NOs:1-48. Inone embodiment, the Cas protein comprises a sequence at least 70%,at least 71%, at least 72%, at least 73%, at least 74%, at least75%, at least 76%, at least 77%, at least 78%, at least 79%, atleast 80%, at least 81%, at least 82%, at least 83%, at least 84%,at least 85%, at least 86%, at least 87%, at least 88%, at least89%, at least 90%, at least 91%, at least 92%, at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%,or at least 99% identical to one of SEQ ID NOs: 1-46. In oneembodiment, the Cas protein comprises a sequence of one of SEQ IDNOs:1-48. In one embodiment, the Cas protein comprises a sequenceof one of SEQ ID NOs:1-46.

[0102] Localization Signal

[0103] In some embodiments, the protein may contain a localizationsignal, such as an nuclear localization signal (NLS), nuclearexport signal (NES) or other localization signals to localize toorganelles, such as mitochondria, or to localize in the cytoplasm.In one embodiment, the localization signal localizes the protein tothe site in which a target RNA is located.

[0104] Nuclear Localization Signal

[0105] In one embodiment, the protein comprises a NLS. In oneembodiment, the NLS is a retrotransposon NLS. In one embodiment,the NLS is derived from Ty1, yeast GAL4, SKI3, L29 or histone H2Bproteins, polyoma virus large T protein, VP1 or VP2 capsid protein,SV40 VP1 or VP2 capsid protein, Adenovirus E1 a or DBP protein,influenza virus NS1 protein, hepatitis vims core antigen or themammalian lamin, c-myc, max, c-myb, p53, c-erbA, jun, Tax, steroidreceptor or Mx proteins, Nucleoplasmin (NPM2), Nucleophosmin(NPM1), or simian vims 40 ("SV40") T-antigen. In one embodiment,the NLS is a Ty1 or Ty1-derived NLS, a Ty2 or Ty2-derived NLS or aMAK11 or MAK11-derived NLS. In one embodiment, the Ty1 NLScomprises an amino acid sequence of SEQ ID NO:67. In oneembodiment, the Ty2 NLS comprises an amino acid sequence of SEQ IDNO:68. In one embodiment, the MAK11 NLS comprises an amino acidsequence of SEQ ID NO:69. In one embodiment, the NLS comprises asequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to one of SEQ ID NOs:67-74 and 427-1039. In one embodiment, the NLS comprises a sequenceof one of SEQ ID NOs: 67-74 and 427-1039.

[0106] In one embodiment, the NLS is a Ty1-like NLS. For example,in one embodiment, the Ty1-like NLS comprises KKRX motif. In oneembodiment, the Ty1-like NLS comprises KKRX motif at the N-terminalend. In one embodiment, the Ty1-like NLS comprises KKR motif. Inone embodiment, the Ty1-like NLS comprises KKR motif at theC-terminal end. In one embodiment, the Ty1-like NLS comprises aKKRX and a KKR motif. In one embodiment, the Ty1-like NLS comprisesa KKRX at the N-terminal end and a KKR motif at the C-terminal end.In one embodiment, the Ty1-like NLS comprises at least 20 aminoacids. In one embodiment, the Ty1-like NLS comprises between 20 and40 amino acids. In one embodiment, the Ty1-like NLS comprises asequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to one of SEQ ID NOs:427-1039. In one embodiment, the NLS comprises a sequence of one ofSEQ ID NOs: 427-1039, wherein the sequence comprises one or more,two or more, three or more, four or more, five or more, six ormore, seven or more, eight or more, nine or more, or ten or more,insertions, deletions or substitutions. In one embodiment, theTy1-like NLS comprises a sequence of one of SEQ ID NOs:427-1039.

[0107] In one embodiment, the NLS comprises two copies of the sameNLS. For example, in one embodiment, the NLS comprises a multimerof a first Ty1-derived NLS and a second Ty1-derived NLS.

[0108] Nuclear Export Signal

[0109] In one embodiment, the protein comprises a Nuclear ExportSignal (NES). In one embodiment, the NES is attached to theN-terminal end of the Cas protein. In one embodiment, the NESlocalizes the protein to the cytoplasm for targeting cytoplasmicRNA. In one embodiment, the NES comprises an amino acid sequence atleast 70%, at least 71%, at least 72%, at least 73%, at least 74%,at least 75%, at least 76%, at least 77%, at least 78%, at least79%, at least 80%, at least 81%, at least 82%, at least 83%, atleast 84%, at least 85%, at least 86%, at least 87%, at least 88%,at least 89%, at least 90%, at least 91%, at least 92%, at least93%, at least 94%, at least 95%, at least 96%, at least 97%, atleast 98%, or at least 99% identical to SEQ ID NO:75 or 76. In oneembodiment, the NES comprises an amino acid sequence of SEQ ID NO:75 or 76.

[0110] Organelle Localization Signal

[0111] In one embodiment, the protein comprises a localizationsignal that localizes the protein to an organelle. In oneembodiment, the localization signal localizes the protein to thenucleolus, ribosome, vesicle, rough endoplasmic reticulum, Golgiapparatus, cytoskeleton, smooth endoplasmic reticulum,mitochondria, vacuole, cytosol, lysosome, or centriole. A number oflocalization signals are known in the art.

[0112] In one embodiment, the protein comprises a localizationsignal that localizes the protein to an organelle orextracellularly. In one embodiment, the localization signallocalizes the protein to the nucleolus, ribosome, vesicle, roughendoplasmic reticulum, Golgi apparatus, cytoskeleton, smoothendoplasmic reticulum, mitochondria, vacuole, cytosol, lysosome, orcentriole.

[0113] A number of localization signals are known in the art.Exemplary localization signals include, but are not limited to1.times. mitochondrial targeting sequence, 4.times. mitochondrialtargeting sequence, secretory signal sequence (IL-2),myristylation, Calsequestrin leader, KDEL retention and peroxisometargeting sequence.

[0114] In one embodiment, the localization signal comprisessequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to SEQ ID NO:77-83. Inone embodiment, the localization signal comprises sequence of SEQID NO: 77-83.

[0115] Purification and/or Detection Tag

[0116] In some embodiments, the protein may contain a purificationand/or detection tag. In one embodiment, the tag is on theN-terminal end of the protein. In one embodiment, the tag is a3.times.FLAG tag. In one embodiment, the tag comprises an aminoacid sequence at least 70%, at least 71%, at least 72%, at least73%, at least 74%, at least 75%, at least 76%, at least 77%, atleast 78%, at least 79%, at least 80%, at least 81%, at least 82%,at least 83%, at least 84%, at least 85%, at least 86%, at least87%, at least 88%, at least 89%, at least 90%, at least 91%, atleast 92%, at least 93%, at least 94%, at least 95%, at least 96%,at least 97%, at least 98%, or at least 99% identical to SEQ IDNO:66. In one embodiment, the tag comprises an amino acid sequenceof SEQ ID NO:66.

[0117] EraseR Proteins

[0118] In one embodiment, the proteins of the disclosure areeffectively delivered to the nucleus, an organelle, the cytoplasmor extracellularly and allow for targeted RNA cleavage. In oneembodiment, the protein comprises an amino acid sequence 70%, atleast 71%, at least 72%, at least 73%, at least 74%, at least 75%,at least 76%, at least 77%, at least 78%, at least 79%, at least80%, at least 81%, at least 82%, at least 83%, at least 84%, atleast 85%, at least 86%, at least 87%, at least 88%, at least 89%,at least 90%, at least 91%, at least 92%, at least 93%, at least94%, at least 95%, at least 96%, at least 97%, at least 98%, or atleast 99% identical to one of SEQ ID NOs:150-171. In oneembodiment, the protein comprises an amino acid sequence of one ofSEQ ID NOs: 150-171.

HiLightR

[0119] The present disclosure also provides novel fusions of anediting protein and a fluorescent protein. In one embodiment, thefusion protein combines the visualization capability of thefluorescent protein and the programmable DNA targeting capabilityof catalytically dead Cas. In one embodiment, the fusion proteincomprises a nuclear localization signal, to target RNA in thenucleus. In one embodiments, the fusion protein comprises a nuclearexport signal (NES), to target RNA in the cytoplasm. In otherembodiments, the fusion protein does not comprise an NLS, to targetRNA in the cytoplasm. Other localization signals can be used (andwhich are known in the art) to target RNA in organelles, such asmitochondria. In one embodiment, the fusion protein comprises alinker. In one embodiment, the linker links the Cas protein andfluorescent protein. In one embodiment, the fusion proteincomprises a purification and/or detection tag.

[0120] Editing Protein

[0121] In one embodiment, the editing protein includes, but is notlimited to, a CRISPR-associated (Cas) protein, a zinc fingernuclease (ZFN) protein, and a protein having a DNA or RNA bindingdomain.

[0122] Non-limiting examples of Cas proteins include Cas1, Cas1B,Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2,Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2. Csm2, Csm3, Csm4, Csm5,Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14,Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4,SpCas9, StCas9, NmCas9, SaCas9, CjCas9, CjCas9, AsCpf1, LbCpf1,FnCpf1, VRER SpCas9, VQR SpCas9, xCas9 3.7, homologs thereof,orthologs thereof, or modified versions thereof. In someembodiments, the Cas protein has DNA or RNA cleavage activity. Insome embodiments, the Cas protein directs cleavage of one or bothstrands of a nucleic acid molecule at the location of a targetsequence, such as within the target sequence and/or within thecomplement of the target sequence. In some embodiments, the Casprotein directs cleavage of one or both strands within about 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or morebase pairs from the first or last nucleotide of a target sequence.In one embodiment, the Cas protein is Cas9, Cas13, or Cpf1. In oneembodiment, Cas protein is catalytically deficient (dCas).

[0123] In one embodiment, the Cas protein has RNA binding activity.In one embodiment, Cas protein is Cas13. In one embodiment, the Casprotein is PspCas13b, PspCas13b Truncation, AdmCas13d, AspCas13b,AspCas13c, BmaCas13a, BzoCas13b, CamCas13a, CcaCas13b, Cga2Cas13a,CgaCas13a, EbaCas13a, EreCas13a, EsCas13d, FbrCas13b, FnbCas13c,FndCas13c, FnfCas13c, FnsCas13c, FpeCas13c, FulCas13c, HheCas13a,LbfCas13a, LbmCas13a, LbnCas13a, LbuCas13a, LseCas13a, LshCas13a,LspCas13a, Lwa2cas13a, LwaCas13a, LweCas13a, PauCas13b, PbuCas13b,PgiCas13b, PguCas13b, Pin2Cas13b, Pin3Cas13b, PinCas13b, Pprcas13a,PsaCas13b, PsmCas13b, RaCas13d, RanCas13b, RcdCas13a, RcrCas13a,RcsCas13a, RfxCas13d, UrCas13d, dPspCas13b, PspCas13b_A133H,PspCas13b_A1058H, dPspCas13b truncation, dAdmCas13d, dAspCas13b,dAspCas13c, dBmaCas13a, dBzoCas13b, dCamCas13a, dCcaCas13b,dCga2Cas13a, dCgaCas13a, dEbaCas13a, dEreCas13a, dEsCas13d,dFbrCas13b, dFnbCas13c, dFndCas13c, dFnfCas13c, dFnsCas13c,dFpeCas13c, dFulCas13c, dHheCas13a, dLbfCas13a, dLbmCas13a,dLbnCas13a, dLbuCas13a, dLseCas13a, dLshCas13a, dLspCas13a,dLwa2cas13a, dLwaCas13a, dLweCas13a, dPauCas13b, dPbuCas13b,dPgiCas13b, dPguCas13b, dPin2Cas13b, dPin3Cas13b, dPinCas13b,dPprCas13a, dPsaCas13b, dPsmCas13b, dRaCas13d, dRanCas13b,dRcdCas13a, dRcrCas13a, dRcsCas13a, dRfxCas13d, or dUrCas13d.Additional Cas proteins are known in the art (e.g., Konermann etal., Cell, 2018, 173:665-676 e14, Yan et al., Mol Cell, 2018,7:327-339 e5; Cox, D. B. T., et al., Science, 2017, 358: 1019-1027;Abudayyeh et al., Nature, 2017, 550: 280-284, Gootenberg et al.,Science, 2017, 356: 438-442; and East-Seletsky et al., Mol Cell,2017, 66: 373-383 e3, which are herein incorporated byreference).

[0124] In one embodiment, the Cas protein comprises a sequence atleast 70%, at least 71%, at least 72%, at least 73%, at least 74%,at least 75%, at least 76%, at least 77%, at least 78%, at least79%, at least 80%, at least 81%, at least 82%, at least 83%, atleast 84%, at least 85%, at least 86%, at least 87%, at least 88%,at least 89%, at least 90%, at least 91%, at least 92%, at least93%, at least 94%, at least 95%, at least 96%, at least 97%, atleast 98%, or at least 99% identical to one of SEQ ID NOs:1-48. Inone embodiment, the Cas protein comprises a sequence at least 70%,at least 71%, at least 72%, at least 73%, at least 74%, at least75%, at least 76%, at least 77%, at least 78%, at least 79%, atleast 80%, at least 81%, at least 82%, at least 83%, at least 84%,at least 85%, at least 86%, at least 87%, at least 88%, at least89%, at least 90%, at least 91%, at least 92%, at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%,or at least 99% identical to one of SEQ ID NOs: 1-48. In oneembodiment, the Cas protein comprises a sequence of a variant ofone of SEQ ID NOs: 1-48, wherein the variant renders the Casprotein catalytically inactive. In one embodiment, the Cas proteincomprises a sequence of one of SEQ ID NOs: 1-46 having one or moreinsertions, deletions or substitutions, wherein the one or moreinsertions, deletions or substitutions renders the Cas proteincatalytically inactive. In one embodiment, the Cas proteincomprises a sequence of one of SEQ ID NOs:1-48. In one embodiment,the Cas protein comprises a sequence of one of SEQ IDNOs:47-48.

[0125] Fluorescent Protein

[0126] In one embodiment, the fluorescent protein is eGFP, mCherry,mCherry-MBNL1, sfGFP, sfGFP(1-10), sfGFP(1-10)-L-(11), 7xS11,sfCherry, S11, Emerald, Superfolder GFP, Azami Green, mWasabi,TagGFP, TurboGFP, AcGFP, ZsGreen, T-Sapphire, Blue FluorescentProteins, EBFP, EBFP2, Azurite, mTagBFP, Cyan Fluorescent Proteins,eCFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl, Midori-IshiCyan, TagCFP, mTFP1 (Teal), Yellow Fluorescent Proteins, EYFP,Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellow1, mBanana,Orange Fluorescent Proteins, Kusabira Orange, Kusabira Orange2,mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T,DsRed, DsRed2, DsRed-Express (T1), DsRed-Monomer, mTangerine, RedFluorescent Proteins, mRuby, mApple, mStrawberry, AsRed2, mRFP1,JRed, HcRed1, mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum, orAQ143.

[0127] In one embodiment, the fluorescent protein is eGFP, mCherry,sfGFP, sfGFP(1-10), sfGFP(1-10)-L-(11), sfCherry, or 7xS11. In oneembodiment, the fluorescent protein comprises an amino acidsequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to one of SEQ IDNOs:49-56. In one embodiment, the fluorescent protein comprises anamino acid sequence of one of SEQ ID NOs: 49-56.

[0128] Localization Signal

[0129] In some embodiments, the protein may contain a localizationsignal, such as an nuclear localization signal (NLS), nuclearexport signal (NES) or other localization signals to localize toorganelles, such as mitochondria, or to localize in the cytoplasm.In one embodiment, the localization signal localizes the protein tothe site in which a target RNA is located.

[0130] Nuclear Localization Signal

[0131] In one embodiment, the fusion protein comprises a NLS. Inone embodiment, the NLS is a retrotransposon NLS. In oneembodiment, the NLS is derived from Ty1, yeast GAL4, SKI3, L29 orhistone H2B proteins, polyoma virus large T protein, VP1 or VP2capsid protein, SV40 VP1 or VP2 capsid protein, Adenovirus E1 a orDBP protein, influenza virus NS1 protein, hepatitis vims coreantigen or the mammalian lamin, c-myc, max, c-myb, p53, c-erbA,jun, Tax, steroid receptor or Mx proteins, Nucleoplasmin (NPM2),Nucleophosmin (NPM1), or simian vims 40 ("SV40") T-antigen. In oneembodiment, the NLS is a Ty1 or Ty1-derived NLS, a Ty2 orTy2-derived NLS or a MAK11 or MAK11-derived NLS. In one embodiment,the Ty1 NLS comprises an amino acid sequence of SEQ ID NO:67. Inone embodiment, the Ty2 NLS comprises an amino acid sequence of SEQID NO:68. In one embodiment, the MAK11 NLS comprises an amino acidsequence of SEQ ID NO:69. In one embodiment, the NLS comprises asequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to one of SEQ ID NOs:67-74 and 427-1039. In one embodiment, the NLS comprises a sequenceof one of SEQ ID NOs: 67-74 and 427-1039.

[0132] In one embodiment, the NLS is a Ty1-like NLS. For example,in one embodiment, the Ty1-like NLS comprises KKRX motif. In oneembodiment, the Ty1-like NLS comprises KKRX motif at the N-terminalend. In one embodiment, the Ty1-like NLS comprises KKR motif. Inone embodiment, the Ty1-like NLS comprises KKR motif at theC-terminal end. In one embodiment, the Ty1-like NLS comprises aKKRX and a KKR motif. In one embodiment, the Ty1-like NLS comprisesa KKRX at the N-terminal end and a KKR motif at the C-terminal end.In one embodiment, the Ty1-like NLS comprises at least 20 aminoacids. In one embodiment, the Ty1-like NLS comprises between 20 and40 amino acids. In one embodiment, the Ty1-like NLS comprises asequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to one of SEQ ID NOs:427-1039. In one embodiment, the NLS comprises a sequence of one ofSEQ ID NOs: 427-1039, wherein the sequence comprises one or more,two or more, three or more, four or more, five or more, six ormore, seven or more, eight or more, nine or more, or ten or more,insertions, deletions or substitutions. In one embodiment, theTy1-like NLS comprises a sequence of one of SEQ ID NOs:427-1039.

[0133] In one embodiment, the NLS comprises two copies of the sameNLS. For example, in one embodiment, the NLS comprises a multimerof a first Ty1-derived NLS and a second Ty1-derived NLS.

[0134] Nuclear Export Signal

[0135] In one embodiment, the fusion protein comprises a NuclearExport Signal (NES). In one embodiment, the NES is attached to theN-terminal end of the Cas protein. In one embodiment, the NESlocalizes the fusion protein to the cytoplasm for targetingcytoplasmic RNA. In one embodiment, the NES comprises an amino acidsequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to SEQ ID NO:75 or 76.In one embodiment, the NES comprises an amino acid sequence of SEQID NO: 75 or 76.

[0136] Organelle Localization Signal

[0137] In one embodiment, the fusion protein comprises alocalization signal that localizes the fusion protein to anorganelle. In one embodiment, the localization signal localizes theprotein to the nucleolus, ribosome, vesicle, rough endoplasmicreticulum, Golgi apparatus, cytoskeleton, smooth endoplasmicreticulum, mitochondria, vacuole, cytosol, lysosome, or centriole.A number of localization signals are known in the art.

[0138] In one embodiment, the fusion protein comprises alocalization signal that localizes the fusion protein to anorganelle or extracellularly. In one embodiment, the localizationsignal localizes the protein to the nucleolus, ribosome, vesicle,rough endoplasmic reticulum, Golgi apparatus, cytoskeleton, smoothendoplasmic reticulum, mitochondria, vacuole, cytosol, lysosome, orcentriole.

[0139] A number of localization signals are known in the art.Exemplary localization signals include, but are not limited to1.times. mitochondrial targeting sequence, 4.times. mitochondrialtargeting sequence, secretory signal sequence (IL-2),myristylation, Calsequestrin leader, KDEL retention and peroxisometargeting sequence.

[0140] In one embodiment, the localization signal comprisessequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to SEQ ID NO:77-83. Inone embodiment, the localization signal comprises sequence of SEQID NO: 77-83.

[0141] Linker

[0142] In one embodiment, the protein comprises a linker peptide.In one embodiment, the linker peptide links the Cas protein andfluorescent protein. In one embodiment, the linker peptide isconnected to the C-terminal end of the Cas protein and to theN-terminal end of the fluorescent protein. In one embodiment, thelinker is connected to the N-terminal end of the Cas protein and tothe C-terminal end of the fluorescent protein.

[0143] In one embodiment, linker peptide comprises an amino acidsequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to one of SEQ IDNOs:57-65. In one embodiment, linker peptide comprises an aminoacid sequence of one of SEQ ID NOs: 57-65.

[0144] Purification and/or Detection Tag

[0145] In some embodiments, the protein may contain a purificationand/or detection tag. In one embodiment, the tag is on theN-terminal end of the protein. In one embodiment, the tag is a3.times.FLAG tag. In one embodiment, the tag comprises an aminoacid sequence at least 70%, at least 71%, at least 72%, at least73%, at least 74%, at least 75%, at least 76%, at least 77%, atleast 78%, at least 79%, at least 80%, at least 81%, at least 82%,at least 83%, at least 84%, at least 85%, at least 86%, at least87%, at least 88%, at least 89%, at least 90%, at least 91%, atleast 92%, at least 93%, at least 94%, at least 95%, at least 96%,at least 97%, at least 98%, or at least 99% identical to SEQ IDNO:66. In one embodiment, the tag comprises an amino acid sequenceof SEQ ID NO:66.

[0146] HilightR Fusion Proteins

[0147] In one embodiment, the fusion protein combines thevisualization capability of the fluorescent protein and theprogrammable DNA targeting capability of catalytically dead Cas.Thus, in one embodiment, the fusion protein of the disclosureprovide for visualization of In one embodiment, the fusion proteincomprises an amino acid sequence 70%, at least 71%, at least 72%,at least 73%, at least 74%, at least 75%, at least 76%, at least77%, at least 78%, at least 79%, at least 80%, at least 81%, atleast 82%, at least 83%, at least 84%, at least 85%, at least 86%,at least 87%, at least 88%, at least 89%, at least 90%, at least91%, at least 92%, at least 93%, at least 94%, at least 95%, atleast 96%, at least 97%, at least 98%, or at least 99% identical toone of SEQ ID NOs:84-149. In one embodiment, the fusion proteincomprises an amino acid sequence of one of SEQ ID NOs: 84-149.

Proteins, Peptides and Fusion Proteins

[0148] The proteins of the present disclosure may be made usingchemical methods. For example, protein can be synthesized by solidphase techniques (Roberge J Y et al (1995) Science 269: 202-204),cleaved from the resin, and purified by preparativehigh-performance liquid chromatography. Automated synthesis may beachieved, for example, using the ABI 431 A Peptide Synthesizer(Perkin Elmer) in accordance with the instructions provided by themanufacturer.

[0149] The proteins of the present disclosure may be made usingrecombinant protein expression. The recombinant expression vectorsof the disclosure comprise a nucleic acid of the invention in aform suitable for expression of the nucleic acid in a host cell,which means that the recombinant expression vectors include one ormore regulatory sequences, selected on the basis of the host cellsto be used for expression, that is operatively-linked to thenucleic acid sequence to be expressed. Within a recombinantexpression vector, "operably-linked" is intended to mean that thenucleotide sequence of interest is linked to the regulatorysequences in a manner that allows for expression of the nucleotidesequence (e.g., in an in vitro transcription/translation system orin a host cell when the vector is introduced into the hostcell).

[0150] The term "regulatory sequence" is intended to includepromoters, enhancers and other expression control elements (e.g.,polyadenylation signals). Such regulatory sequences are described,for example, in Goeddel, Gene Expression Technology: Methods inEnzymology 185, Academic Press, San Diego, Calif. (1990).Regulatory sequences include those that direct constitutiveexpression of a nucleotide sequence in many types of host cell andthose that direct expression of the nucleotide sequence only incertain host cells (e.g., tissue-specific regulatory sequences). Itwill be appreciated by those skilled in the art that the design ofthe expression vector can depend on such factors as the choice ofthe host cell to be transformed, the level of expression of proteindesired, etc. The expression vectors of the invention can beintroduced into host cells to thereby produce proteins or peptides,including fusion proteins or peptides, encoded by nucleic acids asdescribed herein.

[0151] The recombinant expression vectors of the invention can bedesigned for production of variant proteins in prokaryotic oreukaryotic cells. For example, proteins of the invention can beexpressed in bacterial cells such as Escherichia coli, insect cells(using baculovirus expression vectors) yeast cells or mammaliancells. Suitable host cells are discussed further in Goeddel, GeneExpression Technology: Methods in Enzymology 185, Academic Press,San Diego, Calif. (1990). Alternatively, the recombinant expressionvector can be transcribed and translated in vitro, for exampleusing T7 promoter regulatory sequences and T7 polymerase.

[0152] Expression of proteins in prokaryotes is most often carriedout in Escherichia coli with vectors containing constitutive orinducible promoters directing the expression of either fusion ornon-fusion proteins. Fusion vectors add a number of amino acids toa protein encoded therein, to the amino or C terminus of therecombinant protein. Such fusion vectors typically serve threepurposes: (i) to increase expression of recombinant protein; (ii)to increase the solubility of the recombinant protein; and (iii) toaid in the purification of the recombinant protein by acting as aligand in affinity purification. Often, in fusion expressionvectors, a proteolytic cleavage site is introduced at the junctionof the fusion moiety and the recombinant protein to enableseparation of the recombinant protein from the fusion moietysubsequent to purification of the fusion protein. Such enzymes, andtheir cognate recognition sequences, include Factor Xa, thrombin,PreScission, TEV and enterokinase. Typical fusion expressionvectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson,1988. Gene 67: 31-40), pMAL (New England Biolabs, Beverly, Mass.)and pRITS (Pharmacia, Piscataway, N.J.) that fuse glutathioneS-transferase (GST), maltose E binding protein, or protein A,respectively, to the target recombinant protein.

[0153] Examples of suitable inducible non-fusion E. coli expressionvectors include pTrc (Amrann et al., (1988) Gene 69:301-315) andpET 11d (Studier et al., Gene Expression Technology: Methods inEnzymology 185, Academic Press, San Diego, Calif. (1990)60-89)--not accurate, pET11a-d have N terminal T7 tag.

[0154] One strategy to maximize recombinant protein expression inE. coli is to express the protein in a host bacterium with animpaired capacity to proteolytically cleave the recombinantprotein. See, e.g., Gottesman, Gene Expression Technology: Methodsin Enzymology 185, Academic Press, San Diego, Calif. (1990)119-128. Another strategy is to alter the nucleic acid sequence ofthe nucleic acid to be inserted into an expression vector so thatthe individual codons for each amino acid are those preferentiallyutilized in E. coli (see, e.g., Wada, et al., 1992. Nucl. AcidsRes. 20: 2111-2118). Such alteration of nucleic acid sequences ofthe invention can be carried out by standard DNA synthesistechniques. Another strategy to solve codon bias is by usingBL21-codon plus bacterial strains (Invitrogen) or Rosetta bacterialstrain (Novagen), these strains contain extra copies of rare E.coli tRNA genes.

[0155] In another embodiment, the expression vector encoding forthe protein of the disclosure is a yeast expression vector.Examples of vectors for expression in yeast Saccharomycescerevisiae include pYepSec1 (Baldari, et al., 1987. EMBO J. 6:229-234), pMFa (Kurjan and Herskowitz, 1982. Cell 30: 933-943),pJRY88 (Schultz et al., 1987. Gene 54: 113-123), pYES2 (InvitrogenCorporation, San Diego, Calif.), and picZ (InVitrogen Corp, SanDiego, Calif.).

[0156] Alternatively, polypeptides of the present invention can beproduced in insect cells using baculovirus expression vectors.Baculovirus vectors available for expression of proteins incultured insect cells (e.g., SF9 cells) include the pAc series(Smith, et al., 1983. Mol. Cell. Biol. 3: 2156-2165) and the pVLseries (Lucklow and Summers, 1989. Virology 170: 31-39).

[0157] In yet another embodiment, a nucleic acid of the disclosureis expressed in mammalian cells using a mammalian expressionvector. Mammalian cell lines available in the art for expression ofa heterologous polypeptide include, but are not limited to, Chinesehamster ovary (CHO) cells, HeLa cells, baby hamster kidney cells,NSO mouse melanoma cells, YB2/0 rat myeloma cells, human embryonickidney cells, human embryonic retina cells and many others.Examples of mammalian expression vectors include pCDM8 (Seed, 1987.Nature 329: 840) and pMT2PC (Kaufman, et al., 1987. EMBO J. 6:187-195), pIRESpuro (Clontech), pUB6 (Invitrogen), pCEP4(Invitrogen) pREP4 (Invitrogen), pcDNA3 (Invitrogen). When used inmammalian cells, the expression vector's control functions areoften provided by viral regulatory elements. For example, commonlyused promoters are derived from polyoma, adenovirus 2,cytomegalovirus, Rous Sarcoma Virus, and simian virus 40. For othersuitable expression systems for both prokaryotic and eukaryoticcells see, e.g., Chapters 16 and 17 of Sambrook, et al., MolecularCloning: A Laboratory Manual. 2nd ed., Cold Spring HarborLaboratory, Cold Spring Harbor Laboratory Press, Cold SpringHarbor, N.Y., 1989.

[0158] In another embodiment, the recombinant mammalian expressionvector is capable of directing expression of the nucleic acidpreferentially in a particular cell type (e.g., tissue-specificregulatory elements are used to express the nucleic acid).Tissue-specific regulatory elements are known in the art.Non-limiting examples of suitable tissue-specific promoters includethe albumin promoter (liver-specific; Pinkert, et al., 1987. GenesDev. 1: 268-277), lymphoid-specific promoters (Calame and Eaton,1988. Adv. Immunol. 43: 235-275), in particular promoters of T cellreceptors (Winoto and Baltimore, 1989. EMBO J. 8: 729-733) andimmunoglobulins (Banerji, et al., 1983. Cell 33: 729-740; Queen andBaltimore, 1983. Cell 33: 741-748), neuron-specific promoters(e.g., the neurofilament promoter; Byrne and Ruddle, 1989. Proc.Natl. Acad. Sci. USA 86: 5473-5477), pancreas-specific promoters(Edlund, et al., 1985. Science 230: 912-916), and mammarygland-specific promoters (e.g., milk whey promoter; U.S. Pat. No.4,873,316 and European Application Publication No. 264,166).Developmentally-regulated promoters are also encompassed, e.g., themurinehox promoters (Kessel and Gruss, 1990. Science 249: 374-379)and the alpha-fetoprotein promoter (Campes and Tilghman, 1989.Genes Dev. 3: 537-546).

[0159] The invention should also be construed to include any formof a protein having substantial homology to a protein disclosedherein. In one embodiment, a protein which is "substantiallyhomologous" is about 50% homologous, about 70% homologous, about80% homologous, about 90% homologous, about 91% homologous, about92% homologous, about 93% homologous, about 94% homologous, about95% homologous, about 96% homologous, about 97% homologous, about98% homologous, or about 99% homologous to amino acid sequence of afusion-protein disclosed herein.

[0160] The protein may alternatively be made by recombinant meansor by cleavage from a longer polypeptide. The composition of aprotein may be confirmed by amino acid analysis or sequencing.

[0161] The variants of the protein according to the presentinvention may be (i) one in which one or more of the amino acidresidues are substituted with a conserved or non-conserved aminoacid residue and such substituted amino acid residue may or may notbe one encoded by the genetic code, (ii) one in which there are oneor more modified amino acid residues, e.g., residues that aremodified by the attachment of substituent groups, (iii) one inwhich the peptide is an alternative splice variant of the proteinof the present invention, (iv) fragments of the peptides and/or (v)one in which the protein is fused with another peptide, such as aleader or secretory sequence or a sequence which is employed forpurification (for example, His-tag) or for detection (for example,Sv5 epitope tag). The fragments include peptides generated viaproteolytic cleavage (including multi-site proteolysis) of anoriginal sequence. Variants may be post-translationally, orchemically modified. Such variants are deemed to be within thescope of those skilled in the art from the teaching herein.

[0162] As known in the art the "similarity" between two fusionproteins is determined by comparing the amino acid sequence and itsconserved amino acid substitutes of one polypeptide to a sequenceof a second polypeptide. Variants are defined to include peptidesequences different from the original sequence. In one embodiment,variants are different from the original sequence in less than 40%of residues per segment of interest different from the originalsequence in less than 25% of residues per segment of interest,different by less than 10% of residues per segment of interest, ordifferent from the original protein sequence in just a few residuesper segment of interest and at the same time sufficientlyhomologous to the original sequence to preserve the functionalityof the original sequence and/or the ability to stimulate thedifferentiation of a stem cell into the osteoblast lineage. Thepresent invention includes amino acid sequences that are at least60%, 65%, 70%, 72%, 74%, 76%, 78%, 80%, 90%, 91%, 92%, 93%, 94%,95%, 96%, 97%, 98%, or 99% similar or identical to the originalamino acid sequence. The degree of identity between two peptides isdetermined using computer algorithms and methods that are widelyknown for the persons skilled in the art. The identity between twoamino acid sequences may be determined by using the BLASTPalgorithm [BLAST Manual, Altschul, S., et al., NCBI NLM NIHBethesda, Md. 20894, Altschul, S., et al., J. Mol. Biol. 215:403-410 (1990)].

[0163] The protein of the disclosure can be post-translationallymodified. For example, post-translational modifications that fallwithin the scope of the present invention include signal peptidecleavage, glycosylation, acetylation, isoprenylation, proteolysis,myristoylation, protein folding and proteolytic processing, etc.Some modifications or processing events require introduction ofadditional biological machinery. For example, processing events,such as signal peptide cleavage and core glycosylation, areexamined by adding canine microsomal membranes or Xenopus eggextracts (U.S. Pat. No. 6,103,489) to a standard translationreaction.

[0164] The protein of the disclosure may include unnatural aminoacids formed by post-translational modification or by introducingunnatural amino acids during translation. A variety of approachesare available for introducing unnatural amino acids during proteintranslation.

[0165] A protein of the disclosure may be phosphorylated usingconventional methods such as the method described in Reedijk et al.(The EMBO Journal 11(4):1365, 1992).

[0166] Cyclic derivatives of the fusion proteins of the inventionare also part of the present invention. Cyclization may allow theprotein to assume a more favorable conformation for associationwith other molecules. Cyclization may be achieved using techniquesknown in the art. For example, disulfide bonds may be formedbetween two appropriately spaced components having free sulfhydrylgroups, or an amide bond may be formed between an amino group ofone component and a carboxyl group of another component.Cyclization may also be achieved using an azobenzene-containingamino acid as described by Ulysse, L., et al., J. Am. Chem. Soc.1995, 117, 8466-8467. The components that form the bonds may beside chains of amino acids, non-amino acid components or acombination of the two. In an embodiment of the invention, cyclicpeptides may comprise a beta-turn in the right position. Beta-turnsmay be introduced into the peptides of the invention by adding theamino acids Pro-Gly at the right position.

[0167] It may be desirable to produce a cyclic protein which ismore flexible than the cyclic peptides containing peptide bondlinkages as described above. A more flexible peptide may beprepared by introducing cysteines at the right and left position ofthe peptide and forming a disulfide bridge between the twocysteines. The two cysteines are arranged so as not to deform thebeta-sheet and turn. The peptide is more flexible as a result ofthe length of the disulfide linkage and the smaller number ofhydrogen bonds in the beta-sheet portion. The relative flexibilityof a cyclic peptide can be determined by molecular dynamicssimulations.

[0168] The invention also relates to peptides comprising a fusionprotein comprising Cas13 and a RNase protein, wherein the fusionprotein is itself fused to, or integrated into, a target protein,and/or a targeting domain capable of directing the chimeric proteinto a desired cellular component or cell type or tissue. Thechimeric proteins may also contain additional amino acid sequencesor domains. The chimeric proteins are recombinant in the sense thatthe various components are from different sources, and as such arenot found together in nature (i.e., are heterologous).

[0169] In one embodiment, the targeting domain can be a membranespanning domain, a membrane binding domain, or a sequence directingthe protein to associate with for example vesicles or with thenucleus. In one embodiment, the targeting domain can target apeptide to a particular cell type or tissue. For example, thetargeting domain can be a cell surface ligand or an antibodyagainst cell surface antigens of a target tissue. A targetingdomain may target the peptide of the invention to a cellularcomponent.

[0170] A peptide of the invention may be synthesized byconventional techniques. For example, the peptides or chimericproteins may be synthesized by chemical synthesis using solid phasepeptide synthesis. These methods employ either solid or solutionphase synthesis methods (see for example, J. M. Stewart, and J. D.Young, Solid Phase Peptide Synthesis, 2.sup.nd Ed., Pierce ChemicalCo., Rockford Ill. (1984) and G. Barany and R. B. Merrifield, ThePeptides: Analysis Synthesis, Biology editors E. Gross and J.Meienhofer Vol. 2 Academic Press, New York, 1980, pp. 3-254 forsolid phase synthesis techniques; and M Bodansky, Principles ofPeptide Synthesis, Springer-Verlag, Berlin 1984, and E. Gross andJ. Meienhofer, Eds., The Peptides: Analysis, Synthesis, Biology,suprs, Vol 1, for classical solution synthesis). By way of example,a peptide of the invention may be synthesized using 9-fluorenylmethoxycarbonyl (Fmoc) solid phase chemistry with directincorporation of phosphothreonine as theN-fluorenylmethoxy-carbonyl-O-benzyl-L-phosphothreoninederivative.

[0171] N-terminal or C-terminal fusion proteins comprising apeptide or chimeric protein of the invention conjugated with othermolecules may be prepared by fusing, through recombinanttechniques, the N-terminal or C-terminal of the peptide or chimericprotein, and the sequence of a selected protein or selectablemarker with a desired biological function. The resultant fusionproteins contain the protein fused to the selected protein ormarker protein as described herein. Examples of proteins which maybe used to prepare fusion proteins include immunoglobulins,glutathione-S-transferase (GST), hemagglutinin (HA), and truncatedmyc.

[0172] Peptides of the invention may be developed using abiological expression system. The use of these systems allows theproduction of large libraries of random peptide sequences and thescreening of these libraries for peptide sequences that bind toparticular proteins. Libraries may be produced by cloning syntheticDNA that encodes random peptide sequences into appropriateexpression vectors (see Christian et al 1992, J. Mol. Biol.227:711; Devlin et al, 1990 Science 249:404; Cwirla et al 1990,Proc. Natl. Acad, Sci. USA, 87:6378). Libraries may also beconstructed by concurrent synthesis of overlapping peptides (seeU.S. Pat. No. 4,708,871).

[0173] The peptides and chimeric proteins of the invention may beconverted into pharmaceutical salts by reacting with inorganicacids such as hydrochloric acid, sulfuric acid, hydrobromic acid,phosphoric acid, etc., or organic acids such as formic acid, aceticacid, propionic acid, glycolic acid, lactic acid, pyruvic acid,oxalic acid, succinic acid, malic acid, tartaric acid, citric acid,benzoic acid, salicylic acid, benzenesulfonic acid, andtoluenesulfonic acids.

Nucleic Acids

[0174] In one aspect, the present disclosure novel nucleic acidmolecules encoding editing proteins which provide targeted RNAcleavage. In some embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a localization signal. In oneembodiment, the localization signal localizes the protein to thesite in which a target RNA is located. In one embodiment, thenucleic acid molecule comprises a nucleic acid sequence encoding anuclear localization signal (NLS), to target RNA in the nucleus. Inone embodiment, the nucleic acid molecule comprises a nucleic acidsequence encoding a nuclear export signal (NES), to target RNA inthe cytoplasm. Other localization signals can be used (and whichare known in the art) to target RNA in organelles, such asmitochondria. In other embodiments, the nucleic acid molecule doesnot comprise a nucleic acid sequence encoding an localizationsignal, to target RNA in the cytoplasm. In one embodiment, thenucleic acid molecule comprises a nucleic acid sequence encoding apurification and/or detection tag.

[0175] The present disclosure also provides novel nucleic acidmolecules encoding fusions of an editing protein and a fluorescentprotein. In one embodiment, the fusion protein combines thevisualization capability of the fluorescent protein and theprogrammable DNA targeting capability of catalytically dead Cas. Inone embodiment, the nucleic acid molecule comprises a nucleic acidsequence encoding a nuclear localization signal, to target RNA inthe nucleus. In one embodiments, the nucleic acid moleculecomprises a nucleic acid sequence encoding an nuclear export signal(NES), to target RNA in the cytoplasm. In other embodiments, thenucleic acid molecule does not comprise a nucleic acid sequenceencoding localization signal, to target RNA in the cytoplasm. Otherlocalization signals can be used (and which are known in the art)to target RNA in organelles, such as mitochondria. In oneembodiment, the nucleic acid molecule comprises a nucleic acidsequence encoding a linker. In one embodiment, the linker links theCas protein and fluorescent protein. In one embodiment, the nucleicacid molecule comprises a nucleic acid sequence encoding apurification and/or detection tag.

[0176] The present disclosure also provides targeting nucleicacids, including CRISPR RNAs (crRNAs), for targeting the protein ofthe disclosure to a target RNA.

EraseR

[0177] In one aspect, the present disclosure novel nucleic acidmolecules encoding editing proteins which provide targeted RNAcleavage. In some embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a localization signal. In oneembodiment, the localization signal localizes the protein to thesite in which a target RNA is located. Thus, the disclosureprovides nucleic acid molecules encoding proteins for targeted RNAcleavage which are capable of localization.

[0178] Editing Protein

[0179] In one embodiment, the nucleic acid molecule comprises asequence nucleic acid encoding an editing protein. In oneembodiment, the editing protein includes, but is not limited to, aCRISPR-associated (Cas) protein, a zinc finger nuclease (ZFN)protein, and a protein having a DNA or RNA binding domain.

[0180] Non-limiting examples of Cas proteins include Cas1, Cas1B,Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2,Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2. Csm2, Csm3, Csm4, Csm5,Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14,Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4,SpCas9, StCas9, NmCas9, SaCas9, CjCas9, CjCas9, AsCpf1, LbCpf1,FnCpf1, VRER SpCas9, VQR SpCas9, xCas9 3.7, homologs thereof,orthologs thereof, or modified versions thereof. In someembodiments, the Cas protein has DNA or RNA cleavage activity. Insome embodiments, the Cas protein directs cleavage of one or bothstrands of a nucleic acid molecule at the location of a targetsequence, such as within the target sequence and/or within thecomplement of the target sequence. In some embodiments, the Casprotein directs cleavage of one or both strands within about 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or morebase pairs from the first or last nucleotide of a target sequence.In one embodiment, the Cas protein is Cas9, Cas13, or Cpf1. In oneembodiment, Cas protein is catalytically deficient (dCas).

[0181] In one embodiment, the Cas protein has RNA binding activity.In one embodiment, Cas protein is Cas13. In one embodiment, the Casprotein is PspCas13b, PspCas13b Truncation, AdmCas13d, AspCas13b,AspCas13c, BmaCas13a, BzoCas13b, CamCas13a, CcaCas13b, Cga2Cas13a,CgaCas13a, EbaCas13a, EreCas13a, EsCas13d, FbrCas13b, FnbCas13c,FndCas13c, FnfCas13c, FnsCas13c, FpeCas13c, FulCas13c, HheCas13a,LbfCas13a, LbmCas13a, LbnCas13a, LbuCas13a, LseCas13a, LshCas13a,LspCas13a, Lwa2cas13a, LwaCas13a, LweCas13a, PauCas13b, PbuCas13b,PgiCas13b, PguCas13b, Pin2Cas13b, Pin3Cas13b, PinCas13b, Pprcas13a,PsaCas13b, PsmCas13b, RaCas13d, RanCas13b, RcdCas13a, RcrCas13a,RcsCas13a, RfxCas13d, UrCas13d, dPspCas13b, PspCas13b_A133H,PspCas13b_A1058H, dPspCas13b truncation, dAdmCas13d, dAspCas13b,dAspCas13c, dBmaCas13a, dBzoCas13b, dCamCas13a, dCcaCas13b,dCga2Cas13a, dCgaCas13a, dEbaCas13a, dEreCas13a, dEsCas13d,dFbrCas13b, dFnbCas13c, dFndCas13c, dFnfCas13c, dFnsCas13c,dFpeCas13c, dFulCas13c, dHheCas13a, dLbfCas13a, dLbmCas13a,dLbnCas13a, dLbuCas13a, dLseCas13a, dLshCas13a, dLspCas13a,dLwa2cas13a, dLwaCas13a, dLweCas13a, dPauCas13b, dPbuCas13b,dPgiCas13b, dPguCas13b, dPin2Cas13b, dPin3Cas13b, dPinCas13b,dPprCas13a, dPsaCas13b, dPsmCas13b, dRaCas13d, dRanCas13b,dRcdCas13a, dRcrCas13a, dRcsCas13a, dRfxCas13d, or dUrCas13d.Additional Cas proteins are known in the art (e.g., Konermann etal., Cell, 2018, 173:665-676 e14, Yan et al., Mol Cell, 2018,7:327-339 e5; Cox, D. B. T., et al., Science, 2017, 358: 1019-1027;Abudayyeh et al., Nature, 2017, 550: 280-284, Gootenberg et al.,Science, 2017, 356: 438-442; and East-Seletsky et al., Mol Cell,2017, 66: 373-383 e3, which are herein incorporated byreference).

[0182] In one embodiment, the nucleic acid sequence encoding a Casprotein comprises a nucleic acid sequence encoding an amino acidsequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to one of SEQ ID NOs:1-48. In one embodiment, the nucleic acid sequence encoding a Casprotein comprises a nucleic acid sequence encoding an amino acidsequence of one of SEQ ID NOs:1-48. In one embodiment, the nucleicacid sequence encoding a Cas protein comprises a nucleic acidsequence encoding an amino acid sequence of one of SEQ IDNOs:1-46.

[0183] In one embodiment, the nucleic acid sequence encoding a Casprotein comprises a nucleic acid sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% identical to one of SEQ ID NOs: 188-191. In one embodiment, thenucleic acid sequence encoding a Cas protein comprises a nucleicacid sequence of one of SEQ ID NOs: 188-191. In one embodiment, thenucleic acid sequence encoding a Cas protein comprises a nucleicacid sequence of one of SEQ ID NOs:188-190.

[0184] Localization Signal

[0185] In some embodiments, the nucleic acid molecule comprises anucleic acid sequence encoding a localization signal, such as anuclear localization signal (NLS), nuclear export signal (NES) orother localization signals to localize to the cytoplasm or toorganelles, such as mitochondria. In one embodiment, thelocalization signal localizes the protein to the site in which thetarget RNA is located.

[0186] Nuclear Localization Signal

[0187] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a nuclear localization signal (NLS).In one embodiment, the NLS is a retrotransposon NLS. In oneembodiment, the NLS is derived from Ty1, yeast GAL4, SKI3, L29 orhistone H2B proteins, polyoma virus large T protein, VP1 or VP2capsid protein, SV40 VP1 or VP2 capsid protein, Adenovirus E1 a orDBP protein, influenza virus NS1 protein, hepatitis vims coreantigen or the mammalian lamin, c-myc, max, c-myb, p53, c-erbA,jun, Tax, steroid receptor or Mx proteins, Nucleoplasmin (NPM2),Nucleophosmin (NPM1), or simian vims 40 ("SV40") T-antigen.

[0188] In one embodiment, the NLS is a Ty1 or Ty1-derived NLS, aTy2 or Ty2-derived NLS or a MAK11 or MAK11-derived NLS. In oneembodiment, the Ty1 NLS comprises an amino acid sequence of SEQ IDNO:67. In one embodiment, the Ty2 NLS comprises an amino acidsequence of SEQ ID NO:68. In one embodiment, the MAK11 NLScomprises an amino acid sequence of SEQ ID NO:69. In oneembodiment, the nucleic acid sequence encoding a NLS comprises anucleic acid sequence encoding an amino acid sequence at least 70%,at least 71%, at least 72%, at least 73%, at least 74%, at least75%, at least 76%, at least 77%, at least 78%, at least 79%, atleast 80%, at least 81%, at least 82%, at least 83%, at least 84%,at least 85%, at least 86%, at least 87%, at least 88%, at least89%, at least 90%, at least 91%, at least 92%, at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%,or at least 99% identical to one of SEQ ID NOs: 67-74 and 427-1039.In one embodiment, the nucleic acid sequence encoding a NLScomprises a nucleic acid sequence encoding an amino acid sequenceof one of SEQ ID NOs: 67-74 and 427-1039.

[0189] In one embodiment, the NLS is a Ty1-like NLS. For example,in one embodiment, the Ty1-like NLS comprises KKRX motif. In oneembodiment, the Ty1-like NLS comprises KKRX motif at the N-terminalend. In one embodiment, the Ty1-like NLS comprises KKR motif. Inone embodiment, the Ty1-like NLS comprises KKR motif at theC-terminal end. In one embodiment, the Ty1-like NLS comprises aKKRX and a KKR motif. In one embodiment, the Ty1-like NLS comprisesa KKRX at the N-terminal end and a KKR motif at the C-terminal end.In one embodiment, the Ty1-like NLS comprises at least 20 aminoacids. In one embodiment, the Ty1-like NLS comprises between 20 and40 amino acids. In one embodiment, the nucleic acid sequenceencoding a Ty1-like NLS comprises a nucleic acid sequence encodingan amino acid sequence at least 70%, at least 71%, at least 72%, atleast 73%, at least 74%, at least 75%, at least 76%, at least 77%,at least 78%, at least 79%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, or at least 99% identical to oneof SEQ ID NOs: 427-1039. In one embodiment, the nucleic acidsequence encoding a Ty1-like NLS comprises a nucleic acid sequenceencoding an amino acid sequence of one of SEQ ID NOs: 427-1039,wherein the sequence comprises one or more, two or more, three ormore, four or more, five or more, six or more, seven or more, eightor more, nine or more, or ten or more, insertions, deletions orsubstitutions. In one embodiment, the nucleic acid sequenceencoding a Ty1-like NLS comprises a nucleic acid sequence encodingan amino acid sequence of one of SEQ ID NOs: 427-1039.

[0190] In one embodiment, the nucleic acid sequence encoding an NLSencodes two copies of the same NLS. For example, in one embodiment,the nucleic acid sequence encodes a multimer of a first Ty1-derivedNLS and a second Ty1-derived NLS.

[0191] In one embodiment, the nucleic acid sequence encoding a NLScomprises a nucleic acid sequence at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%identical to SEQ ID NO:201. In one embodiment, the nucleic acidsequence encoding a NLS comprises a nucleic acid sequence of SEQ IDNO: 201.

[0192] Nuclear Export Signal

[0193] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a Nuclear Export Signal (NES). Inone embodiment, the NES localizes the protein to the cytoplasm fortargeting cytoplasmic RNA. In one embodiment, the nucleic acidsequence encoding the NES comprises a sequence encoding an aminoacid sequence at least 70%, at least 71%, at least 72%, at least73%, at least 74%, at least 75%, at least 76%, at least 77%, atleast 78%, at least 79%, at least 80%, at least 81%, at least 82%,at least 83%, at least 84%, at least 85%, at least 86%, at least87%, at least 88%, at least 89%, at least 90%, at least 91%, atleast 92%, at least 93%, at least 94%, at least 95%, at least 96%,at least 97%, at least 98%, or at least 99% identical to SEQ IDNO:75 or 76. In one embodiment, the nucleic acid sequence encodingthe NES comprises a sequence encoding an amino acid sequence of SEQID NO: 75 or 76.

[0194] In one embodiment, the nucleic acid sequence encoding theNES comprises a sequence at least 70%, at least 71%, at least 72%,at least 73%, at least 74%, at least 75%, at least 76%, at least77%, at least 78%, at least 79%, at least 80%, at least 81%, atleast 82%, at least 83%, at least 84%, at least 85%, at least 86%,at least 87%, at least 88%, at least 89%, at least 90%, at least91%, at least 92%, at least 93%, at least 94%, at least 95%, atleast 96%, at least 97%, at least 98%, or at least 99% identical toSEQ ID NO: 202 or 203. In one embodiment, the nucleic acid sequenceencoding the NES comprises a sequence of SEQ ID NO: 202 or 203.

[0195] Organelle Localization Signal

[0196] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a localization signal that localizesthe protein to an organelle or extracellularly. In one embodiment,the localization signal localizes the protein to the nucleolus,ribosome, vesicle, rough endoplasmic reticulum, Golgi apparatus,cytoskeleton, smooth endoplasmic reticulum, mitochondria, vacuole,cytosol, lysosome, or centriole. A number of localization signalsare known in the art.

[0197] Exemplary localization signals include, but are not limitedto 1.times. mitochondrial targeting sequence, 4.times.mitochondrial targeting sequence, secretory signal sequence (IL-2),myristylation, Calsequestrin leader, KDEL retention and peroxisometargeting sequence.

[0198] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a localization signal. In oneembodiment, the localization signal localizes the protein to anorganelle or extracellularly. In one embodiment, the nucleic acidsequence encoding the localization signal comprises a sequenceencoding an amino acid sequence at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%identical to one of SEQ ID NO:77-83. In one embodiment, the nucleicacid sequence encoding the localization signal comprises a sequenceencoding an amino acid sequence of one of SEQ ID NO: 77-83.

[0199] In one embodiment, the nucleic acid sequence encoding thelocalization signal comprises a sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% identical to one of SEQ ID NO:204-210. In one embodiment, thenucleic acid sequence encoding the localization signal comprises asequence of one of SEQ ID NO: 204-210.

[0200] Purification and/or Detection Tag

[0201] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a purification and/or detection tag.In one embodiment, the tag is on the N-terminal end of the protein.In one embodiment, the tag is a 3.times.FLAG tag. In oneembodiment, nucleic acid sequence encoding a purification and/ordetection tag encodes an amino acid sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% identical to SEQ ID NO:66. In one embodiment, nucleic acidsequence encoding a purification and/or detection tag encodes anamino acid sequence of SEQ ID NO:66.

[0202] In one embodiment, nucleic acid sequence encoding apurification and/or detection tag comprises sequence at least 70%,at least 71%, at least 72%, at least 73%, at least 74%, at least75%, at least 76%, at least 77%, at least 78%, at least 79%, atleast 80%, at least 81%, at least 82%, at least 83%, at least 84%,at least 85%, at least 86%, at least 87%, at least 88%, at least89%, at least 90%, at least 91%, at least 92%, at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%,or at least 99% identical to SEQ ID NO:194. In one embodiment,nucleic acid sequence encoding a purification and/or detection tagcomprises a sequence of SEQ ID NO: 200.

[0203] EraseR Proteins

[0204] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a protein of the disclosure, whichis effectively delivered to the nucleus, an organelle, thecytoplasm or extracellularly and allow for targeted RNA cleavage.In one embodiment, the nucleic acid sequence encoding a proteinencodes an amino acid sequence at least 70%, at least 71%, at least72%, at least 73%, at least 74%, at least 75%, at least 76%, atleast 77%, at least 78%, at least 79%, at least 80%, at least 81%,at least 82%, at least 83%, at least 84%, at least 85%, at least86%, at least 87%, at least 88%, at least 89%, at least 90%, atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%,at least 96%, at least 97%, at least 98%, or at least 99% identicalto one of SEQ ID NOs:150-171. In one embodiment, the nucleic acidsequence encoding a protein encodes an amino acid sequence of oneof SEQ ID NOs: 150-171.

[0205] In one embodiment, the nucleic acid sequence encoding aprotein comprises a sequence at least 70%, at least 71%, at least72%, at least 73%, at least 74%, at least 75%, at least 76%, atleast 77%, at least 78%, at least 79%, at least 80%, at least 81%,at least 82%, at least 83%, at least 84%, at least 85%, at least86%, at least 87%, at least 88%, at least 89%, at least 90%, atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%,at least 96%, at least 97%, at least 98%, or at least 99% identicalto one of SEQ ID NOs: 271-290. In one embodiment, the nucleic acidsequence encoding a protein comprises a sequence of one of SEQ IDNOs: 271-290.

HiLightR

[0206] The present disclosure also provides novel nucleic acidmolecules encoding fusions of an editing protein and a fluorescentprotein. In one embodiment, the fusion protein combines thevisualization capability of the fluorescent protein and theprogrammable nucleic acid targeting capability of catalyticallydead Cas. In some embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a localization signal. In oneembodiment, the localization signal localizes the protein to thesite in which a target RNA is located. Thus, the disclosureprovides nucleic acid molecules encoding proteins for visualizationof RNA which are capable of localization.

[0207] Editing Protein

[0208] In one embodiment, the nucleic acid molecule comprises asequence nucleic acid encoding an editing protein. In oneembodiment, the editing protein includes, but is not limited to, aCRISPR-associated (Cas) protein, a zinc finger nuclease (ZFN)protein, and a protein having a DNA or RNA binding domain.

[0209] Non-limiting examples of Cas proteins include Cas1, Cas1B,Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2,Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2. Csm2, Csm3, Csm4, Csm5,Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14,Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4,SpCas9, StCas9, NmCas9, SaCas9, CjCas9, CjCas9, AsCpf1, LbCpf1,FnCpf1, VRER SpCas9, VQR SpCas9, xCas9 3.7, homologs thereof,orthologs thereof, or modified versions thereof. In someembodiments, the Cas protein has DNA or RNA cleavage activity. Insome embodiments, the Cas protein directs cleavage of one or bothstrands of a nucleic acid molecule at the location of a targetsequence, such as within the target sequence and/or within thecomplement of the target sequence. In some embodiments, the Casprotein directs cleavage of one or both strands within about 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or morebase pairs from the first or last nucleotide of a target sequence.In one embodiment, the Cas protein is Cas9, Cas13, or Cpf1. In oneembodiment, Cas protein is catalytically deficient (dCas).

[0210] In one embodiment, the Cas protein has RNA binding activity.In one embodiment, Cas protein is Cas13. In one embodiment, the Casprotein is PspCas13b, PspCas13b Truncation, AdmCas13d, AspCas13b,AspCas13c, BmaCas13a, BzoCas13b, CamCas13a, CcaCas13b, Cga2Cas13a,CgaCas13a, EbaCas13a, EreCas13a, EsCas13d, FbrCas13b, FnbCas13c,FndCas13c, FnfCas13c, FnsCas13c, FpeCas13c, FulCas13c, HheCas13a,LbfCas13a, LbmCas13a, LbnCas13a, LbuCas13a, LseCas13a, LshCas13a,LspCas13a, Lwa2cas13a, LwaCas13a, LweCas13a, PauCas13b, PbuCas13b,PgiCas13b, PguCas13b, Pin2Cas13b, Pin3Cas13b, PinCas13b, Pprcas13a,PsaCas13b, PsmCas13b, RaCas13d, RanCas13b, RcdCas13a, RcrCas13a,RcsCas13a, RfxCas13d, UrCas13d, dPspCas13b, PspCas13b_A133H,PspCas13b_A1058H, dPspCas13b truncation, dAdmCas13d, dAspCas13b,dAspCas13c, dBmaCas13a, dBzoCas13b, dCamCas13a, dCcaCas13b,dCga2Cas13a, dCgaCas13a, dEbaCas13a, dEreCas13a, dEsCas13d,dFbrCas13b, dFnbCas13c, dFndCas13c, dFnfCas13c, dFnsCas13c,dFpeCas13c, dFulCas13c, dHheCas13a, dLbfCas13a, dLbmCas13a,dLbnCas13a, dLbuCas13a, dLseCas13a, dLshCas13a, dLspCas13a,dLwa2cas13a, dLwaCas13a, dLweCas13a, dPauCas13b, dPbuCas13b,dPgiCas13b, dPguCas13b, dPin2Cas13b, dPin3Cas13b, dPinCas13b,dPprCas13a, dPsaCas13b, dPsmCas13b, dRaCas13d, dRanCas13b,dRcdCas13a, dRcrCas13a, dRcsCas13a, dRfxCas13d, or dUrCas13d.Additional Cas proteins are known in the art (e.g., Konermann etal., Cell, 2018, 173:665-676 e14, Yan et al., Mol Cell, 2018,7:327-339 e5; Cox, D. B. T., et al., Science, 2017, 358: 1019-1027;Abudayyeh et al., Nature, 2017, 550: 280-284, Gootenberg et al.,Science, 2017, 356: 438-442; and East-Seletsky et al., Mol Cell,2017, 66: 373-383 e3, which are herein incorporated byreference).

[0211] In one embodiment, the nucleic acid sequence encoding a Casprotein comprises a nucleic acid sequence encoding an amino acidsequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to one of SEQ ID NOs:1-48. In one embodiment, the nucleic acid sequence encoding a Casprotein comprises a nucleic acid sequence encoding an amino acidsequence of a variant of one of SEQ ID NOs:1-48, wherein thevariant renders the Cas protein catalytically inactive. In oneembodiment, the nucleic acid sequence encoding a Cas proteincomprises a nucleic acid sequence encoding an amino acid sequenceof one of SEQ ID NOs:1-46 having one or more insertions, deletionsor substitutions, wherein the one or more insertions, deletions orsubstitutions renders the Cas protein catalytically inactive. Inone embodiment, the nucleic acid sequence encoding a Cas proteincomprises a nucleic acid sequence encoding an amino acid sequenceof one of SEQ ID NOs:1-48. In one embodiment, the nucleic acidsequence encoding a Cas protein comprises a nucleic acid sequenceencoding an amino acid sequence of one of SEQ ID NOs:47-48.

[0212] In one embodiment, the nucleic acid sequence encoding a Casprotein comprises a nucleic acid sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% identical to one of SEQ ID NOs: 182-185. In one embodiment, thenucleic acid sequence encoding a Cas protein comprises a of avariant of one of SEQ ID NOs: 188-190, wherein the variant rendersthe encoded Cas protein catalytically inactive. In one embodiment,the nucleic acid sequence encoding a Cas protein comprises anucleic acid sequence of one of SEQ ID NOs: 188-191. In oneembodiment, the nucleic acid sequence encoding a Cas proteincomprises a nucleic acid sequence of one of SEQ ID NOs:190-191.

[0213] Fluorescent Protein

[0214] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a fluorescent protein. In oneembodiment, the fluorescent protein is eGFP, mCherry,mCherry-MBNL1, sfGFP, sfGFP(1-10), sfGFP(1-10)-L-(11), sfCherry7xS11, S11, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP,TurboGFP, AcGFP, ZsGreen, T-Sapphire, Blue Fluorescent Proteins,EBFP, EBFP2, Azurite, mTagBFP, Cyan Fluorescent Proteins, eCFP,mECFP, Cerulean, mTurquoise, CyPet, AmCyanl, Midori-Ishi Cyan,TagCFP, mTFP1 (Teal), Yellow Fluorescent Proteins, EYFP, Topaz,Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellow1, mBanana, OrangeFluorescent Proteins, Kusabira Orange, Kusabira Orange2, mOrange,mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2,DsRed-Express (T1), DsRed-Monomer, mTangerine, Red FluorescentProteins, mRuby, mApple, mStrawberry, AsRed2, mRFP1, JRed, HcRed1,mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum, or AQ143.

[0215] In one embodiment, the fluorescent protein is eGFP, mCherry,sfGFP, sfGFP(1-10), sfGFP(1-10)-L-(11), sfCherry or 7xS11. In oneembodiment, nucleic acid sequence encoding a fluorescent proteincomprises a sequence encoding an amino acid sequence at least 70%,at least 71%, at least 72%, at least 73%, at least 74%, at least75%, at least 76%, at least 77%, at least 78%, at least 79%, atleast 80%, at least 81%, at least 82%, at least 83%, at least 84%,at least 85%, at least 86%, at least 87%, at least 88%, at least89%, at least 90%, at least 91%, at least 92%, at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%,or at least 99% identical to one of SEQ ID NOs:49-56. In oneembodiment, nucleic acid sequence encoding a fluorescent proteincomprises a sequence encoding an amino acid sequence of one of SEQID NOs: 49-56.

[0216] In one embodiment, nucleic acid sequence encoding afluorescent protein comprises a nucleic acid sequence at least 70%,at least 71%, at least 72%, at least 73%, at least 74%, at least75%, at least 76%, at least 77%, at least 78%, at least 79%, atleast 80%, at least 81%, at least 82%, at least 83%, at least 84%,at least 85%, at least 86%, at least 87%, at least 88%, at least89%, at least 90%, at least 91%, at least 92%, at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%,or at least 99% identical to one of SEQ ID NOs:192-195. In oneembodiment, nucleic acid sequence encoding a fluorescent proteincomprises a nucleic acid sequence of one of SEQ ID NOs:192-195.

[0217] Localization Signal

[0218] In some embodiments, the nucleic acid molecule comprises anucleic acid sequence encoding a localization signal, such as anuclear localization signal (NLS), nuclear export signal (NES) orother localization signals to localize to the cytoplasm or toorganelles, such as mitochondria. In one embodiment, thelocalization signal localizes the fusion protein to the site inwhich the target RNA is located.

[0219] Nuclear Localization Signal

[0220] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a nuclear localization signal (NLS).In one embodiment, the NLS is a retrotransposon NLS. In oneembodiment, the NLS is derived from Ty1, yeast GAL4, SKI3, L29 orhistone H2B proteins, polyoma virus large T protein, VP1 or VP2capsid protein, SV40 VP1 or VP2 capsid protein, Adenovirus E1 a orDBP protein, influenza virus NS1 protein, hepatitis vims coreantigen or the mammalian lamin, c-myc, max, c-myb, p53, c-erbA,jun, Tax, steroid receptor or Mx proteins, Nucleoplasmin (NPM2),Nucleophosmin (NPM1), or simian vims 40 ("SV40") T-antigen.

[0221] In one embodiment, the NLS is a Ty1 or Ty1-derived NLS, aTy2 or Ty2-derived NLS or a MAK11 or MAK11-derived NLS. In oneembodiment, the Ty1 NLS comprises an amino acid sequence of SEQ IDNO:67. In one embodiment, the Ty2 NLS comprises an amino acidsequence of SEQ ID NO:68. In one embodiment, the MAK11 NLScomprises an amino acid sequence of SEQ ID NO:69. In oneembodiment, the nucleic acid sequence encoding a NLS comprises anucleic acid sequence encoding an amino acid sequence at least 70%,at least 71%, at least 72%, at least 73%, at least 74%, at least75%, at least 76%, at least 77%, at least 78%, at least 79%, atleast 80%, at least 81%, at least 82%, at least 83%, at least 84%,at least 85%, at least 86%, at least 87%, at least 88%, at least89%, at least 90%, at least 91%, at least 92%, at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%,or at least 99% identical to one of SEQ ID NOs: 67-74 and 427-1039.In one embodiment, the nucleic acid sequence encoding a NLScomprises a nucleic acid sequence encoding an amino acid sequenceof one of SEQ ID NOs: 67-74 and 427-1039.

[0222] In one embodiment, the NLS is a Ty1-like NLS. For example,in one embodiment, the Ty1-like NLS comprises KKRX motif. In oneembodiment, the Ty1-like NLS comprises KKRX motif at the N-terminalend. In one embodiment, the Ty1-like NLS comprises KKR motif. Inone embodiment, the Ty1-like NLS comprises KKR motif at theC-terminal end. In one embodiment, the Ty1-like NLS comprises aKKRX and a KKR motif. In one embodiment, the Ty1-like NLS comprisesa KKRX at the N-terminal end and a KKR motif at the C-terminal end.In one embodiment, the Ty1-like NLS comprises at least 20 aminoacids. In one embodiment, the Ty1-like NLS comprises between 20 and40 amino acids. In one embodiment, the nucleic acid sequenceencoding a Ty1-like NLS comprises a nucleic acid sequence encodingan amino acid sequence at least 70%, at least 71%, at least 72%, atleast 73%, at least 74%, at least 75%, at least 76%, at least 77%,at least 78%, at least 79%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, or at least 99% identical to oneof SEQ ID NOs: 427-1039. In one embodiment, the nucleic acidsequence encoding a Ty1-like NLS comprises a nucleic acid sequenceencoding an amino acid sequence of one of SEQ ID NOs: 427-1039,wherein the sequence comprises one or more, two or more, three ormore, four or more, five or more, six or more, seven or more, eightor more, nine or more, or ten or more, insertions, deletions orsubstitutions. In one embodiment, the nucleic acid sequenceencoding a Ty1-like NLS comprises a nucleic acid sequence encodingan amino acid sequence of one of SEQ ID NOs: 427-1039.

[0223] In one embodiment, the nucleic acid sequence encoding an NLSencodes two copies of the same NLS. For example, in one embodiment,the nucleic acid sequence encodes a multimer of a first Ty1-derivedNLS and a second Ty1-derived NLS.

[0224] In one embodiment, the nucleic acid sequence encoding a NLScomprises a nucleic acid sequence at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%identical to SEQ ID NO:201. In one embodiment, the nucleic acidsequence encoding a NLS comprises a nucleic acid sequence of SEQ IDNO: 201.

[0225] Nuclear Export Signal

[0226] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a Nuclear Export Signal (NES). Inone embodiment, the NES localizes the fusion protein to thecytoplasm for targeting cytoplasmic RNA. In one embodiment, thenucleic acid sequence encoding the NES comprises a sequenceencoding an amino acid sequence at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%identical to SEQ ID NO:802 or 803. In one embodiment, the nucleicacid sequence encoding the NES comprises a sequence encoding anamino acid sequence of SEQ ID NO: 75 or 76.

[0227] In one embodiment, the nucleic acid sequence encoding theNES comprises a sequence at least 70%, at least 71%, at least 72%,at least 73%, at least 74%, at least 75%, at least 76%, at least77%, at least 78%, at least 79%, at least 80%, at least 81%, atleast 82%, at least 83%, at least 84%, at least 85%, at least 86%,at least 87%, at least 88%, at least 89%, at least 90%, at least91%, at least 92%, at least 93%, at least 94%, at least 95%, atleast 96%, at least 97%, at least 98%, or at least 99% identical toSEQ ID NO: 202 or 203. In one embodiment, the nucleic acid sequenceencoding the NES comprises a sequence of SEQ ID NO: 202 or 203.

[0228] Organelle Localization Signal

[0229] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a localization signal that localizesthe fusion protein to an organelle or extracellularly. In oneembodiment, the localization signal localizes the protein to thenucleolus, ribosome, vesicle, rough endoplasmic reticulum, Golgiapparatus, cytoskeleton, smooth endoplasmic reticulum,mitochondria, vacuole, cytosol, lysosome, or centriole. A number oflocalization signals are known in the art.

[0230] Exemplary localization signals include, but are not limitedto 1.times. mitochondrial targeting sequence, 4.times.mitochondrial targeting sequence, secretory signal sequence (IL-2),myristylation, Calsequestrin leader, KDEL retention and peroxisometargeting sequence.

[0231] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a localization signal. In oneembodiment, the localization signal localizes the fusion protein toan organelle or extracellularly. In one embodiment, the nucleicacid sequence encoding the localization signal comprises a sequenceencoding an amino acid sequence at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%identical to SEQ ID NO:77-83. In one embodiment, the nucleic acidsequence encoding the localization signal comprises a sequenceencoding an amino acid sequence of SEQ ID NO: 77-83.

[0232] In one embodiment, the nucleic acid sequence encoding thelocalization signal comprises a sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% identical to SEQ ID NO:204-210. In one embodiment, the nucleicacid sequence encoding the localization signal comprises a sequenceof SEQ ID NO: 204-210.

[0233] Purification and/or Detection Tag

[0234] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a purification and/or detection tag.In one embodiment, the tag is on the N-terminal end of the fusionprotein. In one embodiment, the tag is a 3.times.FLAG tag. In oneembodiment, nucleic acid sequence encoding a purification and/ordetection tag encodes an amino acid sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% identical to SEQ ID NO:66. In one embodiment, nucleic acidsequence encoding a purification and/or detection tag encodes anamino acid sequence of SEQ ID NO:66.

[0235] In one embodiment, nucleic acid sequence encoding apurification and/or detection tag comprises sequence at least 70%,at least 71%, at least 72%, at least 73%, at least 74%, at least75%, at least 76%, at least 77%, at least 78%, at least 79%, atleast 80%, at least 81%, at least 82%, at least 83%, at least 84%,at least 85%, at least 86%, at least 87%, at least 88%, at least89%, at least 90%, at least 91%, at least 92%, at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%,or at least 99% identical to SEQ ID NO: 200. In one embodiment,nucleic acid sequence encoding a purification and/or detection tagcomprises a sequence of SEQ ID NO: 200.

[0236] Linker

[0237] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a linker peptide. In one embodiment,the linker links the Cas protein and fluorescent protein. In oneembodiment, the linker is connected to the C-terminal end of theCas protein and to the N-terminal end of the fluorescent protein.In one embodiment, the linker is connected to the N-terminal end ofthe Cas protein and to the C-terminal end of the fluorescentprotein.

[0238] In one embodiment, the nucleic acid sequence encoding alinker peptide encodes an amino acid sequence at least 70%, atleast 71%, at least 72%, at least 73%, at least 74%, at least 75%,at least 76%, at least 77%, at least 78%, at least 79%, at least80%, at least 81%, at least 82%, at least 83%, at least 84%, atleast 85%, at least 86%, at least 87%, at least 88%, at least 89%,at least 90%, at least 91%, at least 92%, at least 93%, at least94%, at least 95%, at least 96%, at least 97%, at least 98%, or atleast 99% identical to one of SEQ ID NOs:57-65. In one embodiment,the nucleic acid sequence encoding a linker peptide encodes anamino acid sequence of one of SEQ ID NOs: 57-65.

[0239] In one embodiment, the nucleic acid sequence encoding alinker peptide comprises a sequence at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%identical to one of SEQ ID NOs:196-199. In one embodiment, thenucleic acid sequence encoding a linker peptide comprises sequenceof one of SEQ ID NOs: 196-199.

[0240] HilightR Fusion Proteins

[0241] In one embodiment, the nucleic acid molecule comprises anucleic acid sequence encoding a fusion protein of the disclosure,which is effectively delivered to the nucleus, an organelle, thecytoplasm or extracellularly and allow for targeted RNA cleavage.In one embodiment, the nucleic acid sequence encoding a fusionprotein encodes an amino acid sequence at least 70%, at least 71%,at least 72%, at least 73%, at least 74%, at least 75%, at least76%, at least 77%, at least 78%, at least 79%, at least 80%, atleast 81%, at least 82%, at least 83%, at least 84%, at least 85%,at least 86%, at least 87%, at least 88%, at least 89%, at least90%, at least 91%, at least 92%, at least 93%, at least 94%, atleast 95%, at least 96%, at least 97%, at least 98%, or at least99% identical to one of SEQ ID NOs:84-149. In one embodiment, thenucleic acid sequence encoding a fusion protein encodes an aminoacid sequence of one of SEQ ID NOs: 84-149.

[0242] In one embodiment, the nucleic acid sequence encoding afusion protein comprises a sequence at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%identical to one of SEQ ID NOs: 211-270. In one embodiment, thenucleic acid sequence encoding a fusion protein comprises asequence of one of SEQ ID NOs: 211-270.

Targeting Nucleic Acids and CRISPR RNAs (crRNAs)

[0243] In one aspect, the disclosure provides CRISPR RNAs (crRNAs)for targeting Cas to a target RNA. In one embodiment, crRNAcomprises guide sequence. In one embodiment, the crRNA comprises adirect repeat (DR) sequence. In one embodiment the crRNA comprisesa direct repeat sequence and a guide sequence fused or linked to aguide sequence or spacer sequence. In one embodiment the directrepeat sequence may be located upstream (i.e., 5') from the guidesequence or spacer sequence. In other embodiments, the directrepeat sequence may be located downstream (i.e., 3') from the guidesequence or spacer sequence.

[0244] In some embodiments, the crRNA comprises a stem loop. In oneembodiment, the crRNA comprises a single stem loop. In oneembodiment, the direct repeat sequence forms a stem loop. In oneembodiment, the direct repeat sequence forms a single stemloop.

[0245] In one embodiment, the spacer length of the guide RNA isfrom 15 to 35 nt. In one embodiment, the spacer length of the guideRNA is at least 15 nucleotides. In one embodiment the spacer lengthis from 15 to 17 nt, e.g., 15, 16, or 17 nt, from 17 to 20 nt,e.g., 17, 18, 19, or 20 nt, from 20 to 24 nt, e.g., 20, 21, 22, 23,or 24 nt, from 23 to 25 nt, e.g., 23, 24, or 25 nt, from 24 to 27nt, e.g., 24, 25, 26, or 27 nt, from 27-30 nt, e.g., 27, 28, 29, or30 nt, from 30-35 nt, e.g., 30, 31, 32, 33, 34, or 35 nt, or 35 ntor longer.

[0246] In general, a guide sequence is any polynucleotide sequencehaving sufficient complementarity with a target polynucleotidesequence to hybridize with the target sequence and directsequence-specific binding of a CRISPR complex to the targetsequence. In some embodiments, the degree of complementaritybetween a guide sequence and its corresponding target sequence,when optimally aligned using a suitable alignment algorithm, isabout or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%,99%, or more. Optimal alignment may be determined with the use ofany suitable algorithm for aligning sequences, non-limiting exampleof which include the Smith-Waterman algorithm, the Needleman-Wunschalgorithm, algorithms based on the Burrows-Wheeler Transform (e.g.the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign(Novocraft Technologies; available at www.novocraft.com), ELAND(Illumina, San Diego, Calif.), SOAP (available atsoap.genomics.org.cn), and Maq (available at maq.sourceforge.net).In some embodiments, a guide sequence is about or more than about5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides inlength. In some embodiments, a guide sequence is less than about75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides inlength. Preferably the guide sequence is 10 30 nucleotides long.The ability of a guide sequence to direct sequence-specific bindingof a CRISPR complex to a target sequence may be assessed by anysuitable assay. For example, the components of a CRISPR systemsufficient to form a CRISPR complex, including the guide sequenceto be tested, may be provided to a host cell having thecorresponding target sequence, such as by transfection with vectorsencoding the components of the CRISPR sequence, followed by anassessment of preferential cleavage within the target sequence,such as by Surveyor assay as described herein. Similarly, cleavageof a target polynucleotide sequence may be evaluated in a test tubeby providing the target sequence, components of a CRISPR complex,including the guide sequence to be tested and a control guidesequence different from the test guide sequence, and comparingbinding or rate of cleavage at the target sequence between the testand control guide sequence reactions. Other assays are possible,and will occur to those skilled in the art.

[0247] In some embodiments of CRISPR-Cas systems, the degree ofcomplementarity between a guide sequence and its correspondingtarget sequence can be about or more than about 50%, 60%, 75%, 80%,85%, 90%, 95%, 97.5%, 99%, or 100%; a guide or RNA or sgRNA can beabout or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, ormore nucleotides in length; or guide or RNA or sgRNA can be lessthan about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewernucleotides in length; and advantageously tracr RNA is 30 or 50nucleotides in length. However, an aspect of the disclosure is toreduce off-target interactions, e.g., reduce the guide interactingwith a target sequence having low complementarity. Indeed, in theexamples, it is shown that the disclosure involves mutations thatresult in the CRISPR-Cas system being able to distinguish betweentarget and off-target sequences that have greater than 80% to about95% complementarity, e.g., 83%-84% or 88-89% or 94-95%complementarity (for instance, distinguishing between a targethaving 18 nucleotides from an off-target of 18 nucleotides having1, 2 or 3 mismatches). Accordingly, in the context of the presentdisclosure the degree of complementarity between a guide sequenceand its corresponding target sequence is greater than 94.5% or 95%or 95.5% or 96% or 96.5% or 97% or 97.5% or 98% or 98.5% or 99% or99.5% or 99.9%, or 100%. Off target is less than 100% or 99.9% or99.5% or 99% or 99% or 98.5% or 98% or 97.5% or 97% or 96.5% or 96%or 95.5% or 95% or 94.5% or 94% or 93% or 92% or 91% or 90% or 89%or 88% or 87% or 86% or 85% or 84% or 83% or 82% or 81% or 80%complementarity between the sequence and the guide, with itadvantageous that off target is 100% or 99.9% or 99.5% or 99% or99% or 98.5% or 98% or 97.5% or 97% or 96.5% or 96% or 95.5% or 95%or 94.5% complementarity between the sequence and the guide.

[0248] In one embodiment, the crRNA comprises a substantiallycomplementary to a Coronavirus genomic mRNA sequence or aCoronavirus subgenomic mRNA sequence. For example, in oneembodiment, the crRNA comprises a sequence substantiallycomplementary to a Coronavirus leader sequence, S sequence, Esequence, M sequence, N sequence, or S2M sequence. In oneembodiment, the crRNA comprises a sequence substantiallycomplementary to a Coronavirus leader sequence, N sequence, or S2Msequence.

[0249] In one embodiment, the crRNA comprises a sequence that issubstantially complementary to a sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% homologous to a sequence selected from SEQ ID NOs: 307-327, ora fragment thereof. In one embodiment, the crRNA comprises asequence that is substantially complementary to a sequence selectedfrom SEQ ID NOs: 307-327, or a fragment thereof.

[0250] In one embodiment, the crRNA comprises a sequence that issubstantially complementary to a sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% homologous to a sequence selected from SEQ ID NOs:308-314,316-321, and 326-327. In one embodiment, the crRNA comprises asequence that is substantially complementary to a sequence selectedfrom SEQ ID NOs: 308-314, 316-321, and 326-327.

[0251] In one embodiment, the crRNA comprises a sequence at least70%, at least 71%, at least 72%, at least 73%, at least 74%, atleast 75%, at least 76%, at least 77%, at least 78%, at least 79%,at least 80%, at least 81%, at least 82%, at least 83%, at least84%, at least 85%, at least 86%, at least 87%, at least 88%, atleast 89%, at least 90%, at least 91%, at least 92%, at least 93%,at least 94%, at least 95%, at least 96%, at least 97%, at least98%, or at least 99% homologous to a sequence selected from SEQ IDNOs: 356-391. In one embodiment, the crRNA comprises a sequenceselected from SEQ ID NOs: 356-391.

[0252] In one embodiment, the disclosure provides crRNA having asequence substantially complementary to an influenza virussequence. In one embodiment, the crRNA comprises a substantiallycomplementary to an influenza virus genomic mRNA sequence or asubgenomic mRNA sequence. For example, in one embodiment, the crRNAcomprises a sequence substantially complementary to an Influenzavirus PB2 sequence, PB1 sequence, PA sequence, HA sequence, NPsequence, NA sequence, M sequence or NS sequence. In oneembodiment, the crRNA comprises a sequence substantiallycomplementary to an Influenza virus PB2 sequence, PB1 sequence, PAsequence, NP sequence, or M sequence.

[0253] In one embodiment, the crRNA comprises a sequence that issubstantially complementary to a sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% homologous to a sequence selected from SEQ ID NOs:328-347, or afragment thereof. In one embodiment, the crRNA comprises a sequencethat is substantially complementary to a sequence selected from SEQID NOs: 328-347, or a fragment thereof.

[0254] In one embodiment, the crRNA comprises a sequence that issubstantially complementary to a viral RNA sequence. In oneembodiment, the crRNA comprises a sequence that is substantiallycomplementary to a sequence a positive-sense viral RNA sequence. Inone embodiment, the crRNA comprises a sequence that issubstantially complementary to a sequence a negative-sense viralRNA sequence. In one embodiment, the crRNA comprises a sequencethat at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% homologous to a sequenceselected from SEQ ID NOs: 392-401. In one embodiment, the crRNAcomprises a sequence selected from SEQ ID NOs: 392-401.

[0255] In one embodiment, the disclosure provides crRNA having asequence substantially complementary an expanded RNA repeat. In oneembodiment, crRNA comprises a sequence substantially complementaryan expanded CUG repeat. For example, the RNA repeat includes, butis not limited to, a CTG repeat, CCTG repeat, GGGCC repeat, CAGrepeat, CGG repeat, ATTCT repeat, and TGGAA repeat. In oneembodiment, the crRNA comprises a sequence that is substantiallycomplementary to a sequence at least 70%, at least 71%, at least72%, at least 73%, at least 74%, at least 75%, at least 76%, atleast 77%, at least 78%, at least 79%, at least 80%, at least 81%,at least 82%, at least 83%, at least 84%, at least 85%, at least86%, at least 87%, at least 88%, at least 89%, at least 90%, atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%,at least 96%, at least 97%, at least 98%, or at least 99%homologous to a sequence selected from SEQ ID NOs:301-306, or afragment thereof. In one embodiment, the crRNA comprises a sequencethat is substantially complementary to a sequence selected from SEQID NOs: 301-306, or a fragment thereof. In one embodiment, thecrRNA comprises a sequence that at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%homologous to a sequence selected from SEQ ID NOs: 348-354. In oneembodiment, the crRNA comprises a sequence selected from SEQ IDNOs: 348-354.

[0256] In one embodiment, the crRNA comprises a direct repeat (DR)sequence. In one embodiment, the DR sequence is 5' of the sequencesubstantially complementary to the target sequence. For example, inone embodiment, the DR sequence is 5' of the sequence substantiallycomplementary to a Coronavirus genomic mRNA sequence or aCoronavirus subgenomic mRNA sequence. In one embodiment, the DRsequence is 5' of the sequence substantially complementary to aninfluenza virus genomic RNA sequence or a influenza virussubgenomic RNA sequence. In one embodiment, the DR sequence is 5'of the sequence substantially complementary to an expanded RNArepeat sequence. In one embodiment, the DR sequence enhances theactivity of Cas13 targeting to a target sequence, Cas13 catalyticactivity, or both. For example, in one embodiment, the DR sequencecomprises a mutation. For example, in one embodiment, the DRsequence comprises a T17C point mutation. In one embodiment, the DRsequence comprises a T18C point mutation. In one embodiment, the DRsequence is 5' of a sequence at least 80% homologous to a sequenceselected from SEQ ID NOs: 348-341.

[0257] In one embodiment, the DR sequence is 3' of the sequencesubstantially complementary to the target sequence. For example, inone embodiment, the DR sequence is 3' of the sequence substantiallycomplementary to a Coronavirus genomic mRNA sequence or aCoronavirus subgenomic mRNA sequence. In one embodiment, the DRsequence is 3' of the sequence substantially complementary to anInfluenza virus genomic mRNA sequence or an Influenza virussubgenomic mRNA sequence. In one embodiment, the DR sequence is 3'of the sequence substantially complementary to an expanded RNArepeat sequence. In one embodiment, the DR sequence is 3' of asequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% homologous to a sequenceselected from SEQ ID NOs: 348-341.

[0258] In one embodiment, selection of a 5' or 3' DR sequence isdependent on the Cas protein ortholog used. In one embodiment theDR sequence comprises a sequence selected from SEQ ID NOs:291-303.

Tandem Arrays

[0259] In one embodiment, the disclosure provides tandem crRNAarrays. In one embodiment, the tandem crRNA arrays allow for asingle promoter to drive expression of multiple crRNAs. In oneembodiment, the tandem array comprises one or more, two or more,three or more, four or more, five or more six or more, seven ormore or eight or more crRNA sequences.

[0260] In one embodiment, each crRNA in the tandem crRNA arraycomprises a direct repeat (DR) sequence and a spacer sequence. Inone embodiment the direct repeat sequence may be located upstream(i.e., 5') from the guide sequence or spacer sequence. In otherembodiments, the direct repeat sequence may be located downstream(i.e., 3') from the guide sequence or spacer sequence.

[0261] In one embodiment the direct repeat sequence comprises asequence of one of SEQ ID NOs: 291-293. In one embodiment, thedirect repeat sequence includes a single mutation in the poly Tstretch. For example, in one embodiment, the direct repeat sequencecomprises a sequence selected from SEQ ID NOs: 294-200.

[0262] In one embodiment, each crRNA in the tandem crRNA arraycomprises a different direct repeat sequence. For example, in oneembodiment, nucleotide substitutions within the loop region of thedirect repeat, multiple guide-RNAs provides for efficientlygenerated ordered arrays of crRNAs.

[0263] In one embodiment, the tandem array comprises at least twoor more crRNA comprising sequences substantially complementary to agenomic coronavirus RNA sequence and/or a sub-genomic coronavirusRNA sequence. In one embodiment, the tandem array comprises atleast two or more crRNA comprising a substantially complementary toa sequence at least 70%, at least 71%, at least 72%, at least 73%,at least 74%, at least 75%, at least 76%, at least 77%, at least78%, at least 79%, at least 80%, at least 81%, at least 82%, atleast 83%, at least 84%, at least 85%, at least 86%, at least 87%,at least 88%, at least 89%, at least 90%, at least 91%, at least92%, at least 93%, at least 94%, at least 95%, at least 96%, atleast 97%, at least 98%, or at least 99% homologous to a sequenceselected from SEQ ID NOs: 307-327 or a fragment thereof. In oneembodiment, the tandem array comprises at least two or more crRNAcomprising a sequence at least 80% homologous to a sequenceselected from SEQ ID NOs: 356-391. In one embodiment, the tandemarray comprises a sequence at least 70%, at least 71%, at least72%, at least 73%, at least 74%, at least 75%, at least 76%, atleast 77%, at least 78%, at least 79%, at least 80%, at least 81%,at least 82%, at least 83%, at least 84%, at least 85%, at least86%, at least 87%, at least 88%, at least 89%, at least 90%, atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%,at least 96%, at least 97%, at least 98%, or at least 99%homologous to SEQ ID NO:402. In one embodiment, the tandem arraycomprises a sequence of SEQ ID NO: 402.

[0264] In one embodiment, the tandem array comprises at least twoor more crRNA comprising sequences substantially complementary to agenomic coronavirus RNA sequence and/or a sub-genomic coronavirusRNA sequence. In one embodiment, the tandem array comprises atleast two or more crRNA comprising a substantially complementary toa sequence at least 70%, at least 71%, at least 72%, at least 73%,at least 74%, at least 75%, at least 76%, at least 77%, at least78%, at least 79%, at least 80%, at least 81%, at least 82%, atleast 83%, at least 84%, at least 85%, at least 86%, at least 87%,at least 88%, at least 89%, at least 90%, at least 91%, at least92%, at least 93%, at least 94%, at least 95%, at least 96%, atleast 97%, at least 98%, or at least 99% homologous to a sequenceselected from SEQ ID NOs: 328-347 or a fragment thereof. In oneembodiment, the tandem array comprises at least two or more crRNAcomprising a sequence at least 70%, at least 71%, at least 72%, atleast 73%, at least 74%, at least 75%, at least 76%, at least 77%,at least 78%, at least 79%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, or at least 99% homologoushomologous to a sequence selected from SEQ ID NOs: 392-401. In oneembodiment, the tandem array comprises a sequence at least 70%, atleast 71%, at least 72%, at least 73%, at least 74%, at least 75%,at least 76%, at least 77%, at least 78%, at least 79%, at least80%, at least 81%, at least 82%, at least 83%, at least 84%, atleast 85%, at least 86%, at least 87%, at least 88%, at least 89%,at least 90%, at least 91%, at least 92%, at least 93%, at least94%, at least 95%, at least 96%, at least 97%, at least 98%, or atleast 99% homologous to SEQ ID NO: 403 or 404. In one embodiment,the tandem array comprises a sequence of SEQ ID NO: 403 or 404.

Nucleic Acids

[0265] The isolated nucleic acid sequences of the disclosure can beobtained using any of the many recombinant methods known in theart, such as, for example by screening libraries from cellsexpressing the gene, by deriving the gene from a vector known toinclude the same, or by isolating directly from cells and tissuescontaining the same, using standard techniques. Alternatively, thegene of interest can be produced synthetically, rather thancloned.

[0266] The isolated nucleic acid may comprise any type of nucleicacid, including, but not limited to DNA and RNA. For example, inone embodiment, the composition comprises an isolated DNA molecule,including for example, an isolated cDNA molecule, encoding aprotein of the disclosure. In one embodiment, the compositioncomprises an isolated RNA molecule encoding a protein of thedisclosure, or a functional fragment thereof.

[0267] The nucleic acid molecules of the present invention can bemodified to improve stability in serum or in growth medium for cellcultures. Modifications can be added to enhance stability,functionality, and/or specificity and to minimize immunostimulatoryproperties of the nucleic acid molecule of the invention. Forexample, in order to enhance the stability, the 3'-residues may bestabilized against degradation, e.g., they may be selected suchthat they consist of purine nucleotides, particularly adenosine orguanosine nucleotides. Alternatively, substitution of pyrimidinenucleotides by modified analogues, e.g., substitution of uridine by2'-deoxythymidine is tolerated and does not affect function of themolecule.

[0268] In one embodiment of the present invention the nucleic acidmolecule may contain at least one modified nucleotide analogue. Forexample, the ends may be stabilized by incorporating modifiednucleotide analogues.

[0269] Non-limiting examples of nucleotide analogues include sugar-and/or backbone-modified ribonucleotides (i.e., includemodifications to the phosphate-sugar backbone). For example, thephosphodiester linkages of natural RNA may be modified to includeat least one of a nitrogen or sulfur heteroatom. In exemplarybackbone-modified ribonucleotides the phosphoester group connectingto adjacent ribonucleotides is replaced by a modified group, e.g.,of phosphothioate group. In exemplary sugar-modifiedribonucleotides, the 2' OH-group is replaced by a group selectedfrom H, OR, R, halo, SH, SR, NH.sub.2, NHR, NR.sub.2 or ON, whereinR is C.sub.1-C.sub.6 alkyl, alkenyl or alkynyl and halo is F, Cl,Br or I.

[0270] Other examples of modifications are nucleobase-modifiedribonucleotides, i.e., ribonucleotides, containing at least onenon-naturally occurring nucleobase instead of a naturally occurringnucleobase. Bases may be modified to block the activity ofadenosine deaminase. Exemplary modified nucleobases include, butare not limited to, uridine and/or cytidine modified at the5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine;adenosine and/or guanosines modified at the 8 position, e.g.,8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O-and N-alkylated nucleotides, e.g., N6-methyl adenosine aresuitable. It should be noted that the above modifications may becombined.

[0271] In some instances, the nucleic acid molecule comprises atleast one of the following chemical modifications: 2'-H,2'-O-methyl, or 2'-OH modification of one or more nucleotides. Incertain embodiments, a nucleic acid molecule of the invention canhave enhanced resistance to nucleases. For increased nucleaseresistance, a nucleic acid molecule, can include, for example,2'-modified ribose units and/or phosphorothioate linkages. Forexample, the 2' hydroxyl group (OH) can be modified or replacedwith a number of different "oxy" or "deoxy" substituents. Forincreased nuclease resistance the nucleic acid molecules of theinvention can include 2'-O-methyl, 2'-fluorine, 2'-O-methoxyethyl,2'-O-aminopropyl, 2'-amino, and/or phosphorothioate linkages.Inclusion of locked nucleic acids (LNA), ethylene nucleic acids(ENA), e.g., 2'-4'-ethylene-bridged nucleic acids, and certainnucleobase modifications such as 2-amino-A, 2-thio (e.g.,2-thio-U), G-clamp modifications, can also increase bindingaffinity to a target. In one embodiment, the nucleic acid moleculeincludes a 2'-modified nucleotide, e.g., a 2'-deoxy,2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE),2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE),2'-O-dimethylaminopropyl (2'-O-DMAP),2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or2'-O--N-methylacetamido (2'-O-NMA). In one embodiment, the nucleicacid molecule includes at least one 2'-O-methyl-modifiednucleotide, and in some embodiments, all of the nucleotides of thenucleic acid molecule include a 2'-O-methyl modification.

[0272] In certain embodiments, the nucleic acid molecule of theinvention has one or more of the following properties:

[0273] Nucleic acid agents discussed herein include otherwiseunmodified RNA and DNA as well as RNA and DNA that have beenmodified, e.g., to improve efficacy, and polymers of nucleosidesurrogates. Unmodified RNA refers to a molecule in which thecomponents of the nucleic acid, namely sugars, bases, and phosphatemoieties, are the same or essentially the same as that which occurin nature, or as occur naturally in the human body. The art hasreferred to rare or unusual, but naturally occurring, RNAs asmodified RNAs, see, e.g., Limbach et al. (Nucleic Acids Res., 1994,22:2183-2196). Such rare or unusual RNAs, often termed modifiedRNAs, are typically the result of a post-transcriptionalmodification and are within the term unmodified RNA as used herein.Modified RNA, as used herein, refers to a molecule in which one ormore of the components of the nucleic acid, namely sugars, bases,and phosphate moieties, are different from that which occur innature, or different from that which occurs in the human body.While they are referred to as "modified RNAs" they will of course,because of the modification, include molecules that are not,strictly speaking, RNAs. Nucleoside surrogates are molecules inwhich the ribophosphate backbone is replaced with anon-ribophosphate construct that allows the bases to be presentedin the correct spatial relationship such that hybridization issubstantially similar to what is seen with a ribophosphatebackbone, e.g., non-charged mimics of the ribophosphatebackbone.

[0274] Modifications of the nucleic acid of the invention may bepresent at one or more of, a phosphate group, a sugar group,backbone, N-terminus, C-terminus, or nucleobase.

[0275] The present invention also includes a vector in which theisolated nucleic acid of the present invention is inserted. The artis replete with suitable vectors that are useful in the presentinvention.

[0276] In brief summary, the expression of natural or syntheticnucleic acids encoding a protein of the disclosure is typicallyachieved by operably linking a nucleic acid encoding the protein ofthe disclosure or portions thereof to a promoter, and incorporatingthe construct into an expression vector. The vectors to be used aresuitable for replication and, optionally, integration in eukaryoticcells. Typical vectors contain transcription and translationterminators, initiation sequences, and promoters useful forregulation of the expression of the desired nucleic acidsequence.

[0277] The vectors of the present invention may also be used fornucleic acid immunization and gene therapy, using standard genedelivery protocols. Methods for gene delivery are known in the art.See, e.g., U.S. Pat. Nos. 5,399,346, 5,580,859, 5,589,466,incorporated by reference herein in their entireties. In anotherembodiment, the invention provides a gene therapy vector.

[0278] The isolated nucleic acid of the invention can be clonedinto a number of types of vectors. For example, the nucleic acidcan be cloned into a vector including, but not limited to aplasmid, a phagemid, a phage derivative, an animal virus, and acosmid. Vectors of particular interest include expression vectors,replication vectors, probe generation vectors, and sequencingvectors.

[0279] Further, the vector may be provided to a cell in the form ofa viral vector. Viral vector technology is well known in the artand is described, for example, in Sambrook et al. (2012, MolecularCloning: A Laboratory Manual, Cold Spring Harbor Laboratory, NewYork), and in other virology and molecular biology manuals.Viruses, which are useful as vectors include, but are not limitedto, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. In general, a suitable vector containsan origin of replication functional in at least one organism, apromoter sequence, convenient restriction endonuclease sites, andone or more selectable markers, (e.g., WO 01/96584; WO 01/29058;and U.S. Pat. No. 6,326,193).

Delivery Systems and Methods

[0280] In one aspect, the disclosure relates to the development ofnovel lentiviral packaging and delivery systems. The lentiviralparticle delivers the viral enzymes as proteins. In this fashion,lentiviral enzymes are short lived, thus limiting the potential foroff-target editing due to long term expression though the entirelife of the cell. Thus, in one embodiment, the disclosure providesnovel delivery systems for delivering a gene or geneticmaterial.

[0281] The incorporation of editing components, or traditionalCRISPR-Cas editing components as proteins in lentiviral particlesis advantageous, given that their required activity is onlyrequired for a short period of time. Thus, in one embodiment, thedisclosure provides a lentiviral delivery system and methods ofdelivering the compositions of the invention, editing geneticmaterial, and nucleic acid delivery using lentiviral deliverysystems.

[0282] In one embodiment, the delivery system comprises (1) apackaging plasmid (2) a transfer plasmid, and (3) an envelopeplasmid. In one embodiment, the delivery system comprises (1) apackaging plasmid (2) an envelope plasmid, and (3) a VPR plasmid.In one embodiment, the packaging plasmid comprises a nucleic acidsequence encoding a gag-pol polyprotein. In one embodiment, thegag-pol polyprotein comprises catalytically dead integrase. In oneembodiment, the gag-pol polyprotein comprises a mutation selectedfrom D116N and D64V.

[0283] In one embodiment, the transfer plasmid comprises a nucleicacid sequence encoding a crRNA sequence and Cas protein of thedisclosure. For example, in one embodiment the transfer plasmidcomprises a nucleic acid sequence encoding a crRNA sequence and aprotein of the disclosure comprising a Cas protein. In oneembodiment, the transfer plasmid comprises a nucleic acid sequenceencoding a crRNA sequence and a protein of the disclosurecomprising a Cas protein and a localization signal. In oneembodiment, the transfer plasmid comprises a nucleic acid sequenceencoding a crRNA sequence and a protein of the disclosurecomprising a Cas protein and a NLS, NES or other localizationsignal.

[0284] For example, in one embodiment, the transfer plasmidcomprises a nucleic acid sequence encoding a crRNA sequence havingsubstantial complementary to a Coronavirus genomic mRNA sequence ora Coronavirus subgenomic mRNA sequence, and a nucleic acid sequenceencoding Cas protein of the disclosure. In one embodiment, thenucleic acid sequence encoding a crRNA sequence having substantialcomplementary to a Coronavirus genomic mRNA sequence or aCoronavirus subgenomic mRNA sequence comprises a sequence at least70%, at least 71%, at least 72%, at least 73%, at least 74%, atleast 75%, at least 76%, at least 77%, at least 78%, at least 79%,at least 80%, at least 81%, at least 82%, at least 83%, at least84%, at least 85%, at least 86%, at least 87%, at least 88%, atleast 89%, at least 90%, at least 91%, at least 92%, at least 93%,at least 94%, at least 95%, at least 96%, at least 97%, at least98%, or at least 99% homologous to SEQ ID NOs: 356-391. In oneembodiment, nucleic acid sequence encoding Cas protein comprises asequence encoding an amino acid sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% homologous to one of SEQ ID NOs: 1-46 and 150-171. In oneembodiment, nucleic acid sequence encoding Cas protein comprises asequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% homologous to one of SEQ ID NOs:188-190 and 271-290. In one embodiment, the transfer plasmidcomprises a sequence of SEQ ID NO:405-407.

[0285] In one embodiment, the transfer plasmid comprises a nucleicacid sequence encoding a crRNA sequence having substantialcomplementary to an influenza virus genomic mRNA sequence or asubgenomic mRNA sequence, and a nucleic acid sequence encoding Casprotein of the disclosure. In one embodiment, the nucleic acidsequence encoding a crRNA sequence having substantial complementaryto influenza virus genomic mRNA sequence or a subgenomic mRNAsequence encodes a sequence comprising a sequence at least 70%, atleast 71%, at least 72%, at least 73%, at least 74%, at least 75%,at least 76%, at least 77%, at least 78%, at least 79%, at least80%, at least 81%, at least 82%, at least 83%, at least 84%, atleast 85%, at least 86%, at least 87%, at least 88%, at least 89%,at least 90%, at least 91%, at least 92%, at least 93%, at least94%, at least 95%, at least 96%, at least 97%, at least 98%, or atleast 99% homologous to SEQ ID NOs: 392-401. In one embodiment,nucleic acid sequence encoding Cas protein comprises a sequenceencoding an amino acid sequence at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%homologous to one of SEQ ID NOs: 1-46 and 150-171. In oneembodiment, nucleic acid sequence encoding Cas protein comprises asequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% homologous to one of SEQ ID NOs:188-190 and 271-290.

[0286] In one embodiment, the transfer plasmid comprises a nucleicacid sequence encoding a crRNA sequence and a fusion protein of thedisclosure comprising a Cas protein and a fluorescent protein. Inone embodiment, the transfer plasmid comprises a nucleic acidsequence encoding a crRNA sequence and a protein of the disclosurecomprising a Cas protein, a fluorescent protein and a localizationsignal. In one embodiment, the transfer plasmid comprises a nucleicacid sequence encoding a crRNA sequence and a protein of thedisclosure comprising a Cas protein, a fluorescent protein, and aNLS, NES or other localization signal.

[0287] In one embodiment, the transfer plasmid comprises a nucleicacid sequence encoding a crRNA array sequence and Cas protein ofthe disclosure. For example, in one embodiment the transfer plasmidcomprises a nucleic acid sequence encoding a crRNA array sequenceand a protein of the disclosure comprising a Cas protein. In oneembodiment, the transfer plasmid comprises a nucleic acid sequenceencoding a crRNA array sequence and a protein of the disclosurecomprising a Cas protein and a localization signal. In oneembodiment, the transfer plasmid comprises a nucleic acid sequenceencoding a crRNA array sequence and a protein of the disclosurecomprising a Cas protein and a NLS, NES or other localizationsignal.

[0288] For example, in one embodiment, the transfer plasmidcomprises a nucleic acid sequence encoding a tandem arraycomprising two or more crRNA sequence having substantialcomplementary to a Coronavirus genomic mRNA sequence or aCoronavirus subgenomic mRNA sequence, and a nucleic acid sequenceencoding Cas protein of the disclosure. In one embodiment, thenucleic acid sequence encoding a tandem array comprises a sequenceencoding a sequence at least 70%, at least 71%, at least 72%, atleast 73%, at least 74%, at least 75%, at least 76%, at least 77%,at least 78%, at least 79%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, or at least 99% homologous to SEQID NO:402. In one embodiment, nucleic acid sequence encoding Casprotein comprises a sequence encoding an amino acid sequence atleast 70%, at least 71%, at least 72%, at least 73%, at least 74%,at least 75%, at least 76%, at least 77%, at least 78%, at least79%, at least 80%, at least 81%, at least 82%, at least 83%, atleast 84%, at least 85%, at least 86%, at least 87%, at least 88%,at least 89%, at least 90%, at least 91%, at least 92%, at least93%, at least 94%, at least 95%, at least 96%, at least 97%, atleast 98%, or at least 99% homologous to one of SEQ ID NOs: 1-46and 150-171. In one embodiment, nucleic acid sequence encoding Casprotein comprises a sequence at least 70%, at least 71%, at least72%, at least 73%, at least 74%, at least 75%, at least 76%, atleast 77%, at least 78%, at least 79%, at least 80%, at least 81%,at least 82%, at least 83%, at least 84%, at least 85%, at least86%, at least 87%, at least 88%, at least 89%, at least 90%, atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%,at least 96%, at least 97%, at least 98%, or at least 99%homologous to one of SEQ ID NOs: 188-190 and 271-290. In oneembodiment, the transfer plasmid comprises a sequence of SEQ IDNO:396.

[0289] In one embodiment, the transfer plasmid comprises a nucleicacid sequence encoding a tandem array comprising two or more crRNAsequence having substantial complementary to an influenza virusgenomic mRNA sequence or a subgenomic mRNA sequence, and a nucleicacid sequence encoding Cas protein of the disclosure. In oneembodiment, the nucleic acid sequence encoding a tandem arraycomprises a sequence encoding a sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% homologous to SEQ ID NO:403 or 404. In one embodiment, nucleicacid sequence encoding Cas protein comprises a sequence encoding anamino acid sequence at least 80% homologous to one of SEQ ID NOs:1-46 and 150-171. In one embodiment, nucleic acid sequence encodingCas protein comprises a sequence at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%homologous to one of SEQ ID NOs: 188-190 and 271-290.

[0290] In one embodiment, the transfer plasmid comprises a nucleicacid sequence encoding a crRNA array sequence and a fusion proteinof the disclosure comprising a Cas protein and a fluorescentprotein. In one embodiment, the transfer plasmid comprises anucleic acid sequence encoding a crRNA array sequence and a proteinof the disclosure comprising a Cas protein, a fluorescent proteinand a localization signal. In one embodiment, the transfer plasmidcomprises a nucleic acid sequence encoding a crRNA array sequenceand a protein of the disclosure comprising a Cas protein, afluorescent protein, and a NLS, NES or other localizationsignal.

[0291] In one embodiment, the transfer plasmid comprises a nucleicacid sequence encoding a gene. For example, in one embodiment thetransfer plasmid comprises a nucleic acid sequence encoding atherapeutic gene. In some embodiments, the gene is a wild-typegene.

[0292] In one embodiment, the envelope plasmid comprises a nucleicacid sequence encoding an envelope protein. In one embodiment, theenvelope protein can be selected based on the desired cell type. Inone embodiment, the envelope plasmid comprises a nucleic acidsequence encoding an HIV envelope protein. In one embodiment, theenvelope plasmid comprises a nucleic acid sequence encoding avesicular stomatitis virus g-protein (VSV-g) envelope protein. Inone embodiment, the envelope plasmid comprises a nucleic acidsequence encoding an amino acid sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% homologous to one of SEQ ID NOs:184. In one embodiment, theenvelope plasmid comprises a nucleic acid sequence encoding anamino acid sequence of one of SEQ ID NOs:184.

[0293] In one embodiment, the envelope plasmid comprises a nucleicacid sequence encoding a coronavirus spike protein or a coronavirusspike protein-derived protein. For example in one embodiment, theenvelope plasmid comprises a nucleic acid sequence encoding anamino acid sequence at least 70%, at least 71%, at least 72%, atleast 73%, at least 74%, at least 75%, at least 76%, at least 77%,at least 78%, at least 79%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, or at least 99% homologous to oneof SEQ ID NOs:172-183. In one embodiment, the envelope plasmidcomprises a nucleic acid sequence encoding an amino acid sequenceof one of SEQ ID NOs:172-183.

[0294] In one embodiment, viral envelope proteins fromcoronaviruses are not efficient for pseudotyping of lentiviralvectors. Thus, in one embodiment, the disclosure also providesnovel coronavirus envelope proteins for use in pseudotyping alentiviral vector. In one embodiment, the coronavirus envelopeprotein comprises an amino acid sequence at least 70%, at least71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%,at least 81%, at least 82%, at least 83%, at least 84%, at least85%, at least 86%, at least 87%, at least 88%, at least 89%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%,at least 95%, at least 96%, at least 97%, at least 98%, or at least99% homologous to one of SEQ ID NOs:172-183. In one embodiment, thecoronavirus envelope protein comprises an amino acid sequence ofone of SEQ ID NOs:172-183.

[0295] In one embodiment, the VPR plasmid comprises a nucleic acidsequence encoding a fusion protein comprising VPR, and a Casprotein of the disclosure. In one embodiment, the VPR plasmidcomprises a nucleic acid sequence encoding a fusion proteincomprising VPR, and a protein of the disclosure comprising a Casprotein and a fluorescent protein.

[0296] In one embodiment, the packaging plasmid, transfer plasmid,and envelope plasmid are introduced into a cell. In one embodiment,the cell transcribes and translates the nucleic acid sequenceencoding the gag-pol protein encoded by the packaging plasmid toproduce the gag-pol polyprotein. In one embodiment, the celltranscribes and translates the nucleic acid sequence encoding theenvelope protein of the envelope plasmid to produce the envelopeprotein. In one embodiment, the cell transcribes the nucleic acidsequence encoding the crRNA sequence or crRNA array of the transferplasmid to produce the crRNA or crRNA array. In one embodiment, thecell transcribes and translates the nucleic acid sequence encodingthe Cas protein or Cas protein and fluorescent protein of thetransfer plasmid to produce the Cas or Cas fusion protein.

[0297] In one embodiment, the transcribed transfer plasmid andgag-pol proteins are packaged into a lentiviral vector. In oneembodiment, the lentiviral vectors are collected from the cellmedia. In one embodiment, the viral particles transduce a targetcell, wherein the transcribed the crRNA and Cas protein are cleavedand the translated thereby generating the Cas protein and crRNA,wherein the crRNA binds to the Cas protein and directs it to an RNAhaving a sequence substantially complementary to the crRNAsequence.

[0298] In one embodiment, the packaging plasmid, transfer plasmid,and envelope plasmid are introduced into a cell. In one embodiment,the cell transcribes and translates the nucleic acid sequenceencoding the gag-pol protein encoded by the packaging plasmid toproduce the gag-pol polyprotein. In one embodiment, the celltranscribes and translates the nucleic acid sequence encoding theenvelope protein of the envelope plasmid to produce the envelopeprotein. In one embodiment, the cell transcribes the nucleic acidsequence encoding the gene to produce the gene. In one embodiment,the cell transcribes and translates the nucleic acid sequenceencoding the gene of the transfer plasmid to produce a protein.

[0299] In one embodiment, the transcribed transfer plasmid andgag-pol proteins are packaged into a lentiviral vector. In oneembodiment, the lentiviral vectors are collected from the cellmedia. In one embodiment, the viral particles transduce a targetcell, wherein the transcribed gene is delivered to the cell andinserted into the genome.

[0300] In one embodiment, the transcribed transfer plasmid andgag-pol proteins are packaged into a lentiviral vector. In oneembodiment, the lentiviral vectors are collected from the cellmedia. In one embodiment, the viral particles transduce a targetcell, wherein the transcribed and translated gene is delivered tothe cell.

[0301] In one embodiment, the gene or protein is delivered to arespiratory, vascular, renal, or cardiovascular cell type. Thus, inone embodiment the envelope protein is derived from a coronavirus.In one embodiment, the coronavirus envelope protein comprises anamino acid sequence at least 70%, at least 71%, at least 72%, atleast 73%, at least 74%, at least 75%, at least 76%, at least 77%,at least 78%, at least 79%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, or at least 99% homologous to oneof SEQ ID NOs:172-183. In one embodiment, the coronavirus envelopeprotein comprises an amino acid sequence of one of SEQ IDNOs:172-183.

[0302] Further, a number of additional viral based systems havebeen developed for gene transfer into mammalian cells. For example,retroviruses provide a convenient platform for gene deliverysystems. A selected gene can be inserted into a vector and packagedin retroviral particles using techniques known in the art. Therecombinant virus can then be isolated and delivered to cells ofthe subject either in vivo or ex vivo. A number of retroviralsystems are known in the art. In some embodiments, adenovirusvectors are used. A number of adenovirus vectors are known in theart. In one embodiment, lentivirus vectors are used.

[0303] For example, vectors derived from retroviruses such as thelentivirus are suitable tools to achieve long-term gene transfersince they allow long-term, stable integration of a transgene andits propagation in daughter cells. Lentiviral vectors have theadded advantage over vectors derived from onco-retroviruses such asmurine leukemia viruses in that they can transducenon-proliferating cells, such as hepatocytes. They also have theadded advantage of low immunogenicity.

[0304] In one embodiment, the composition includes a vector derivedfrom an adeno-associated virus (AAV). The term "AAV vector" means avector derived from an adeno-associated virus serotype, includingwithout limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6,AAV-7, AAV-8, and AAV-9. AAV vectors have become powerful genedelivery tools for the treatment of various disorders. AAV vectorspossess a number of features that render them ideally suited forgene therapy, including a lack of pathogenicity, minimalimmunogenicity, and the ability to transduce postmitotic cells in astable and efficient manner. Expression of a particular genecontained within an AAV vector can be specifically targeted to oneor more types of cells by choosing the appropriate combination ofAAV serotype, promoter, and delivery method.

[0305] For example, in one embodiment, the AAV vector comprises acrRNA having substantially complementary to a Coronavirus genomicmRNA sequence or a Coronavirus subgenomic mRNA sequence. In oneembodiment, the AAV vector comprises a crRNA array comprising twoor more crRNA having substantially complementary to a Coronavirusgenomic mRNA sequence or a Coronavirus subgenomic mRNA sequence. Inone embodiment, the AAV vector comprises a sequence at least 70%,at least 71%, at least 72%, at least 73%, at least 74%, at least75%, at least 76%, at least 77%, at least 78%, at least 79%, atleast 80%, at least 81%, at least 82%, at least 83%, at least 84%,at least 85%, at least 86%, at least 87%, at least 88%, at least89%, at least 90%, at least 91%, at least 92%, at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%,or at least 99% homologous to SEQ ID NO: 409. In one embodiment,the transfer plasmid comprises a sequence of SEQ ID NO: 409.

[0306] In one embodiment, the AAV vector comprises a crRNA havingsubstantially complementary to an influenza virus genomic RNAsequence or an influenza virus subgenomic RNA sequence. In oneembodiment, the transfer plasmid comprises a crRNA array comprisingtwo or more crRNA having substantially complementary to aninfluenza virus genomic RNA sequence or an influenza virussubgenomic RNA sequence.

[0307] AAV vectors can have one or more of the AAV wild-type genesdeleted in whole or part, preferably the rep and/or cap genes, butretain functional flanking ITR sequences. Despite the high degreeof homology, the different serotypes have tropisms for differenttissues. The receptor for AAV1 is unknown; however, AAV1 is knownto transduce skeletal and cardiac muscle more efficiently thanAAV2. Since most of the studies have been done with pseudotypedvectors in which the vector DNA flanked with AAV2 ITR is packagedinto capsids of alternate serotypes, it is clear that thebiological differences are related to the capsid rather than to thegenomes. Recent evidence indicates that DNA expression cassettespackaged in AAV 1 capsids are at least 1 log 10 more efficient attransducing cardiomyocytes than those packaged in AAV2 capsids. Inone embodiment, the viral delivery system is an adeno-associatedviral delivery system. The adeno-associated virus can be ofserotype 1 (AAV 1), serotype 2 (AAV2), serotype 3 (AAV3), serotype4 (AAV4), serotype 5 (AAV5), serotype 6 (AAV6), serotype 7 (AAV7),serotype 8 (AAV8), or serotype 9 (AAV9).

[0308] Desirable AAV fragments for assembly into vectors includethe cap proteins, including the vp1, vp2, vp3 and hypervariableregions, the rep proteins, including rep 78, rep 68, rep 52, andrep 40, and the sequences encoding these proteins. These fragmentsmay be readily utilized in a variety of vector systems and hostcells. Such fragments may be used alone, in combination with otherAAV serotype sequences or fragments, or in combination withelements from other AAV or non-AAV viral sequences. As used herein,artificial AAV serotypes include, without limitation, AAV with anon-naturally occurring capsid protein. Such an artificial capsidmay be generated by any suitable technique, using a selected AAVsequence (e.g., a fragment of a vp1 capsid protein) in combinationwith heterologous sequences which may be obtained from a differentselected AAV serotype, non-contiguous portions of the same AAVserotype, from a non-AAV viral source, or from a non-viral source.An artificial AAV serotype may be, without limitation, a chimericAAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid.Thus exemplary AAVs, or artificial AAVs, suitable for expression ofone or more proteins, include AAV2/8 (see U.S. Pat. No. 7,282,199),AAV2/5 (available from the National Institutes of Health), AAV2/9(International Patent Publication No. WO2005/033321), AAV2/6 (U.S.Pat. No. 6,156,303), and AAVrh8 (International Patent PublicationNo. WO2003/042397), among others.

[0309] In certain embodiments, the vector also includesconventional control elements which are operably linked to thetransgene in a manner which permits its transcription, translationand/or expression in a cell transfected with the plasmid vector orinfected with the virus produced by the invention. As used herein,"operably linked" sequences include both expression controlsequences that are contiguous with the gene of interest andexpression control sequences that act in trans or at a distance tocontrol the gene of interest. Expression control sequences includeappropriate transcription initiation, termination, promoter andenhancer sequences; efficient RNA processing signals such assplicing and polyadenylation (polyA) signals; sequences thatstabilize cytoplasmic mRNA; sequences that enhance translationefficiency (i.e., Kozak consensus sequence); sequences that enhanceprotein stability; and when desired, sequences that enhancesecretion of the encoded product. A great number of expressioncontrol sequences, including promoters which are native,constitutive, inducible and/or tissue-specific, are known in theart and may be utilized.

[0310] Additional promoter elements, e.g., enhancers, regulate thefrequency of transcriptional initiation. Typically, these arelocated in the region 30-110 bp upstream of the start site,although a number of promoters have recently been shown to containfunctional elements downstream of the start site as well. Thespacing between promoter elements frequently is flexible, so thatpromoter function is preserved when elements are inverted or movedrelative to one another. In the thymidine kinase (tk) promoter, thespacing between promoter elements can be increased to 50 bp apartbefore activity begins to decline. Depending on the promoter, itappears that individual elements can function either cooperativelyor independently to activate transcription.

[0311] One example of a suitable promoter is the immediate earlycytomegalovirus (CMV) promoter sequence. This promoter sequence isa strong constitutive promoter sequence capable of driving highlevels of expression of any polynucleotide sequence operativelylinked thereto. Another example of a suitable promoter isElongation Growth Factor-1.alpha. (EF-1.alpha.). However, otherconstitutive promoter sequences may also be used, including, butnot limited to the simian virus 40 (SV40) early promoter, mousemammary tumor virus (MMTV), human immunodeficiency virus (HIV) longterminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemiavirus promoter, an Epstein-Barr virus immediate early promoter, aRous sarcoma virus promoter, as well as human gene promoters suchas, but not limited to, the actin promoter, the myosin promoter,the hemoglobin promoter, and the creatine kinase promoter. Further,the invention should not be limited to the use of constitutivepromoters. Inducible promoters are also contemplated as part of theinvention. The use of an inducible promoter provides a molecularswitch capable of turning on expression of the polynucleotidesequence which it is operatively linked when such expression isdesired, or turning off the expression when expression is notdesired. Examples of inducible promoters include, but are notlimited to a metallothionine promoter, a glucocorticoid promoter, aprogesterone promoter, and a tetracycline promoter.

[0312] Enhancer sequences found on a vector also regulatesexpression of the gene contained therein. Typically, enhancers arebound with protein factors to enhance the transcription of a gene.Enhancers may be located upstream or downstream of the gene itregulates. Enhancers may also be tissue-specific to enhancetranscription in a specific cell or tissue type. In one embodiment,the vector of the present invention comprises one or more enhancersto boost transcription of the gene present within the vector.

[0313] In order to assess the expression of a fusion protein of theinvention, the expression vector to be introduced into a cell canalso contain either a selectable marker gene or a reporter gene orboth to facilitate identification and selection of expressing cellsfrom the population of cells sought to be transfected or infectedthrough viral vectors. In other aspects, the selectable marker maybe carried on a separate piece of DNA and used in a co-transfectionprocedure. Both selectable markers and reporter genes may beflanked with appropriate regulatory sequences to enable expressionin the host cells. Useful selectable markers include, for example,antibiotic-resistance genes, such as neo and the like.

[0314] Reporter genes are used for identifying potentiallytransfected cells and for evaluating the functionality ofregulatory sequences. In general, a reporter gene is a gene that isnot present in or expressed by the recipient organism or tissue andthat encodes a polypeptide whose expression is manifested by someeasily detectable property, e.g., enzymatic activity. Expression ofthe reporter gene is assayed at a suitable time after the DNA hasbeen introduced into the recipient cells. Suitable reporter genesmay include genes encoding luciferase, beta-galactosidase,chloramphenicol acetyl transferase, secreted alkaline phosphatase,or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000FEBS Letters 479: 79-82). Suitable expression systems are wellknown and may be prepared using known techniques or obtainedcommercially. In general, the construct with the minimal 5'flanking region showing the highest level of expression of reportergene is identified as the promoter. Such promoter regions may belinked to a reporter gene and used to evaluate agents for theability to modulate promoter-driven transcription.

[0315] Methods of introducing and expressing genes into a cell areknown in the art. In the context of an expression vector, thevector can be readily introduced into a host cell, e.g., mammalian,bacterial, yeast, or insect cell by any method in the art. Forexample, the expression vector can be transferred into a host cellby physical, chemical, or biological means.

[0316] Physical methods for introducing a polynucleotide into ahost cell include calcium phosphate precipitation, lipofection,particle bombardment, microinjection, electroporation, and thelike. Methods for producing cells comprising vectors and/orexogenous nucleic acids are well-known in the art. See, forexample, Sambrook et al. (2012, Molecular Cloning: A LaboratoryManual, Cold Spring Harbor Laboratory, New York). An exemplarymethod for the introduction of a polynucleotide into a host cell iscalcium phosphate transfection.

[0317] Biological methods for introducing a polynucleotide ofinterest into a host cell include the use of DNA and RNA vectors.Viral vectors, and especially retroviral vectors, have become themost widely used method for inserting genes into mammalian, e.g.,human cells. Other viral vectors can be derived from lentivirus,poxviruses, herpes simplex virus I, adenoviruses andadeno-associated viruses, and the like. See, for example, U.S. Pat.Nos. 5,350,674 and 5,585,362.

[0318] Chemical means for introducing a polynucleotide into a hostcell include colloidal dispersion systems, such as macromoleculecomplexes, nanocapsules, microspheres, beads, and lipid-basedsystems including oil-in-water emulsions, micelles, mixed micelles,and liposomes. An exemplary colloidal system for use as a deliveryvehicle in vitro and in vivo is a liposome (e.g., an artificialmembrane vesicle).

[0319] In the case where a non-viral delivery system is utilized,an exemplary delivery vehicle is a liposome. The use of lipidformulations is contemplated for the introduction of the nucleicacids into a host cell (in vitro, ex vivo or in vivo). In anotheraspect, the nucleic acid may be associated with a lipid. Thenucleic acid associated with a lipid may be encapsulated in theaqueous interior of a liposome, interspersed within the lipidbilayer of a liposome, attached to a liposome via a linkingmolecule that is associated with both the liposome and theoligonucleotide, entrapped in a liposome, complexed with aliposome, dispersed in a solution containing a lipid, mixed with alipid, combined with a lipid, contained as a suspension in a lipid,contained or complexed with a micelle, or otherwise associated witha lipid. Lipid, lipid/DNA or lipid/expression vector associatedcompositions are not limited to any particular structure insolution. For example, they may be present in a bilayer structure,as micelles, or with a "collapsed" structure. They may also simplybe interspersed in a solution, possibly forming aggregates that arenot uniform in size or shape. Lipids are fatty substances which maybe naturally occurring or synthetic lipids. For example, lipidsinclude the fatty droplets that naturally occur in the cytoplasm aswell as the class of compounds which contain long-chain aliphatichydrocarbons and their derivatives, such as fatty acids, alcohols,amines, amino alcohols, and aldehydes.

[0320] Lipids suitable for use can be obtained from commercialsources. For example, dimyristyl phosphatidylcholine ("DMPC") canbe obtained from Sigma, St. Louis, Mo.; dicetyl phosphate ("DCP")can be obtained from K & K Laboratories (Plainview, N.Y.);cholesterol ("Choi") can be obtained from Calbiochem-Behring;dimyristyl phosphatidylglycerol ("DMPG") and other lipids may beobtained from Avanti Polar Lipids, Inc. (Birmingham, Ala.). Stocksolutions of lipids in chloroform or chloroform/methanol can bestored at about -20.degree. C. Chloroform is used as the onlysolvent since it is more readily evaporated than methanol."Liposome" is a generic term encompassing a variety of single andmultilamellar lipid vehicles formed by the generation of enclosedlipid bilayers or aggregates. Liposomes can be characterized ashaving vesicular structures with a phospholipid bilayer membraneand an inner aqueous medium. Multilamellar liposomes have multiplelipid layers separated by aqueous medium. They form spontaneouslywhen phospholipids are suspended in an excess of aqueous solution.The lipid components undergo self-rearrangement before theformation of closed structures and entrap water and dissolvedsolutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology5: 505-10). However, compositions that have different structures insolution than the normal vesicular structure are also encompassed.For example, the lipids may assume a micellar structure or merelyexist as nonuniform aggregates of lipid molecules. Alsocontemplated are lipofectamine-nucleic acid complexes.

[0321] Regardless of the method used to introduce exogenous nucleicacids into a host cell, in order to confirm the presence of therecombinant DNA sequence in the host cell, a variety of assays maybe performed. Such assays include, for example, "molecularbiological" assays well known to those of skill in the art, such asSouthern and Northern blotting, RT-PCR and PCR; "biochemical"assays, such as detecting the presence or absence of a particularpeptide, e.g., by immunological means (ELISAs and Western blots) orby assays described herein to identify agents falling within thescope of the invention.

Systems

[0322] In one aspect, the present invention provides a system fordecreasing the number of an RNA transcript in a subject. In oneembodiment the system comprises, in one or more vectors, a nucleicacid sequence encoding a protein, wherein the protein comprises aCRISPR-associated (Cas) protein, and optionally a localizationsequence, such as an NLS, NES, or organelle localization signal;and a nucleic acid sequence encoding a crRNA. In one embodiment,the crRNA substantially hybridizes to a target RNA sequence in theRNA transcript. In one embodiment, the nucleic acid sequenceencoding the Cas and the nucleic acid sequence encoding a crRNA arein the same vector. In one embodiment, the nucleic acid sequenceencoding the protein and the nucleic acid sequence encoding a crRNAare in different vectors.

[0323] In one embodiment, the nucleic acid sequence encoding aprotein comprises (1) a nucleic acid sequence encoding an aminoacid sequence at least 70%, at least 71%, at least 72%, at least73%, at least 74%, at least 75%, at least 76%, at least 77%, atleast 78%, at least 79%, at least 80%, at least 81%, at least 82%,at least 83%, at least 84%, at least 85%, at least 86%, at least87%, at least 88%, at least 89%, at least 90%, at least 91%, atleast 92%, at least 93%, at least 94%, at least 95%, at least 96%,at least 97%, at least 98%, or at least 99% identical to one of SEQID NOs: 1-46; and (2) optionally a nucleic acid sequence encodingan amino acid sequence at least 70%, at least 71%, at least 72%, atleast 73%, at least 74%, at least 75%, at least 76%, at least 77%,at least 78%, at least 79%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, or at least 99% identical to oneof SEQ ID NOs: 67-83 and 427-1039. In one embodiment, the nucleicacid sequence encoding a protein comprises (1) a nucleic acidsequence encoding an amino acid of one of SEQ ID NOs: 1-46; and (2)optionally a nucleic acid sequence encoding an amino acid of one ofSEQ ID NOs: 67-83 and 427-1039. In one embodiment, the nucleic acidsequence encoding a protein comprises a nucleic acid sequenceencoding an amino acid at least 70%, at least 71%, at least 72%, atleast 73%, at least 74%, at least 75%, at least 76%, at least 77%,at least 78%, at least 79%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, or at least 99% identical to oneof SEQ ID NOs: 150-171. In one embodiment, the nucleic acidsequence encoding a protein comprises a nucleic acid sequenceencoding an amino acid of one of SEQ ID NOs: 150-171.

[0324] In one aspect, the present invention provides a system forvisualizing an RNA transcript in a subject. In one embodiment thesystem comprises, in one or more vectors, a nucleic acid sequenceencoding a fusion protein, wherein the fusion protein comprises aCRISPR-associated (Cas) protein, a fluorescent protein, andoptionally a localization sequence, such as an NLS, NES, ororganelle localization signal; and a nucleic acid sequence encodinga crRNA. In one embodiment, the crRNA substantially hybridizes to atarget RNA sequence in the RNA transcript. In one embodiment, thenucleic acid sequence encoding the Cas and the nucleic acidsequence encoding a crRNA are in the same vector. In oneembodiment, the nucleic acid sequence encoding the fusion proteinand the nucleic acid sequence encoding a crRNA are in differentvectors.

[0325] In one embodiment, the nucleic acid sequence encoding afusion protein comprises (1) a nucleic acid sequence encoding anamino acid sequence at least 70%, at least 71%, at least 72%, atleast 73%, at least 74%, at least 75%, at least 76%, at least 77%,at least 78%, at least 79%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, or at least 99% identical to oneof SEQ ID NOs: 47-48; (2) a nucleic acid sequence encoding an aminoacid sequence at least 70%, at least 71%, at least 72%, at least73%, at least 74%, at least 75%, at least 76%, at least 77%, atleast 78%, at least 79%, at least 80%, at least 81%, at least 82%,at least 83%, at least 84%, at least 85%, at least 86%, at least87%, at least 88%, at least 89%, at least 90%, at least 91%, atleast 92%, at least 93%, at least 94%, at least 95%, at least 96%,at least 97%, at least 98%, or at least 99% identical to one of SEQID NOs: 49-56; and (3) optionally a nucleic acid sequence encodingan amino acid sequence at least 70%, at least 71%, at least 72%, atleast 73%, at least 74%, at least 75%, at least 76%, at least 77%,at least 78%, at least 79%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, or at least 99% identical to oneof SEQ ID NOs: 67-83 and 427-1039. In one embodiment, the nucleicacid sequence encoding a fusion protein comprises (1) a nucleicacid sequence encoding an amino acid of one of SEQ ID NOs: 47-48;(2) a nucleic acid sequence encoding an amino acid of one of SEQ IDNOs: 49-56; and (3) a nucleic acid sequence encoding an amino acidof one of SEQ ID NOs: 67-83 and 427-1039. In one embodiment, thenucleic acid sequence encoding a protein comprises a nucleic acidsequence encoding an amino acid at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%identical to one of SEQ ID NOs: 84-149. In one embodiment, thenucleic acid sequence encoding a protein comprises a nucleic acidsequence encoding an amino acid of one of SEQ ID NOs: 84-149.

Compositions and Formulations

[0326] In one aspect, the present invention provides compositionsfor decreasing the number of an RNA transcript in a subject. In oneembodiment, the composition comprises a fusion protein, wherein thefusion protein comprises a CRISPR-associated (Cas) protein, andoptionally a localization sequence, such as an NLS, NES ororganelle localization signal. In one embodiment, the compositioncomprises a crRNA. In one embodiment, the crRNA substantiallyhybridizes to a target RNA sequence in the RNA transcript. In oneembodiment, the composition comprises a crRNA array. In oneembodiment, the crRNA array comprises two or more sequences whichsubstantially hybridizes to a target RNA sequence in the RNAtranscript.

[0327] In one embodiment, the composition comprises a proteincomprising (1) an amino acid sequence at least 70%, at least 71%,at least 72%, at least 73%, at least 74%, at least 75%, at least76%, at least 77%, at least 78%, at least 79%, at least 80%, atleast 81%, at least 82%, at least 83%, at least 84%, at least 85%,at least 86%, at least 87%, at least 88%, at least 89%, at least90%, at least 91%, at least 92%, at least 93%, at least 94%, atleast 95%, at least 96%, at least 97%, at least 98%, or at least99% identical to one of SEQ ID NOs: 1-46; and (2) optionally anamino acid sequence at least 70%, at least 71%, at least 72%, atleast 73%, at least 74%, at least 75%, at least 76%, at least 77%,at least 78%, at least 79%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, or at least 99% identical to oneof SEQ ID NOs: 67-83 and 427-1039. In one embodiment, compositioncomprises a protein comprising (1) an amino acid of one of SEQ IDNOs: 1-46; and (2) optionally an amino acid of one of SEQ ID NOs:67-83 and 427-1039.

[0328] In one embodiment, composition comprises a proteincomprising an amino acid sequence at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%identical to one of SEQ ID NOs: 150-171. In one embodiment, thenucleic acid sequence encoding a protein comprises a proteincomprising an amino acid sequence of one of SEQ ID NOs:150-171.

[0329] In one aspect, the present invention provides compositionsfor decreasing the number of an RNA transcript in a subject. In oneembodiment, the composition comprises a fusion protein, wherein thefusion protein comprises a CRISPR-associated (Cas) protein, afluorescent protein, and optionally a localization sequence, suchas an NLS, NES or organelle localization signal. In one embodiment,the crRNA substantially hybridizes to a target RNA sequence in theRNA transcript. In one embodiment, the composition comprises acrRNA array. In one embodiment, the crRNA array comprises two ormore sequences which substantially hybridizes to a target RNAsequence in the RNA transcript.

[0330] In one embodiment, the composition comprises a fusionprotein comprising (1) an amino acid sequence at least 70%, atleast 71%, at least 72%, at least 73%, at least 74%, at least 75%,at least 76%, at least 77%, at least 78%, at least 79%, at least80%, at least 81%, at least 82%, at least 83%, at least 84%, atleast 85%, at least 86%, at least 87%, at least 88%, at least 89%,at least 90%, at least 91%, at least 92%, at least 93%, at least94%, at least 95%, at least 96%, at least 97%, at least 98%, or atleast 99% identical to one of SEQ ID NOs: 47-48; (2) an amino acidsequence at least 70%, at least 71%, at least 72%, at least 73%, atleast 74%, at least 75%, at least 76%, at least 77%, at least 78%,at least 79%, at least 80%, at least 81%, at least 82%, at least83%, at least 84%, at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, or at least 99% identical to one of SEQ ID NOs:49-56; and (3) optionally an amino acid sequence at least 70%, atleast 71%, at least 72%, at least 73%, at least 74%, at least 75%,at least 76%, at least 77%, at least 78%, at least 79%, at least80%, at least 81%, at least 82%, at least 83%, at least 84%, atleast 85%, at least 86%, at least 87%, at least 88%, at least 89%,at least 90%, at least 91%, at least 92%, at least 93%, at least94%, at least 95%, at least 96%, at least 97%, at least 98%, or atleast 99% identical to one of SEQ ID NOs: 67-83 and 427-1039. Inone embodiment, composition comprises a fusion protein comprising(1) an amino acid of one of SEQ ID NOs: 47-48; (2) amino acid ofone of SEQ ID NOs: 49-56; and (3) an amino acid of one of SEQ IDNOs: 67-83 and 427-1039.

[0331] In one embodiment, composition comprises a fusion proteincomprising an amino acid sequence at least 70%, at least 71%, atleast 72%, at least 73%, at least 74%, at least 75%, at least 76%,at least 77%, at least 78%, at least 79%, at least 80%, at least81%, at least 82%, at least 83%, at least 84%, at least 85%, atleast 86%, at least 87%, at least 88%, at least 89%, at least 90%,at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99%identical to one of SEQ ID NOs: 84-149. In one embodiment, thenucleic acid sequence encoding a fusion protein comprises a proteincomprising an amino acid sequence of one of SEQ ID NOs: 84-149.

[0332] The disclosure also encompasses the use of pharmaceuticalcompositions of the disclosure to practice the methods of thedisclosure. Such a pharmaceutical composition may consist of atleast one modulator (e.g., inhibitor or activator) composition ofthe invention or a salt thereof in a form suitable foradministration to a subject, or the pharmaceutical composition maycomprise at least one modulator (e.g., inhibitor or activator)composition of the invention or a salt thereof, and one or morepharmaceutically acceptable carriers, one or more additionalingredients, or some combination of these. The compound of theinvention may be present in the pharmaceutical composition in theform of a physiologically acceptable salt, such as in combinationwith a physiologically acceptable cation or anion, as is well knownin the art.

[0333] In an embodiment, the pharmaceutical compositions useful forpracticing the methods of the invention may be administered todeliver a dose of between 1 ng/kg/day and 100 mg/kg/day. In anotherembodiment, the pharmaceutical compositions useful for practicingthe invention may be administered to deliver a dose of between 1ng/kg/day and 500 mg/kg/day.

[0334] The relative amounts of the active ingredient, thepharmaceutically acceptable carrier, and any additional ingredientsin a pharmaceutical composition of the invention will vary,depending upon the identity, size, and condition of the subjecttreated and further depending upon the route by which thecomposition is to be administered. By way of example, thecomposition may comprise between 0.1% and 100% (w/w) activeingredient.

[0335] Pharmaceutical compositions that are useful in the methodsof the invention may be suitably developed for oral, rectal,vaginal, parenteral, topical, pulmonary, intranasal, buccal,ophthalmic, or another route of administration. A compositionuseful within the methods of the invention may be directlyadministered to the skin, or any other tissue of a mammal. Othercontemplated formulations include liposomal preparations, resealederythrocytes containing the active ingredient, andimmunologically-based formulations. The route(s) of administrationwill be readily apparent to the skilled artisan and will dependupon any number of factors including the type and severity of thedisease being treated, the type and age of the veterinary or humansubject being treated, and the like.

[0336] The formulations of the pharmaceutical compositionsdescribed herein may be prepared by any method known or hereafterdeveloped in the art of pharmacology. In general, such preparatorymethods include the step of bringing the active ingredient intoassociation with a carrier or one or more other accessoryingredients, and then, if necessary or desirable, shaping orpackaging the product into a desired single- or multi-doseunit.

[0337] As used herein, a "unit dose" is a discrete amount of thepharmaceutical composition comprising a predetermined amount of theactive ingredient. The amount of the active ingredient is generallyequal to the dosage of the active ingredient that would beadministered to a subject or a convenient fraction of such a dosagesuch as, for example, one-half or one-third of such a dosage. Theunit dosage form may be for a single daily dose or one of multipledaily doses (e.g., about 1 to 4 or more times per day). Whenmultiple daily doses are used, the unit dosage form may be the sameor different for each dose.

[0338] In one embodiment, the compositions of the invention areformulated using one or more pharmaceutically acceptable excipientsor carriers. In one embodiment, the pharmaceutical compositions ofthe invention comprise a therapeutically effective amount of acompound or conjugate of the invention and a pharmaceuticallyacceptable carrier. Pharmaceutically acceptable carriers that areuseful, include, but are not limited to, glycerol, water, saline,ethanol and other pharmaceutically acceptable salt solutions suchas phosphates and salts of organic acids. Examples of these andother pharmaceutically acceptable carriers are described inRemington's Pharmaceutical Sciences (1991, Mack Publication Co.,New Jersey).

[0339] The carrier may be a solvent or dispersion mediumcontaining, for example, water, ethanol, polyol (for example,glycerol, propylene glycol, and liquid polyethylene glycol, and thelike), suitable mixtures thereof, and vegetable oils. The properfluidity may be maintained, for example, by the use of a coatingsuch as lecithin, by the maintenance of the required particle sizein the case of dispersion and by the use of surfactants. Preventionof the action of microorganisms may be achieved by variousantibacterial and antifungal agents, for example, parabens,chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. Inmany cases, isotonic agents, for example, sugars, sodium chloride,or polyalcohols such as mannitol and sorbitol are included in thecomposition. Prolonged absorption of the injectable compositionsmay be brought about by including in the composition an agent thatdelays absorption, for example, aluminum monostearate or gelatin.In one embodiment, the pharmaceutically acceptable carrier is notDMSO alone.

[0340] Formulations may be employed in admixtures with conventionalexcipients, i.e., pharmaceutically acceptable organic or inorganiccarrier substances suitable for oral, vaginal, parenteral, nasal,intravenous, subcutaneous, enteral, or any other suitable mode ofadministration, known to the art. The pharmaceutical preparationsmay be sterilized and if desired mixed with auxiliary agents, e.g.,lubricants, preservatives, stabilizers, wetting agents,emulsifiers, salts for influencing osmotic pressure buffers,coloring, flavoring and/or aromatic substances and the like. Theymay also be combined where desired with other active agents, e.g.,other analgesic agents.

[0341] As used herein, "additional ingredients" include, but arenot limited to, one or more of the following: excipients; surfaceactive agents; dispersing agents; inert diluents; granulating anddisintegrating agents; binding agents; lubricating agents;sweetening agents; flavoring agents; coloring agents;preservatives; physiologically degradable compositions such asgelatin; aqueous vehicles and solvents; oily vehicles and solvents;suspending agents; dispersing or wetting agents; emulsifyingagents, demulcents; buffers; salts; thickening agents; fillers;emulsifying agents; antioxidants; antibiotics; antifungal agents;stabilizing agents; and pharmaceutically acceptable polymeric orhydrophobic materials. Other "additional ingredients" that may beincluded in the pharmaceutical compositions of the invention areknown in the art and described, for example in Genaro, ed. (1985,Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton,Pa.), which is incorporated herein by reference.

[0342] The composition of the invention may comprise a preservativefrom about 0.005% to 2.0% by total weight of the composition. Thepreservative is used to prevent spoilage in the case of exposure tocontaminants in the environment. Examples of preservatives usefulin accordance with the invention included but are not limited tothose selected from the group consisting of benzyl alcohol, sorbicacid, parabens, imidurea and combinations thereof. An exemplarypreservative is a combination of about 0.5% to 2.0% benzyl alcoholand 0.05% to 0.5% sorbic acid.

[0343] In one embodiment, the composition includes an anti-oxidantand a chelating agent that inhibits the degradation of thecompound. Exemplary antioxidants for some compounds are BHT, BHA,alpha-tocopherol and ascorbic acid in the range of about 0.01% to0.3% and BHT in the range of 0.03% to 0.1% by weight by totalweight of the composition. In one embodiment, the chelating agentis present in an amount of from 0.01% to 0.5% by weight by totalweight of the composition. Exemplary chelating agents includeedetate salts (e.g. disodium edetate) and citric acid in the weightrange of about 0.01% to 0.20%. In some embodiments, the chelatingagent is in the range of 0.02% to 0.10% by weight by total weightof the composition. The chelating agent is useful for chelatingmetal ions in the composition that may be detrimental to the shelflife of the formulation. While BHT and disodium edetate areexemplary antioxidants and chelating agent respectively for somecompounds, other suitable and equivalent antioxidants and chelatingagents may be substituted therefore as would be known to thoseskilled in the art.

[0344] Liquid suspensions may be prepared using conventionalmethods to achieve suspension of the active ingredient in anaqueous or oily vehicle. Aqueous vehicles include, for example,water, and isotonic saline. Oily vehicles include, for example,almond oil, oily esters, ethyl alcohol, vegetable oils such asarachis, olive, sesame, or coconut oil, fractionated vegetableoils, and mineral oils such as liquid paraffin. Liquid suspensionsmay further comprise one or more additional ingredients including,but not limited to, suspending agents, dispersing or wettingagents, emulsifying agents, demulcents, preservatives, buffers,salts, flavorings, coloring agents, and sweetening agents. Oilysuspensions may further comprise a thickening agent. Knownsuspending agents include, but are not limited to, sorbitol syrup,hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone,gum tragacanth, gum acacia, and cellulose derivatives such assodium carboxymethylcellulose, methylcellulose,hydroxypropylmethylcellulose. Known dispersing or wetting agentsinclude, but are not limited to, naturally-occurring phosphatidessuch as lecithin, condensation products of an alkylene oxide with afatty acid, with a long chain aliphatic alcohol, with a partialester derived from a fatty acid and a hexitol, or with a partialester derived from a fatty acid and a hexitol anhydride (e.g.,polyoxyethylene stearate, heptadecaethyleneoxycetanol,polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitanmonooleate, respectively). Known emulsifying agents include, butare not limited to, lecithin, and acacia. Known preservativesinclude, but are not limited to, methyl, ethyl, orn-propyl-para-hydroxybenzoates, ascorbic acid, and sorbic acid.Known sweetening agents include, for example, glycerol, propyleneglycol, sorbitol, sucrose, and saccharin. Known thickening agentsfor oily suspensions include, for example, beeswax, hard paraffin,and cetyl alcohol.

[0345] Liquid solutions of the active ingredient in aqueous or oilysolvents may be prepared in substantially the same manner as liquidsuspensions, the primary difference being that the activeingredient is dissolved, rather than suspended in the solvent. Asused herein, an "oily" liquid is one which comprises acarbon-containing liquid molecule and which exhibits a less polarcharacter than water. Liquid solutions of the pharmaceuticalcomposition of the invention may comprise each of the componentsdescribed with regard to liquid suspensions, it being understoodthat suspending agents will not necessarily aid dissolution of theactive ingredient in the solvent. Aqueous solvents include, forexample, water, and isotonic saline. Oily solvents include, forexample, almond oil, oily esters, ethyl alcohol, vegetable oilssuch as arachis, olive, sesame, or coconut oil, fractionatedvegetable oils, and mineral oils such as liquid paraffin.

[0346] Powdered and granular formulations of a pharmaceuticalpreparation of the invention may be prepared using known methods.Such formulations may be administered directly to a subject, used,for example, to form tablets, to fill capsules, or to prepare anaqueous or oily suspension or solution by addition of an aqueous oroily vehicle thereto. Each of these formulations may furthercomprise one or more of dispersing or wetting agent, a suspendingagent, and a preservative. Additional excipients, such as fillersand sweetening, flavoring, or coloring agents, may also be includedin these formulations.

[0347] A pharmaceutical composition of the invention may also beprepared, packaged, or sold in the form of oil-in-water emulsion ora water-in-oil emulsion. The oily phase may be a vegetable oil suchas olive or arachis oil, a mineral oil such as liquid paraffin, ora combination of these. Such compositions may further comprise oneor more emulsifying agents such as naturally occurring gums such asgum acacia or gum tragacanth, naturally-occurring phosphatides suchas soybean or lecithin phosphatide, esters or partial estersderived from combinations of fatty acids and hexitol anhydridessuch as sorbitan monooleate, and condensation products of suchpartial esters with ethylene oxide such as polyoxyethylene sorbitanmonooleate. These emulsions may also contain additional ingredientsincluding, for example, sweetening or flavoring agents.

[0348] Methods for impregnating or coating a material with achemical composition are known in the art, and include, but are notlimited to methods of depositing or binding a chemical compositiononto a surface, methods of incorporating a chemical compositioninto the structure of a material during the synthesis of thematerial (i.e., such as with a physiologically degradablematerial), and methods of absorbing an aqueous or oily solution orsuspension into an absorbent material, with or without subsequentdrying.

[0349] The regimen of administration may affect what constitutes aneffective amount. The therapeutic formulations may be administeredto the subject either prior to or after a diagnosis of disease.Further, several divided dosages, as well as staggered dosages maybe administered daily or sequentially, or the dose may becontinuously infused, or may be a bolus injection. Further, thedosages of the therapeutic formulations may be proportionallyincreased or decreased as indicated by the exigencies of thetherapeutic or prophylactic situation.

[0350] Administration of the compositions of the present inventionto a subject, include a mammal, for example a human, may be carriedout using known procedures, at dosages and for periods of timeeffective to prevent or treat disease. An effective amount of thetherapeutic compound necessary to achieve a therapeutic effect mayvary according to factors such as the activity of the particularcompound employed; the time of administration; the rate ofexcretion of the compound; the duration of the treatment; otherdrugs, compounds or materials used in combination with thecompound; the state of the disease or disorder, age, sex, weight,condition, general health and prior medical history of the subjectbeing treated, and like factors well-known in the medical arts.Dosage regimens may be adjusted to provide the optimum therapeuticresponse. For example, several divided doses may be administereddaily, or the dose may be proportionally reduced as indicated bythe exigencies of the therapeutic situation. A non-limiting exampleof an effective dose range for a therapeutic compound of theinvention is from about 1 and 5,000 mg/kg of body weight/per day.One of ordinary skill in the art would be able to study therelevant factors and make the determination regarding the effectiveamount of the therapeutic compound without undueexperimentation.

[0351] The compound may be administered to a subject as frequentlyas several times daily, or it may be administered less frequently,such as once a day, once a week, once every two weeks, once amonth, or even less frequently, such as once every several monthsor even once a year or less. It is understood that the amount ofcompound dosed per day may be administered, in non-limitingexamples, every day, every other day, every 2 days, every 3 days,every 4 days, or every 5 days. For example, with every other dayadministration, a 5 mg per day dose may be initiated on Monday witha first subsequent 5 mg per day dose administered on Wednesday, asecond subsequent 5 mg per day dose administered on Friday, and soon. The frequency of the dose will be readily apparent to theskilled artisan and will depend upon any number of factors, suchas, but not limited to, the type and severity of the disease beingtreated, the type and age of the animal, etc.

[0352] Actual dosage levels of the active ingredients in thepharmaceutical compositions of this invention may be varied so asto obtain an amount of the active ingredient that is effective toachieve the desired therapeutic response for a particular subject,composition, and mode of administration, without being toxic to thesubject.

[0353] A medical doctor, e.g., physician or veterinarian, havingordinary skill in the art may readily determine and prescribe theeffective amount of the pharmaceutical composition required. Forexample, the physician or veterinarian could start doses of thecompounds of the invention employed in the pharmaceuticalcomposition at levels lower than that required in order to achievethe desired therapeutic effect and gradually increase the dosageuntil the desired effect is achieved.

[0354] In particular embodiments, it is especially advantageous toformulate the compound in dosage unit form for ease ofadministration and uniformity of dosage. Dosage unit form as usedherein refers to physically discrete units suited as unitarydosages for the subjects to be treated; each unit containing apredetermined quantity of therapeutic compound calculated toproduce the desired therapeutic effect in association with therequired pharmaceutical vehicle. The dosage unit forms of theinvention are dictated by and directly dependent on (a) the uniquecharacteristics of the therapeutic compound and the particulartherapeutic effect to be achieved, and (b) the limitations inherentin the art of compounding/formulating such a therapeutic compoundfor the treatment of a disease in a subject.

[0355] In one embodiment, the compositions of the invention areadministered to the subject in dosages that range from one to fivetimes per day or more. In another embodiment, the compositions ofthe invention are administered to the subject in range of dosagesthat include, but are not limited to, once every day, every two,days, every three days to once a week, and once every two weeks. Itwill be readily apparent to one skilled in the art that thefrequency of administration of the various combination compositionsof the invention will vary from subject to subject depending onmany factors including, but not limited to, age, disease ordisorder to be treated, gender, overall health, and other factors.Thus, the invention should not be construed to be limited to anyparticular dosage regime and the precise dosage and composition tobe administered to any subject will be determined by the attendingphysical taking all other factors about the subject intoaccount.

[0356] Compounds of the invention for administration may be in therange of from about 1 mg to about 10,000 mg, about 20 mg to about9,500 mg, about 40 mg to about 9,000 mg, about 75 mg to about 8,500mg, about 150 mg to about 7,500 mg, about 200 mg to about 7,000 mg,about 3050 mg to about 6,000 mg, about 500 mg to about 5,000 mg,about 750 mg to about 4,000 mg, about 1 mg to about 3,000 mg, about10 mg to about 2,500 mg, about 20 mg to about 2,000 mg, about 25 mgto about 1,500 mg, about 50 mg to about 1,000 mg, about 75 mg toabout 900 mg, about 100 mg to about 800 mg, about 250 mg to about750 mg, about 300 mg to about 600 mg, about 400 mg to about 500 mg,and any and all whole or partial increments there between.

[0357] In some embodiments, the dose of a compound of the inventionis from about 1 mg and about 2,500 mg. In some embodiments, a doseof a compound of the invention used in compositions describedherein is less than about 10,000 mg, or less than about 8,000 mg,or less than about 6,000 mg, or less than about 5,000 mg, or lessthan about 3,000 mg, or less than about 2,000 mg, or less thanabout 1,000 mg, or less than about 500 mg, or less than about 200mg, or less than about 50 mg. Similarly, in some embodiments, adose of a second compound (i.e., a drug used for treating the sameor another disease as that treated by the compositions of theinvention) as described herein is less than about 1,000 mg, or lessthan about 800 mg, or less than about 600 mg, or less than about500 mg, or less than about 400 mg, or less than about 300 mg, orless than about 200 mg, or less than about 100 mg, or less thanabout 50 mg, or less than about 40 mg, or less than about 30 mg, orless than about 25 mg, or less than about 20 mg, or less than about15 mg, or less than about 10 mg, or less than about 5 mg, or lessthan about 2 mg, or less than about 1 mg, or less than about 0.5mg, and any and all whole or partial increments thereof.

[0358] In one embodiment, the present invention is directed to apackaged pharmaceutical composition comprising a container holdinga therapeutically effective amount of a compound or conjugate ofthe invention, alone or in combination with a second pharmaceuticalagent; and instructions for using the compound or conjugate totreat, prevent, or reduce one or more symptoms of a disease in asubject.

[0359] The term "container" includes any receptacle for holding thepharmaceutical composition. For example, in one embodiment, thecontainer is the packaging that contains the pharmaceuticalcomposition. In other embodiments, the container is not thepackaging that contains the pharmaceutical composition, i.e., thecontainer is a receptacle, such as a box or vial that contains thepackaged pharmaceutical composition or unpackaged pharmaceuticalcomposition and the instructions for use of the pharmaceuticalcomposition. Moreover, packaging techniques are well known in theart. It should be understood that the instructions for use of thepharmaceutical composition may be contained on the packagingcontaining the pharmaceutical composition, and as such theinstructions form an increased functional relationship to thepackaged product. However, it should be understood that theinstructions may contain information pertaining to the compound'sability to perform its intended function, e.g., treating orpreventing a disease in a subject, or delivering an imaging ordiagnostic agent to a subject.

[0360] Routes of administration of any of the compositions of theinvention include oral, nasal, parenteral, sublingual, transdermal,transmucosal (e.g., sublingual, lingual, (trans)buccal, and(intra)nasal,), intravesical, intraduodenal, intragastrical,rectal, intra-peritoneal, subcutaneous, intramuscular, intradermal,intra-arterial, intravenous, or administration.

[0361] Suitable compositions and dosage forms include, for example,tablets, capsules, caplets, pills, gel caps, troches, dispersions,suspensions, solutions, syrups, granules, beads, transdermalpatches, gels, powders, pellets, magmas, lozenges, creams, pastes,plasters, lotions, discs, suppositories, liquid sprays for nasal ororal administration, dry powder or aerosolized formulations forinhalation, compositions and formulations for intravesicaladministration and the like. It should be understood that theformulations and compositions that would be useful in the presentinvention are not limited to the particular formulations andcompositions that are described herein.

Methods of Diagnosing & Visualizing RNA

[0362] In one aspect, the disclosure provides methods ofvisualizing an RNA in a subject. For example, in one embodiment,the methods provide visualization of a nuclear RNA in a subject. Inone embodiment, nuclear RNA is abnormal nuclear RNA. In oneembodiment, the methods provide visualization of cytoplasmic RNA ina subject. In one embodiment, the methods provide visualization ofan organelle-localized RNA in a subject. For example, in oneembodiment, the methods provide visualization of RNA localized inthe nucleolus, ribosome, vesicle, rough endoplasmic reticulum,Golgi apparatus, cytoskeleton, smooth endoplasmic reticulum,mitochondria, vacuole, cytosol, lysosome, or centriole. In oneembodiment, the methods provide visualization of cell-membraneassociated RNA. In one embodiment, methods provide visualization ofdecrease extracellular RNA.

[0363] In one embodiment, the method comprises (A) administering tothe subject (1) a nucleic acid molecule encoding a protein of thedisclosure comprising a Cas protein, a fluorescent protein, andoptionally a localization sequence, such as an NLS, NES ororganelle localization signal, or a fusion protein of thedisclosure comprising a Cas protein, a fluorescent protein, andoptionally a localization sequence, such as an NLS, NES, ororganelle localization signal; and (2) a nucleic acid moleculeencoding a crRNA or crRNA array comprising a targeting nucleotidesequence complimentary to a target RNA sequence in the RNA or acrRNA or crRNA array comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the RNA; and (B)visualizing the nuclear RNA.

[0364] In one embodiment, the method comprises (A) administering(1) a nucleic acid molecule encoding a protein of the disclosurecomprising a Cas protein, a fluorescent protein, and optionally alocalization sequence; and (2) a nucleic acid molecule encoding acrRNA or crRNA array comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the RNA or a crRNA orcrRNA array comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the RNA; and (B)visualizing the nuclear RNA.

[0365] In one embodiment, the method comprises (A) administering(1) a protein of the disclosure comprising a Cas protein, afluorescent protein, and optionally a localization sequence; and(2) a nucleic acid molecule encoding a crRNA or crRNA arraycomprising a targeting nucleotide sequence complimentary to atarget RNA sequence in the RNA or a crRNA or crRNA array comprisinga targeting nucleotide sequence complimentary to a target RNAsequence in the RNA; and (B) visualizing the nuclear RNA.

[0366] In one embodiment, the subject is a cell. In one embodiment,the cell is a prokaryotic cell or eukaryotic cell. In oneembodiment, the cell is a eukaryotic cell. In one embodiment, thecell is a plant, animal, or fungi cell. In one embodiment, the cellis a plant cell. In one embodiment, the cell is an animal cell. Inone embodiment, the cell is a yeast cell.

[0367] In one embodiment, the subject is a mammal. For example, inone embodiment, the subject is a human, non-human primate, dog,cat, horse, cow, goat, sheep, rabbit, pig, rat, or mouse. In oneembodiment, the subject is a non-mammalian subject. For example, inone embodiment, the subject is a zebrafish, fruit fly, orroundworm.

[0368] In one embodiment, the RNA is visualized in vitro. In oneembodiment, the RNA is visualized in vivo. In one embodiment, theRNA is nuclear RNA foci. In one embodiment, the crRNA comprises asequence complementary to a CTG repeat expansion in the 3'UTR ofthe human dystrophia myotonica-protein kinase (DMPK) gene. In oneembodiment, the crRNA comprises a sequence of one of SEQ IDNOs:348-354.

[0369] In one embodiment, the invention provides a method ofdiagnosing a disease or disorder associated with abnormal RNA. Inone embodiment, the abnormal RNA is nuclear RNA. In one embodiment,the abnormal RNA is nuclear RNA foci. In one embodiment, theabnormal RNA is cytoplasmic RNA. In one embodiment, the abnormalRNA is organelle-localized RNA. For example, in one embodiment, theabnormal RNA is localized in the nucleolus, ribosome, vesicle,rough endoplasmic reticulum, Golgi apparatus, cytoskeleton, smoothendoplasmic reticulum, mitochondria, vacuole, cytosol, lysosome, orcentriole. In one embodiment, the abnormal RNA is cell-membraneassociated RNA. In one embodiment, abnormal RNA is extracellularRNA.

[0370] In one embodiment, the method comprises (A) administering tothe subject (1) a nucleic acid molecule encoding a protein of thedisclosure comprising a Cas protein, a fluorescent protein, andoptionally a localization sequence, such as an NLS, NES ororganelle localization signal, or a fusion protein of thedisclosure comprising a Cas protein, a fluorescent protein, andoptionally a localization sequence, such as an NLS, NES, ororganelle localization signal; and (2) a nucleic acid moleculeencoding a crRNA or crRNA array comprising a targeting nucleotidesequence complimentary to a target RNA sequence in the abnormal RNAor a crRNA or crRNA array comprising a targeting nucleotidesequence complimentary to a target RNA sequence in the abnormalRNA; (B) visualizing the nuclear RNA; and (C) diagnosing thedisease or disorder when the abnormal RNA is present.

[0371] In one embodiment, the method comprises (A) administering tothe subject (1) a nucleic acid molecule encoding a protein of thedisclosure comprising a Cas protein, a fluorescent protein, andoptionally a localization sequence, such as an NLS, NES ororganelle localization signal; and (2) a nucleic acid moleculeencoding a crRNA or crRNA array comprising a targeting nucleotidesequence complimentary to a target RNA sequence in the abnormal RNAor a crRNA or crRNA array comprising a targeting nucleotidesequence complimentary to a target RNA sequence in the abnormalRNA; (B) visualizing the nuclear RNA; and (C) diagnosing thedisease or disorder when the abnormal RNA is present.

[0372] In one embodiment, the method comprises (A) administering tothe subject (1) a protein of the disclosure comprising a Casprotein, a fluorescent protein, and optionally a localizationsequence, such as an NLS, NES or organelle localization signal; and(2) a nucleic acid molecule encoding a crRNA or crRNA arraycomprising a targeting nucleotide sequence complimentary to atarget RNA sequence in the abnormal RNA or a crRNA or crRNA arraycomprising a targeting nucleotide sequence complimentary to atarget RNA sequence in the abnormal RNA; (B) visualizing thenuclear RNA; and (C) diagnosing the disease or disorder when theabnormal RNA is present.

[0373] In one embodiment, the subject is a cell. In one embodiment,the cell is a prokaryotic cell or eukaryotic cell. In oneembodiment, the cell is a eukaryotic cell. In one embodiment, thecell is a plant, animal, or fungi cell. In one embodiment, the cellis a plant cell. In one embodiment, the cell is an animal cell. Inone embodiment, the cell is a yeast cell.

[0374] In one embodiment, the subject is a mammal. For example, inone embodiment, the subject is a human, non-human primate, dog,cat, horse, cow, goat, sheep, rabbit, pig, rat, or mouse. In oneembodiment, the subject is a non-mammalian subject. For example, inone embodiment, the subject is a zebrafish, fruit fly, orroundworm.

Methods of Decreasing RNA & Methods of Treatment

[0375] In one aspect, the disclosure provides methods of decreasingthe number of an RNA in a subject. For example, in one embodiment,the methods decrease the number of a nuclear RNA in a subject. Inone embodiment, nuclear RNA is abnormal nuclear RNA. In oneembodiment, the methods decrease the number of a cytoplasmic RNA ina subject. In one embodiment, the methods decrease the number of anorganelle-localized RNA in a subject. For example, in oneembodiment, the methods decrease RNA localized in the nucleolus,ribosome, vesicle, rough endoplasmic reticulum, Golgi apparatus,cytoskeleton, smooth endoplasmic reticulum, mitochondria, vacuole,cytosol, lysosome, or centriole. In one embodiment, the methodsdecrease cell-membrane associated RNA. In one embodiment, themethods decrease extracellular RNA.

[0376] In one embodiment, the method comprises administering to thesubject (1) a nucleic acid molecule encoding a fusion protein ofthe disclosure comprising a Cas protein and optionally alocalization sequence, such as an NLS, NES or organellelocalization signal, or a fusion protein of the disclosurecomprising a Cas protein and optionally a localization sequence,such as an NLS, NES, or organelle localization signal; and (2) anucleic acid molecule encoding a crRNA or crRNA array comprising atargeting nucleotide sequence complimentary to a target RNAsequence in the RNA or a crRNA or crRNA array comprising atargeting nucleotide sequence complimentary to a target RNAsequence in the RNA.

[0377] In one embodiment, the method comprises administering to thesubject (1) a nucleic acid molecule encoding a fusion protein ofthe disclosure comprising a Cas protein and optionally alocalization sequence, such as an NLS, NES or organellelocalization signal; and (2) a nucleic acid molecule encoding acrRNA or crRNA array comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the RNA or a crRNA orcrRNA array comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the RNA.

[0378] In one embodiment, the method comprises administering to thesubject (1) a fusion protein of the disclosure comprising a Casprotein and optionally a localization sequence, such as an NLS, NESor organelle localization signal; and (2) a nucleic acid moleculeencoding a crRNA or crRNA array comprising a targeting nucleotidesequence complimentary to a target RNA sequence in the RNA or acrRNA or crRNA array comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the RNA.

[0379] In some embodiments, the RNA cytoplasmic. In suchembodiments, the method comprises administering to the subject (1)a protein of the disclosure comprising a Cas protein or a nucleicacid molecule encoding a protein of the disclosure comprising a Casprotein; and (2) a nucleic acid molecule encoding a crRNAcomprising a targeting nucleotide sequence complimentary to atarget RNA sequence, or a crRNA comprising a targeting nucleotidesequence complimentary to a target RNA sequence.

[0380] In some embodiments, the RNA cytoplasmic. In suchembodiments, the method comprises administering to the subject (1)a protein of the disclosure comprising a Cas protein and a NES or anucleic acid molecule encoding a protein of the disclosurecomprising a Cas protein and a NES; and (2) a nucleic acid moleculeencoding a crRNA comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence, or a crRNA comprising atargeting nucleotide sequence complimentary to a target RNAsequence

[0381] In some embodiments, the RNA nuclear. In such embodiments,the method comprises administering to the subject (1) a protein ofthe disclosure comprising a Cas protein and a NLS or a nucleic acidmolecule encoding a protein of the disclosure comprising a Casprotein and a NLS; and (2) a nucleic acid molecule encoding a crRNAcomprising a targeting nucleotide sequence complimentary to atarget RNA sequence, or a crRNA comprising a targeting nucleotidesequence complimentary to a target RNA sequence

[0382] In one embodiment, the subject is a cell. In one embodiment,the cell is a prokaryotic cell or eukaryotic cell. In oneembodiment, the cell is a eukaryotic cell. In one embodiment, thecell is a plant, animal, or fungi cell. In one embodiment, the cellis a plant cell. In one embodiment, the cell is an animal cell. Inone embodiment, the cell is a yeast cell.

[0383] In one embodiment, the subject is a mammal. For example, inone embodiment, the subject is a human, non-human primate, dog,cat, horse, cow, goat, sheep, rabbit, pig, rat, or mouse. In oneembodiment, the subject is a non-mammalian subject. For example, inone embodiment, the subject is a zebrafish, fruit fly, orroundworm.

[0384] In one embodiment, the amount of nuclear RNA is reduced invitro. In one embodiment, the amount of nuclear RNA is reduced invivo.

[0385] In one embodiment, the nuclear RNA is nuclear RNA foci. Inone embodiment, the nuclear RNA foci include a CUG repeat. In oneembodiment, the crRNA comprises a sequence complementary to a CUGrepeat expansion. In one embodiment, the crRNA comprises a sequencecomplementary to a CTG repeat expansion. In one embodiment, thecrRNA comprises a sequence complementary to a CTG repeat expansionin the 3'UTR of the human dystrophia myotonica-protein kinase(DMPK) gene. In one embodiment, the crRNA comprises a sequence ofone of SEQ ID NOs:348-354.

[0386] In one aspect, the present invention provides methods oftreating a subject with a disease or disorder associated withabnormal RNA. In one embodiment, the method comprises administeringto the subject (1) a nucleic acid molecule encoding a protein ofthe disclosure comprising a Cas protein and optionally alocalization sequence, such as an NLS, NES or organellelocalization signal, or a protein of the disclosure comprising aCas protein and optionally a localization sequence, such as an NLS,NES, or organelle localization signal; and (2) a nucleic acidmolecule encoding crRNA comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the nuclear RNA or acrRNA molecule comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the nuclear RNA.

[0387] In one embodiment, the method comprises administering to thesubject (1) a nucleic acid molecule encoding a protein of thedisclosure comprising a Cas protein and optionally a localizationsequence, such as an NLS, NES or organelle localization signal; and(2) a nucleic acid molecule encoding crRNA comprising a targetingnucleotide sequence complimentary to a target RNA sequence in thenuclear RNA or a crRNA molecule comprising a targeting nucleotidesequence complimentary to a target RNA sequence in the nuclearRNA.

[0388] In one embodiment, the method comprises administering to thesubject (1) a protein of the disclosure comprising a Cas proteinand optionally a localization sequence, such as an NLS, NES ororganelle localization signal; and (2) a nucleic acid moleculeencoding crRNA comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the nuclear RNA or acrRNA molecule comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the nuclear RNA.

[0389] In one embodiment, the disease or disorder associated withabnormal nuclear RNA is selected from the group consisting ofMyotonic Dystrophy type 2 (DM2), Amyotrophic lateral sclerosis(ALS), Huntington's disease-like 2 (HDL2), Spinocerebellar ataxias8, 31 and 10 (SCAB, -31, -10) and fragile X-associated tremorataxia syndrome (FXTAS).

[0390] In one embodiment, the abnormal nuclear RNA is toxic nuclearRNA foci. In one embodiment, the disease or disorder associatedwith toxic nuclear RNA foci Myotonic Dystrophy type 1. In oneembodiment, the crRNA comprises a sequence complementary to a CTGrepeat expansion in the 3'UTR of the human dystrophiamyotonica-protein kinase (DMPK) gene. In one embodiment, the crRNAcomprises a sequence selected from the group consisting of SEQ IDNOs: 348-354.

[0391] In one aspect, the present invention provides methodscleaving of a target RNA in a subject. In one embodiment, themethod comprises administering to the subject (1) a nucleic acidmolecule encoding a protein of the disclosure comprising a Casprotein and optionally a localization sequence, such as an NLS,NES, or organelle localization signal, or a protein of thedisclosure comprising a Cas protein and optionally a localizationsequence, such as an NLS, NES, or organelle localization signal;and (2) a nucleic acid molecule encoding crRNA comprising atargeting nucleotide sequence complimentary to a RNA sequence inthe target RNA or a crRNA molecule comprising a targetingnucleotide sequence complimentary to a target RNA sequence in thetarget RNA.

[0392] In one embodiment, the method comprises administering to thesubject (1) a nucleic acid molecule encoding a protein of thedisclosure comprising a Cas protein and optionally a localizationsequence, such as an NLS, NES, or organelle localization signal;and (2) a nucleic acid molecule encoding crRNA comprising atargeting nucleotide sequence complimentary to a RNA sequence inthe target RNA or a crRNA molecule comprising a targetingnucleotide sequence complimentary to a target RNA sequence in thetarget RNA.

[0393] In one embodiment, the method comprises administering to thesubject (1) a protein of the disclosure comprising a Cas proteinand optionally a localization sequence, such as an NLS, NES, ororganelle localization signal; and (2) a nucleic acid moleculeencoding crRNA comprising a targeting nucleotide sequencecomplimentary to a RNA sequence in the target RNA or a crRNAmolecule comprising a targeting nucleotide sequence complimentaryto a target RNA sequence in the target RNA.

[0394] In one aspect, the present invention provides methods oftreating a disease or disorder associated with increased geneexpression. In one embodiment, the method comprises administeringto the subject (1) a nucleic acid molecule encoding a protein ofthe disclosure comprising a Cas protein and optionally alocalization sequence, such as an NLS, NES, or organellelocalization signal, or a protein of the disclosure comprising aCas protein and optionally a localization sequence, such as an NLS,NES, or organelle localization signal; and (2) a nucleic acidmolecule encoding crRNA comprising a targeting nucleotide sequencecomplimentary to a RNA sequence in the RNA transcript of the geneor a crRNA molecule comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the RNA transcript of thegene.

[0395] In one embodiment, the method comprises administering to thesubject (1) a nucleic acid molecule encoding a protein of thedisclosure comprising a Cas protein and optionally a localizationsequence, such as an NLS, NES, or organelle localization signal;and (2) a nucleic acid molecule encoding crRNA comprising atargeting nucleotide sequence complimentary to a RNA sequence inthe RNA transcript of the gene or a crRNA molecule comprising atargeting nucleotide sequence complimentary to a target RNAsequence in the RNA transcript of the gene.

[0396] In one embodiment, the method comprises administering to thesubject (1) a protein of the disclosure comprising a Cas proteinand optionally a localization sequence, such as an NLS, NES, ororganelle localization signal; and (2) a nucleic acid moleculeencoding crRNA comprising a targeting nucleotide sequencecomplimentary to a RNA sequence in the RNA transcript of the geneor a crRNA molecule comprising a targeting nucleotide sequencecomplimentary to a target RNA sequence in the RNA transcript of thegene.

[0397] In one aspect, the present invention provides methods oftreating a disease or disorder associated with RNA. For example, inone embodiment, the invention provides a method of treating an RNAvirus infection. In one embodiment, the method comprisesadministering to the subject (1) a nucleic acid molecule encoding aprotein of the disclosure comprising a Cas protein and optionally alocalization sequence, such as an NLS, NES, or organellelocalization signal, or a protein of the disclosure comprising aCas protein and optionally a localization sequence, such as an NLS,NES, or organelle localization signal; and (2) a nucleic acidmolecule encoding crRNA comprising a targeting nucleotide sequencecomplimentary to a RNA sequence in the viral RNA or a crRNAmolecule comprising a targeting nucleotide sequence complimentaryto a target RNA sequence in the viral RNA. In one embodiment, theCas protein binds the crRNA, the crRNA binds a target RNA sequence,and Cas cleaves the RNA sequence thereby preventing translation andexpression of viral protein.

[0398] In one embodiment, the method comprises administering to thesubject (1) a nucleic acid molecule encoding a protein of thedisclosure comprising a Cas protein and optionally a localizationsequence, such as an NLS, NES, or organelle localization signal;and (2) a nucleic acid molecule encoding crRNA comprising atargeting nucleotide sequence complimentary to a RNA sequence inthe viral RNA or a crRNA molecule comprising a targeting nucleotidesequence complimentary to a target RNA sequence in the viralRNA.

[0399] In one embodiment, the method comprises administering to thesubject (1) a protein of the disclosure comprising a Cas proteinand optionally a localization sequence, such as an NLS, NES, ororganelle localization signal; and (2) a nucleic acid moleculeencoding crRNA comprising a targeting nucleotide sequencecomplimentary to a RNA sequence in the viral RNA or a crRNAmolecule comprising a targeting nucleotide sequence complimentaryto a target RNA sequence in the viral RNA.

Methods of Treatment and Use

[0400] The present invention provides methods of treating, reducingthe symptoms of, and/or reducing the risk of developing a diseaseor disorder in a subject. For example, in one embodiment, methodsof the invention of treat, reduce the symptoms of, and/or reducethe risk of developing a disease or disorder in a mammal. In oneembodiment, the methods of the invention of treat, reduce thesymptoms of, and/or reduce the risk of developing a disease ordisorder in a plant. In one embodiment, the methods of theinvention of treat, reduce the symptoms of, and/or reduce the riskof developing a disease or disorder in a yeast organism.

[0401] In one embodiment, the subject is a cell. In one embodiment,the cell is a prokaryotic cell or eukaryotic cell. In oneembodiment, the cell is a eukaryotic cell. In one embodiment, thecell is a plant, animal, or fungi cell. In one embodiment, the cellis a plant cell. In one embodiment, the cell is an animal cell. Inone embodiment, the cell is a yeast cell.

[0402] In one embodiment, the subject is a mammal. For example, inone embodiment, the subject is a human, non-human primate, dog,cat, horse, cow, goat, sheep, rabbit, pig, rat, or mouse. In oneembodiment, the subject is a non-mammalian subject. For example, inone embodiment, the subject is a zebrafish, fruit fly, orroundworm.

[0403] In one embodiment, the disease or disorder is caused by oneor more mutations in a genomic locus. Thus, in one embodiment, thedisease or disorder is may be treated, reduced, or the risk can bereduced via an element that prevents or reduces mRNA transcript, orprevents or reduces translation of the protein. Thus, in oneembodiment, the method comprises manipulation of an RNAtranscript.

[0404] In one embodiment, the disease or disorder is caused byabnormal RNA. Thus, in one embodiment, the disease or disorder ismay be treated, reduced, or the risk can be reduced via an elementthat prevents or reduces RNA transcript. Thus, in one embodiment,the method comprises manipulation of an RNA transcript.

[0405] In one embodiment, the method comprises administering to thesubject (1) a protein of the disclosure or a nucleic acid moleculeencoding a protein of the disclosure, and (2) one or crRNAcomprising a targeting nucleotide sequence complimentary to atarget region in a gene, wherein the gene encodes the RNAtranscript. In one embodiment, the Cas protein cleaves the RNAtranscript. In one embodiment, the method comprises administeringto the subject (1) a protein of the disclosure or a nucleic acidmolecule encoding a protein of the disclosure, and (2) one or crRNAcomprising a sequence complimentary to a target region in an RNAtranscript. In one embodiment, the Cas protein cleaves the RNAtranscript.

[0406] In one embodiment, the disease or disorder is associatedwith abnormal RNA or increased RNA transcription. For example, inone embodiment, the disease or disorder is an endocrine disease.For example, in one embodiment, endocrine diseases include but arenot limited to, .beta.-thalassemias, neonatal diabetes, IPEXsyndrome, Mayer-Rokitanski-Kuster-Hausersyndrome,Hypothalamic-pituitary-adrenal axis dysregulation, Adrenaldysfunction, Gonadal dysfunction, Ectopic Cushing syndrome,Pre-eclampsia, Diabetic nephropathy, Type I diabetes, Type IIdiabetes, and IGF-1 deficiency.

[0407] In one embodiment, the disease or disorder is a tumorigenicdisease. For example, in one embodiment, tumorigenic diseasesinclude but are not limited to, mantle cell lymphoma, hereditary& sporadic parathyroid tumors, Medullary thyroid carcinoma,poliverative conditions, colorectal cancer, gliblastoma, Chroniclymphocytic leukemia, and Breast cancer.

[0408] In one embodiment, the disease or disorder is a neurologicaldisease or disorder. For example, in one embodiment, neurologicaldiseases include but are not limited to, Parkinsons diseases,Oculopharyngeal muscular dystrophy, Huntington's disease, Fabrydisease, Fragile X syndrome, spinal muscular atrophy, AmyotrophicLateral Sclerosis, Spinocerebellar ataxia Spinocerebellar ataxia 1,Spinocerebellar ataxia 2, Spinocerebellar ataxia 3, Spinocerebellarataxia 6, Spinocerebellar ataxia 7, Spinocerebellar ataxia 8,Spinocerebellar ataxia 10, Spinocerebellar ataxia 17,Spinocerebellar ataxia 31, and Alzheimer's disease.

[0409] In one embodiment, the disease or disorder is ahematological disease or disorder. For example, in one embodiment,hematological diseases include but are not limited to,.beta.-Thalassemia, and .alpha.-Thalassemia.

[0410] In one embodiment, the disease or disorder is an infectionor immunological disease or disorder. For example, in oneembodiment, infection or immunological diseases include but are notlimited to, B-cell differentiation, T-cell activation, systemiclupus erythematosus, Wiskott-Aldrich syndrome, Osteoarthritis,scleroderma, and IPEX syndrome.

[0411] In one embodiment, the disease or disorder is amusculoskeletal disease or disorder. For example, in oneembodiment, infection or immunological diseases include Myotonicdystrophy type 1, Spinal and bulbar muscular atrophy, andDentatorubral-pallidoluysian atrophy.

[0412] Exemplary diseases or disorders and corresponding targetsinclude, but are not limited to those listed in Table 1. Additionaldiseases and disorders and corresponding genes are known in theart, for example in Rehfeld et al., Alternations in Polyadenylationand its Implications for Endocrine Disease, Front. Endocrinol. 4:53(2013), Chang et al., Alternative Polyadenylation in HumanDiseases, Endocrinol Metab. 32:413-421 (2017), and Curinha et al.,Implications of polyadenylation in health and disease, Nucleus5:508-519 (2014), which are herein incorporated by reference intheir entireties.

TABLE-US-00001 TABLE 1 Diseases or disorders and target geneCondition Target Adrenal dysfunction STAR Alzheimer's diseaseABCA3, EIF2B3, MSTO2P, OGDHL, PARP6, SLC33A1, SUPV3L1, TAF3,WASH7P, JAK1, ABCA3, UBR1, ALDOC, C10ord10, GABARAPL2, KAT2A,POLR3A, SH3BGRL2, TIMM23, TMC6, UNC80, WTAP Amyotrophic LateralSclerosis ALS (GGGGCC repeat), CCDC92, CRYAB, MAP7D2, PRPH, RTN4,SEC22B, SNAP25, UCHL1, YWHAB, C14ord2, C6orf203, ALDOC, ARL6IP1,CSDE1, CMC2, GAP43, LDHB, MLLT11, NCL, PFN2, TMOD1, VAMP1 B-celldifferentiation IGHM Breast cancer Cancer, Colorectal DMKN, PDXK,PPIE Cancer, Various TP53 Chronic lymphocytic leukaemia Intronicloci Colorectal cancer DMKN, PDXK, PPIEDentatorubral-pallidoluysian atrophy DRPLA (CAG repeat) Diabeticnephropathy HGRG-14 Ectopic Cushing syndrome ACTH Fabry disease.alpha.-GalA Fragile X Syndrome FMR1, FXTAS (CGG repeat)Friedreich's Ataxia YSH1 Glioblastoma CCND1, MECP2 Gonadaldysfunction STAR Huntington's disease HTT, HD (CAG repeat)Huntington's disease-like 2 HDL2 (CTG repeat)Hypothalamic-pituitary-adrenal axis SERT dysregulation IGF-1deficiency IGF-1 IPEX syndrome FOP3 Mayer-Rokitanski-Kuster- AMHHausersyndrome Myotonic Dystrophy Type I DMPK, DM1 (CTG Repeat),DM2 (CCTG repeat) Myotonic Dystrophy Type II ZFN9 Neonatal diabetesINS Oculopharyngeal muscular dystrophy CCND1, PABPN1 Parkinsondisease SNCA Pre-eclampsia SFLT-1 Proliferative conditions RBX1Spinal Muscular Atrophy SMN Spinocerebellar Ataxia 1 ATXN1, SCA1(CAG repeat) Spinocerebellar Ataxia 10 ATXN10, SCA10 (ATTCT repeat)Spinocerebellar Ataxia 17 TATA-box binding protein, SCA17 (CAGrepeat) Spinocerebellar Ataxia 2 ATXN2, SCA2 (CAG repeat)Spinocerebellar Ataxia 3 ATXN3, SCA3 (CAG repeat) SpinocerebellarAtaxia 31 BEAN1, SCA31 (TGGA repeat) Spinocerebellar Ataxia 6CACNA1A, SCA6 (CAG repeat) Spinocerebellar Ataxia 7 TPP1, SCA7 (CAGrepeat) Spinocerebellar Ataxia 8 ATXN8OS, SCA8 (CTG/CAG repeat)Spinal and bulbar muscular atrophy SBMA (CAG repeat)Steroidogenesis STAR Systemic lupus erythematosus GIMAP5, IRF5T-cell activation NF-ATC1 Thrombophilia F2 Type I diabetes GIMAP5Type II diabetes TCF7L2 Wiskott-Aldrich Syndrome WAS.alpha.-Thalassemia HBA1, HBA2 .beta.-Thalassemia HBB

[0413] In one embodiment, the disease or disorder is a viralinfection. Thus, in one embodiment, the disease or disorder is maybe treated, reduced, or the risk can be reduced via an element thatprevents or reduces viral mRNA transcript, or prevents or reducestranslation of viral protein. Thus, in one embodiment, the methodcomprises manipulation of a viral RNA transcript.

[0414] In one embodiment, the method comprises administering to thesubject (1) a protein of the disclosure or a nucleic acid moleculeencoding a protein of the disclosure, and (2) one or more crRNAcomprising a nucleotide sequence complimentary to a viral RNAtranscript. In one embodiment, the Cas protein cleaves the viralRNA transcript.

[0415] In one embodiment, the virus is an RNA virus. In oneembodiment, the virus produces RNA during its lifecycle. In oneembodiment, the virus is a human virus, a plant virus or an animalvirus. Exemplary viruses include, but are not limited to, virusesof families Adenoviridae, Adenoviridae, Alphaflexiviridae,Anelloviridae, Arenavirus, Arteriviridae, Asfarviridae,Astroviridae, Benyviridae, Betaflexiviridae, Birnaviridae,Bornaviridae, Bromoviridae, Caliciviridae, Caulimoviridae,Circoviridae, Closteroviridae, Coronaviridae, Filoviridae,Flaviviridae, Geminiviridae, Hantaviridae, Hepadnaviridae,Hepeviridae, Herpesviridae, Kitaviridae, Luteoviridae,Nairoviridae, Nanoviridae, Nimaviridae, Orthomyxoviridae,Paramyxoviridae, Phenuiviridae, Picornaviridae, Polyomaviridae,Pospiviridae, Potyviridae, Poxviridae, Reoviridae, Retroviridae,Retrovirus, Rhabdoviridae, Secoviridae, Togaviridae, Tombusviridae,Tospoviridae, Tymoviridae, and Virgaviridae. For example, exemplaryviruses include, but are not limited to, African swine fever, Avianhepatitis E, Avian infectious laryngotracheitis, Avian nephritisvirus, Bamboo mosaic virus, Banana bunchy top virus, Barley stripemosaic virus, Barley yellow dwarf virus, Potato leafroll virus,Borna disease, Brome mosaic virus, wheat, Cauliflower mosaic virus,Chikungunya, Eastern equine encephalitis virus, Citrus leprosis,Citrus sudden death associated virus, Citrus tristeza virus,Coconut cadang-cadang viroid, Curly top virus, African cassavamosaic virus, Cytomegalovirus, Epstein-Barr virus, Dengue, Yellowfever, West Nile, Zika, Ebola virus, Marburg virus, Equinearteritis virus, Porcine reproductive and respiratory syndromevirus, Equine infectious anemia, Foot and mouth disease, Foot andmouth disease, Enteroviruses, Rhinoviruses, Hepatitis B virus,Hepatitis E virus, HIV, HIV-1, HIV-2, Infectious bursal diseasevirus (poultry), Infectious pancreatic necrosis (salmon),Infectious canine hepatitis, aviadenoviruses of fowl, Influenzaviruses, Lassa virus, Lymphocytic choriomeningitis virus,Monkeypox, Nairobi sheep disease, Newcastle disease virus(poultry), Norwalk virus, Numerous examples of crop damagingviruses, including Potato virus Y, Porcine circovirus 2, Beak andfeather disease virus (poultry), Potato virus M, Rabies virus,Respiratory and enteric adenoviruses, Respiratory syncytial virus,Rice stripe necrosis virus, Rift Valley fever, rotaviruses,SARS-CoV-2, MERS, Sheeppox virus, Lumpy skin disease virus, SinNombre virus, Andes virus, SV40, Tobacco ringspot virus, Tomatobushy stunt virus, Tomato spotted wilt virus, Torque teno virus,Venezuelan equine encephalitis virus, Vesicular stomatitis Indianavirus, Viral hemorrhagic septicemia (trout), and White spotsyndrome virus (shrimp).

[0416] In one embodiment, exemplary viruses include, but are notlimited to, Primate T-lymphotropic virus 1, Primate T-lymphotropicvirus 2, Primate T-lymphotropic virus 3, Human immunodeficiencyvirus 1, Human immunodeficiency virus 2, Simian foamy virus, Humanpicobirnavirus, Colorado tick fever virus, Changuinola virus, GreatIsland virus, Lebombo virus, Orungo virus, Rotavirus A, RotavirusB, Rotavirus C, Banna virus, Borna disease virus, Lake VictoriaMarburgvirus, Reston ebolavirus, Sudan ebolavirus, Tai forestebolavirus, Zaire virus, Human parainfluenza virus 2, Humanparainfluenza virus 4, Mumps virus, Newcastle disease virus, Humanparainfluenza virus 1, Human parainfluenza virus 3, Hendra virus,Nipah virus, Measles virus, Human respiratory syncytial virus,Human metapneumovirus, Chandipura virus, Isfahan virus, Piry virus,Vesicular stomatitis Alagoas virus, Vesicular stomatitis Indianavirus, Vesicular stomatitis New Jersey virus, Australian batlyssavirus, Duvenhage virus, European bat lyssavirus 1, Europeanbat lyssavirus 2, Mokola virus, Rabies virus, Guanarito virus,Junin virus, Lassa virus, Lymphocytic choriomeningitis virus,Machupo virus, Pichinde virus, Sabia virus, Whitewater Arroyovirus, Bunyamwera virus, Bwamba virus, California encephalitisvirus, Caraparu virus, Catu virus, Guama virus, Guaroa virus, Kairivirus, Marituba virus, Oriboca virus, Oropouche virus, Shuni virus,Tacaiuma virus, Wyeomyia virus, Andes virus, Bayou virus, Blackcreek canal virus, Dobrava-Belgrade virus, Hantaan virus, LagunaNegra virus, New York virus, Puumala virus, Seoul virus, Sin Nombrevirus, Crimean-Congo haemorrhagic fever virus, Dugbe virus, Candiruvirus, Punta Toro virus, Rift Valley fever virus, Sandfly feverNaples virus, Influenza A virus, Influenza B virus, Influenza Cvirus, Dhori virus, Thogoto virus, Hepatitis delta virus, Humancoronavirus 229E, Human coronavirus NL63, Human coronavirus HKU1,Human coronavirus OC43, SARS coronavirus, Human torovirus, Humanenterovirus A, Human enterovirus B, Human enterovirus C, Humanenterovirus D, Human rhinovirus A, Human rhinovirus B, Humanrhinovirus C, Encephalomyocarditis virus, Theilovirus, Equinerhinitis A virus, Foot and mouth disease virus, Hepatitis A virus,Human parechovirus, Ljungan virus, Aichi virus, Human astrovirus,Human astrovirus 2, Human astrovirus 3, Human astrovirus 4, Humanastrovirus 5, Human astrovirus 6, Human astrovirus 7, Humanastrovirus 8, Norwalk virus, Sapporo virus, Aroa virus, Banzivirus, Dengue virus, Ilheus virus, Japanese encephalitis virus,Kokobera virus, Kyasanur forest disease virus, Louping ill virus,Murray Valley encephalitis virus, Ntaya virus, Omsk haemorrhagicfever virus, Powassan virus, Rio Bravo virus, St Louis encephalitisvirus, Tick-borne encephalitis virus, Usutu virus, Wesselsbronvirus, West Nile virus, Yellow fever virus, Zika virus, Hepatitis Cvirus, Hepatitis E virus, Barmah Forest virus, Chikungunya virus,Eastern equine encephalitis virus, Everglades virus, Getah virus,Mayaro virus, Mucambo virus, O'nyong-nyong virus, Pixuna virus,Ross River virus, Semliki Forest virus, Sindbis virus, Venezuelanequine encephalitis virus, Western equine encephalitis virus,Whataroa virus, Rubella virus.

[0417] In one embodiment, exemplary viruses include, but are notlimited to, Ranid herpesvirus 1, Ranid herpesvirus 2, Ranidherpesvirus 3, Anguillid herpesvirus 1, Cyprinid herpesvirus 1,Cyprinid herpesvirus 2, Cyprinid herpesvirus 3, Acipenseridherpesvirus 2, Ictalurid herpesvirus 1, Ictalurid herpesvirus 2,Salmonid herpesvirus 1, Salmonid herpesvirus 2, Salmonidherpesvirus 3, Gallid alphaherpesvirus 1, Psittacidalphaherpesvirus 1, Anatid alphaherpesvirus 1, Columbidalphaherpesvirus 1, Gallid alphaherpesvirus 2, Gallidalphaherpesvirus 3, Meleagrid alphaherpesvirus 1, Spheniscidalphaherpesvirus 1, Chelonid alphaherpesvirus 5, Testudinidalphaherpesvirus 3, Ateline alphaherpesvirus 1, Bovinealphaherpesvirus 2, Cercopithecine alphaherpesvirus 2, Humanalphaherpesvirus 1, Human alphaherpesvirus 2, Leporidalphaherpesvirus 4, Macacine alphaherpesvirus 1, Macropodidalphaherpesvirus 1, Macropodid alphaherpesvirus 2, Paninealphaherpesvirus 3, Papiine alphaherpesvirus 2, Pteropodidalphaherpesvirus 1, Saimiriine alphaherpesvirus 1, Bovinealphaherpesvirus 1, Bovine alphaherpesvirus 5, Bubalinealphaherpesvirus 1, Canid alphaherpesvirus 1, Caprinealphaherpesvirus 1, Cercopithecine alphaherpesvirus 9, Cervidalphaherpesvirus 1, Cervid alphaherpesvirus 2, Equidalphaherpesvirus 1, Equid alphaherpesvirus 3, Equidalphaherpesvirus 4, Equid alphaherpesvirus 8, Equidalphaherpesvirus 9, Felid alphaherpesvirus 1, Humanalphaherpesvirus 3, Monodontid alphaherpesvirus 1, Phocidalphaherpesvirus 1, Suid alphaherpesvirus 1, Chelonidalphaherpesvirus 6, Aotine betaherpesvirus 1, Cebinebetaherpesvirus 1, Cercopithecine betaherpesvirus 5, Humanbetaherpesvirus 5, Macacine betaherpesvirus 3, Macacinebetaherpesvirus 8, Mandrilline betaherpesvirus 1, Paninebetaherpesvirus 2, Papiine betaherpesvirus 3, Papiinebetaherpesvirus 4, Saimiriine betaherpesvirus 4, Muridbetaherpesvirus 1, Murid betaherpesvirus 2, Murid betaherpesvirus8, Elephantid betaherpesvirus 1, Elephantid betaherpesvirus 4,Elephantid betaherpesvirus 5, Human betaherpesvirus 7, Humanbetaherpesvirus 6A, Human betaherpesvirus 6B, Macacinebetaherpesvirus 9, Murid betaherpesvirus 3, Suid betaherpesvirus 2,Caviid betaherpesvirus 2, Tupaiid betaherpesvirus 1, Callitrichinegammaherpesvirus 3, Cercopithecine gammaherpesvirus 14, Gorillinegammaherpesvirus 1, Human gammaherpesvirus 4, Macacinegammaherpesvirus 4, Macacine gammaherpesvirus 10, Paninegammaherpesvirus 1, Papiine gammaherpesvirus 1, Ponginegammaherpesvirus 2, Alcelaphine gammaherpesvirus 1, Alcelaphinegammaherpesvirus 2, Bovine gammaherpesvirus 6, Caprinegammaherpesvirus 2, Hippotragine gammaherpesvirus 1, Ovinegammaherpesvirus 2, Suid gammaherpesvirus 3, Suid gammaherpesvirus4, Suid gammaherpesvirus 5, Equid gammaherpesvirus 2, Equidgammaherpesvirus 5, Felid gammaherpesvirus 1, Mustelidgammaherpesvirus 1, Phocid gammaherpesvirus 3, Vespertilionidgammaherpesvirus 1, Ateline gammaherpesvirus 2, Atelinegammaherpesvirus 3, Bovine gammaherpesvirus 4, Cricetidgammaherpesvirus 2, Human gammaherpesvirus 8, Macacinegammaherpesvirus 5, Macacine gammaherpesvirus 8, Macacinegammaherpesvirus 11, Macacine gammaherpesvirus 12, Muridgammaherpesvirus 4, Murid gammaherpesvirus 7, Saimiriinegammaherpesvirus 2, Equid gammaherpesvirus 7, Phocidgammaherpesvirus 2, Saguinine gammaherpesvirus 1, Iguanidherpesvirus 2, Haliotid herpesvirus 1, Ostreid herpesvirus 1,Salmonella virus SKML39, Shigella virus AG3, Dickeya virusLimestone, Dickeya virus RC2014, Escherichia virus CBA120,Escherichia virus Phax1, Salmonella virus 38, Salmonella virusDet7, Salmonella virus GG32, Salmonella virus PM10, Salmonellavirus SFP10, Salmonella virus SH19, Salmonella virus SJ3,Escherichia virus KWBSE43-6, Klebsiella virus 0507KN21, Klebsiellavirus KpS110, Klebsiella virus May, Klebsiella virus Menlow,Serratia virus IME250, Erwinia virus Ea2809, Serratia virus MAM1,Acinetobacter virus Acibe1007, Acinetobacter virus AB3,Acinetobacter virus AbKT21III, Acinetobacter virus Abp1,Acinetobacter virus Aci07, Acinetobacter virus Aci08, Acinetobactervirus AS11, Acinetobacter virus AS12, Acinetobacter virus Fri1,Acinetobacter virus IME200, Acinetobacter virus PD6A3,Acinetobacter virus PDAB9, Acinetobacter virus phiAB1,Acinetobacter virus SH-Ab 15519, Acinetobacter virus SWHAb1,Acinetobacter virus SWHAb3, Acinetobacter virus WCHABP5,Acintetobacter virus B1, Acintetobacter virus B2, Acintetobactervirus B5, Acintetobacter virus D2, Acintetobacter virus P1,Acintetobacter virus P2, Acintetobacter virus phiAB6, Acinetobactervirus Petty, Vibrio virus Vc1, Vibrio virus A318, Vibrio virusAS51, Vibrio virus Vp670, Marinomonas virus CBSA, Marinomonas virusCPP1m, Vibrio virus VEN, Pseudomonas virus Achelous, Pseudomonasvirus Alpheus, Pseudomonas virus Nerthus, Pseudomonas virus Njord,Pseudomonas virus uligo, Pseudomonas virus C171, Pectobacteriumvirus PP16, Pectobacterium virus PPWS1, Pectobacterium virus PPWS2,Pectobacterium virus CBS, Pectobacterium virus Clickz,Pectobacterium virus fM1, Pectobacterium virus Gaspode,Pectobacterium virus Khlen, Pectobacterium virus Koot,Pectobacterium virus Lelidair, Pectobacterium virus Nobby,Pectobacterium virus Peat1, Pectobacterium virus Phoria,Pectobacterium virus PP90, Pectobacterium virus Zenivior, Dickeyavirus BF25-12, Pseudomonas virus NV3, Pseudomonas virus 130-113,Pseudomonas virus 15pyo, Pseudomonas virus Ab05, Pseudomonas virusABTNL, Pseudomonas virus DL62, Pseudomonas virus kF77, Pseudomonasvirus LKD16, Pseudomonas virus LUZ19, Pseudomonas virus MPK6,Pseudomonas virus MPK7, Pseudomonas virus NFS, Pseudomonas virusPAXYB1, Pseudomonas virus phiKMV, Pseudomonas virus PT2,Pseudomonas virus PTS, Pseudomonas virus RLP, Pseudomonas virusLKA1, Pseudomonas virus f2, Aeromonas virus 25AhydR2PP, Aeromonasvirus AS7, Aeromonas virus ZPAH7, Yersinia virus ISAO8, Aeromonasvirus Ahp1, Aeromonas virus CF7, Cronobacter virus DevCD23823,Cronobacter virus GAP227, Salmonella virus Spp16, Yersinia virusR8-01, Yersinia virus fHeYen301, Yersinia virus Phi80-18,Pectobacterium virus Arno160, Pectobacterium virus PP2, Proteusvirus PM85, Proteus virus PM93, Proteus virus PM116, Proteus virusPm5460, Pectobacterium virus PP1, Erwinia virus Era103, Erwiniavirus S2, Lelliottia virus phD2B, Citrobacter CrRp3, Escherichiavirus LL11, Escherichia virus AAPEc6, Escherichia virus ACGC91,Escherichia virus B, Escherichia virus C, Escherichia virus K,Escherichia virus K1-5, Escherichia virus K1E, Escherichia virusmutPK1A2, Escherichia virus VEc3, Escherichia virus UAB78,Salmonella virus BP12B, Salmonella virus SP6, Burkholderia virusBpAMP1, Ralstonia virus RSPI1, Ralstonia virus RSB1, Ralstoniavirus RsoP1IDN, Burkholderia virus JG068, Ralstonia virus RSJ2,Ralstonia virus RSJS, Ralstonia virus RSPII1, Shigella virus Buco,Escherichia virus Minorna, Klebsiella virus AltoGao, Klebsiellavirus BO1E, Klebsiella virus F19, Klebsiella virus K244, Klebsiellavirus Kp2, Klebsiella virus KP34, Klebsiella virus KPRio2015,Klebsiella virus KpS2, Klebsiella virus KpV41, Klebsiella virusKpV48, Klebsiella virus KpV71, Klebsiella virus KpV74, Klebsiellavirus KpV475, Klebsiella virus KPV811, Klebsiella virus myPSH1235,Klebsiella virus SU503, Klebsiella virus SU552A, Shigella virusSFN6B, Enterobacter virus KDA1, Proteus virus PM16, Proteus virusPM75, Dickeya virus Dagda, Dickeya virus Katbat, Dickeya virusLuksen, Dickeya virus Mysterion, Yersinia virus AP10, Erwinia virusFE44, Escherichia virus 285P, Escherichia virus BA14, Escherichiavirus P483, Escherichia virus P694, Escherichia virus 5523,Kluyvera virus Kvp1, Pectobacterium virus PP74, Salmonella virusBP12A, Salmonella virus BSP161, Shigella virus A7, Yersinia virusBerlin, Yersinia virus PYPS50, Yersinia virus Yepe2, Yersinia virusYepf, Citrobacter virus CR8, Vibrio virus ICP3, Vibrio virus N4,Vibrio virus VP4, Enterobacter virus Eap1, Erwinia virus L1,Escherichia virus SRT7, Pseudomonas virus 17A, Pseudomonas virusgh1, Pseudomonas virus Henninger, Pseudomonas virus KNP,Pseudomonas virus Pf1ERZ2017, Pseudomonas virus PhiPSA2,Pseudomonas virus PhiPsa17, Pseudomonas virus PPPL1, Pseudomonasvirus sh12, Pseudomonas virus WRT, Yersinia virus fPS9, Yersiniavirus fPS53, Yersinia virus fPS59, Yersinia virus fPS54ocr,Pectobacterium virus Jarilo, Citrobacter virus CR44b, Citrobactervirus SH3, Citrobacter virus SH4, Cronobacter virus Dev2,Cronobacter virus GW1, Enterobacter virus EcpYZU01, Escherichiavirus EcoDS1, Escherichia virus F, Escherichia virus GA2A,Escherichia virus IMM002, Escherichia virus K1F, Escherichia virusLM33P1, Escherichia virus PE3-1, Escherichia virus Ro451w,Escherichia virus ST31, Escherichia virus Vec13, Escherichia virusYZ1, Escherichia virus ZG49, Shigella virus SFPH2, Morganella virusMmP1, Morganella virus MP2, Dickeya virus JA10, Dickeya virusNinurta, Pectobacterium virus PP47, Pectobacterium virus PP81,Pectobacterium virus PPWS4, Pseudomonas virus PPpW4, Pseudomonasvirus 22PfluR64PP, Pseudomonas virus IBBPF7A, Pseudomonas virusPf10, Pseudomonas virus PFP1, Pseudomonas virus PhiS1, Pseudomonasvirus UNOSLW1, Pseudomonas virus PspYZU08, Escherichia virus K30,Klebsiella virus 2044-307w, Klebsiella virus BIS33, Klebsiellavirus Henu1, Klebsiella virus IL33, Klebsiella virus IME205,Klebsiella virus IME321, Klebsiella virus K5, Klebsiella virus K11,Klebsiella virus K5-2, Klebsiella virus K5-4, Klebsiella virusKN1-1, Klebsiella virus KN3-1, Klebsiella virus KN4-1, Klebsiellavirus Kp1, Klebsiella virus KP32, Klebsiella virus KP32i192,Klebsiella virus KP32i194, Klebsiella virus KP32i195, Klebsiellavirus KP32i196, Klebsiella virus kpssk3, Klebsiella virus KpV289,Klebsiella virus KpV763, Klebsiella virus KpV766, Klebsiella virusKpV767, Klebsiella virus Pharr, Klebsiella virus PRA33, Klebsiellavirus SHKp152234, Klebsiella virus SHKp152410, Citrobacter virusCFP1, Citrobacter virus SH1, Citrobacter virus SH2, Enterobactervirus E2, Enterobacter virus E3, Enterobacter virus KPN3,Enterobacteria virus T7M, Escherichia virus ECA2, Escherichia virusLL2, Escherichia virus T3, Escherichia virus T3Luria, Leclerciavirus 10164-302, Salmonella virus SG-JL2, Serratia virus 2050H2,Serratia virus SM9-3Y, Yersinia virus APS, Yersinia virus YeF10,Yersinia virus YeO3-12, Enterobacteria virus IME390, Escherichiavirus 13a, Escherichia virus 64795ec1, Escherichia virus C5,Escherichia virus CICC80001, Escherichia virus Ebrios, Escherichiavirus EG1, Escherichia virus HZ2R8, Escherichia virus HZP2,Escherichia virus N30, Escherichia virus NCA, Escherichia virus T7,Salmonella virus 3A8767, Salmonella virus Vi06, Stenotrophomonasvirus IME15, Yersinia virus YpPY, Yersinia virus YpsPG, Pseudomonasvirus Phi15, Pectobacterium virus DUPPII, Synechococcus virusSCBP42, Aquamicrobium virus P14, Ashivirus S45C4, Agrobacteriumvirus Atuph02, Agrobacterium virus Atuph03, Ralstonia virus Ap1,Ayaqvirus S45C18, Prochlorococcus virus SS120-1, Pseudomonas virusAndromeda, Pseudomonas virus Bf7, Escherichia virus J8-65,Escherichia virus Lidtsur, Prochlorococcus virus NATL1A7, ChosvirusKM23C739, Rhizobium virus RHEph02, Rhizobium virus RHEph08,Rhizobium virus RHEph09, Vibrio virus Cyclit, Escherichia virusPGT2, Escherichia virus PhiKT, Alteromonas virus H4-4, FoussvirusS46C10, Fussvirus S30C28, Escherichia virus ECBP5, Pectobacteriumvirus PP99, Ralstonia virus DURPI, Ralstonia virus RsoP1EGY,Synechococcus STIP37, Jalkavirus S08C159, Ralstonia virus RSB3,Kawavirus SWce1C56, Synechococcus virus SRIP1, Providencia virusPS3, Curvibacter virus P26059B, Ralstonia virus RSB2, Synechococcusvirus SCBP2, Krakvirus S39C11, Podovirus Lau218, Pantoea virusLIMElight, Prochlorococcus virus PGSP1, Synechococcus virus SCBP3,Caulobacter virus Lullwater, Vibrio virus KF1, Vibrio virus KF2,Vibrio virus OWB, Vibrio virus VP93, Pseudomonas virus VSW3,Nohivirus S31C1, Oinezvirus S37C6, Rhizobium virus RHEph01,Pagavirus S05C849, Mesorhizobium virus Lo5R7ANS, Pedosvirus S28C3,Pekhitvirus S04C24, Pelagibacter virus HTVC019P, Pelagivirus S35C6,Caulobacter virus Percy, Delftia virus IMEDE1, Podivirus S05C243,Pseudomonas virus PollyC, Synechococcus virus SCBP4, PowvirusS08C41, Xanthomonas virus f20, Xanthomonas virus f30, Xanthomonasvirus XAJ24, Xanthomonas virus Xc10, Xylella virus Prado,Synechococcus virus SB28, Sphingomonas virus Scott, Synechococcusvirus SRIP2, Ralstonia virus ITL1, Sieqvirus S42C7, Ralstonia virusRPSC1, Stopalavirus S38C3, Pelagibacter virus HTVC011P,Stupnyavirus KM16C193, Prochlorococcus virus 951510a,Prochlorococcus virus NATL2A133, Prochlorococcus virus PSSP10,Vibrio virus JSF7, Prochlorococcus virus PSSP7, Synechococcus virusP60, Prochlorococcus virus PSSP3, Synechococcus virus PSSP2,Synechococcus virus Syn5, Votkovvirus S28C10, Pantoea virusLIMEzero, Pasteurella virus PHB01, Pasteurella virus PHB02,Escherichia virus GJ1, Escherichia virus ST32, Erwinia virusFaunus, Erwinia virus Y2, Aeromonas virus pAh6C, Pectobacteriumvirus PM1, Pectobacterium virus PP101, Shewanella virus Spp001,Shewanella virus SppYZU05, Vibrio virus Ceto, Vibrio virusThalassa, Vibrio virus JSF10, Vibrio virus JSF12, Vibrio virusphi3, Vibrio virus pVp1, Escherichia virus EPS7, Escherichia virusmar003J3, Escherichia virus saus132, Salmonella virus 123,Salmonella virus 329, Salmonella virus 118970sa12, Salmonella virusLVR16A, Salmonella virus S113, Salmonella virus S114, Salmonellavirus S116, Salmonella virus S124, Salmonella virus S126,Salmonella virus S132, Salmonella virus S133, Salmonella virusS147, Salmonella virus Seafire, Salmonella virus SH9, Salmonellavirus STG2, Salmonella virus Stitch, Salmonella virus Sw2, Yersiniavirus phiR201, Escherichia virus AKFV33, Escherichia virus BF23,Escherichia virus chee24, Escherichia virus DT5712, Escherichiavirus DT57C, Escherichia virus FFH1, Escherichia virus Gostya9,Escherichia virus H8, Escherichia virus mar004NP2, Escherichiavirus OSYSP, Escherichia virus phiAPCEc03, Escherichia virusphiLLS, Escherichia virus s1ur09, Escherichia virus T5, Salmonellavirus NR01, Salmonella virus 5131, Salmonella virus Shivani,Salmonella virus SP01, Salmonella virus SP3, Salmonella virusSPC35, Shigella virus SHSML45, Shigella virus SSP1, Pectobacteriumvirus DUPPV, Pectobacterium virus My1, Proteus virus PM135, Proteusvirus Stubb, Vibrio virus PG07, Vibrio virus VspSw1, Aeromonasvirus AhSzq1, Aeromonas virus AhSzw1, Klebsiella virus IME260,Klebsiella virus Sugarland, Escherichia virus IME542, Escherichiavirus ACGM12, Escherichia virus EC3a, Escherichia virus DTL,Escherichia virus IME253, Escherichia virus Rtp, Shigella virusSf12, Escherichia virus phiEB49, Escherichia virus AHP42,Escherichia virus AHS24, Escherichia virus AKS96, Escherichia virusC119, Escherichia virus E41c, Escherichia virus Eb49, Escherichiavirus Jk06, Escherichia virus KP26, Escherichia virus phiJLA23,Escherichia

virus Rogue1, Shigella virus Sd1, Shigella virus pSf1, Citrobactervirus DK2017, Citrobacter virus Sazh, Citrobacter virus Stevie,Escherichia virus LLS, Escherichia virus TLS, Salmonella virus 36,Salmonella virus PHB07, Salmonella virus phSE2, Salmonella virusSP126, Salmonella virus YSP2, Escherichia virus 95, Escherichiavirus mar001J1, Escherichia virus mar002J2, Escherichia virusSECphi27, Escherichia virus swan01, Escherichia virus IME347,Escherichia virus SRT8, Escherichia virus ADB2, Escherichia virusBIFF, Escherichia virus IME18, Escherichia virus JMPW1, Escherichiavirus JMPW2, Escherichia virus SH2, Escherichia virus T1, Shigellavirus 008, Shigella virus ISF001, Shigella virus PSf2, Shigellavirus Sfin1, Shigella virus SH6, Shigella virus Shfl1, Shigellavirus ISF002, Cronobacter virus Esp2949-1, Enterobacter virus EcL1,Cronobacter virus PhiCS01, Escherichia virus ESC041, Pantoea virusAAS23, Escherichia virus NBD2, Enterobacter virus F20, Klebsiellavirus 1513, Klebsiella virus GHK3, Klebsiella virus KLPN1,Klebsiella virus KOX1, Klebsiella virus KP36, Klebsiella virusKpCol1, Klebsiella virus KpKT21phi1, Klebsiella virus KPN N141,Klebsiella virus KpV522, Klebsiella virus MezzoGao, Klebsiellavirus NJR15, Klebsiella virus NJS1, Klebsiella virus NJS2,Klebsiella virus PKP126, Klebsiella virus Sushi, Klebsiella virusTAH8, Klebsiella virus TSK1, Bacillus virus Agate, Bacillus virusBobb, Bacillus virus Bp8pC, Bacillus virus Bastille, Bacillus virusCAM003, Bacillus virus Evoli, Bacillus virus HoodyT, Bacillus virusAvesoBmore, Bacillus virus B4, Bacillus virus Bigbertha, Bacillusvirus Riley, Bacillus virus Spock, Bacillus virus Troll, Bacillusvirus Bc431, Bacillus virus Bcp1, Bacillus virus BCP82, Bacillusvirus BM15, Bacillus virus Deepblue, Bacillus virus JBP901,Bacillus virus Grass, Bacillus virus NIT1, Bacillus virus SPG24,Bacillus virus BCP78, Bacillus virus TsarBomba, Bacillus virusBPS13, Bacillus virus BPS10C, Bacillus virus Hakuna, Bacillus virusMegatron, Bacillus virus WPh, Bacillus virus Mater, Bacillus virusMoonbeam, Bacillus virus SIOphi, Enterococcus virus ECP3,Enterococcus virus EF24C, Enterococcus virus EFLK1, Enterococcusvirus EFDG1, Enterococcus virus EFP01, Enterococcus virus EfV12,Listeria virus A511, Listeria virus AG20, Listeria virus List36,Listeria virus LMSP25, Listeria virus LMTA34, Listeria virusLMTA148, Listeria virus LP048, Listeria virus LP064, Listeria virusLP083-2, Listeria virus P100, Listeria virus WIL1, Bacillus virusCamphawk, Bacillus virus SPO1, Bacillus virus CP51, Bacillus virusJL, Bacillus virus Shanette, Staphylococcus virus BS1,Staphylococcus virus BS2, Lactobacillus virus Bacchae,Lactobacillus virus Bromius, Lactobacillus virus Iacchus,Lactobacillus virus Lpa804, Lactobacillus virus Semele,Staphylococcus virus G1, Staphylococcus virus G15, Staphylococcusvirus JD7, Staphylococcus virus K, Staphylococcus virus MCE2014,Staphylococcus virus P108, Staphylococcus virus Rodi,Staphylococcus virus 5253, Staphylococcus virus S25-4,Staphylococcus virus SA12, Staphylococcus virus Sb1, Staphylococcusvirus SscM1, Staphylococcus virus IPLAC1C, Staphylococcus virusSEP1, Staphylococcus virus Remus, Staphylococcus virus SA11,Staphylococcus virus Stau2, Staphylococcus virus Twort, Brochothrixvirus A9, Lactobacillus virus Lb338-1, Lactobacillus virus LP65,Campylobacter virus CP21, Campylobacter virus CP220, Campylobactervirus CPt10, Campylobacter virus IBB35, Campylobacter virus CP81,Campylobacter virus CP30A, Campylobacter virus CPX, Campylobactervirus Los1, Campylobacter virus NCTC12673, Escherichia virus Alf5,Escherichia virus AYO145A, Escherichia virus EC6, Escherichia virusHY02, Escherichia virus JH2, Escherichia virus TP1, Escherichiavirus VpaE1, Escherichia virus wV8, Salmonella virus BPS15Q2,Salmonella virus BPS17L1, Salmonella virus BPS17W1, Salmonellavirus FelixO1, Salmonella virus Mushroom, Salmonella virus Si3,Salmonella virus SP116, Salmonella virus UAB87, Erwinia virusEa214, Erwinia virus M7, Citrobacter virus Moogle, Citrobactervirus Mordin, Shigella virus Sf13, Shigella virus Sf14, Shigellavirus Sf17, Escherichia virus SUSP1, Escherichia virus SUSP2,Ralstonia virus RSA1, Ralstonia virus RSY1, Mannheimia virus1127AP1, Mannheimia virus PHL101, Aeromonas virus phiO18P, Vibriovirus Canoe, Pseudoalteromonas virus C5a, Pseudomonas virus Dobby,Pseudomonas virus phiCTX, Erwinia virus EtG, Escherichia virus 186,Salmonella virus PsP3, Salmonella virus SEN1, Erwinia virus ENT90,Klebsiella virus 4LV2017, Salmonella virus Fels2, Salmonella virusRE2010, Salmonella virus SEN8, Salmonella virus SopEphi,Haemophilus virus HP1, Haemophilus virus HP2, Vibrio virus Kappa,Pasteurella virus F108, Burkholderia virus KS14, Burkholderia virusAP3, Burkholderia virus KS5, Vibrio virus K139, Burkholderia virusST79, Escherichia virus fiAA91ss, Escherichia virus P2, Escherichiavirus pro147, Escherichia virus pro483, Escherichia virus Wphi,Yersinia virus L413C, Pseudomonas virus phi3, Salinivibrio virusSMHB1, Klebsiella virus 3LV2017, Salmonella virus SEN4, Cronobactervirus ESSI2, Stenotrophomonas virus Smp131, Salmonella virusFSLSP004, Burkholderia virus KL3, Burkholderia virus phi52237,Burkholderia virus phiE122, Burkholderia virus phiE202, Vibriovirus PV94, Escherichia virus P88, Escherichia virus Bp7,Escherichia virus IME08, Escherichia virus JS10, Escherichia virusJ598, Escherichia virus MX01, Escherichia virus QL01, Escherichiavirus VR5, Escherichia virus WG01, Escherichia virus VR7,Escherichia virus VR20, Escherichia virus VR25, Escherichia virusVR26, Shigella virus SP18, Salmonella virus Melville, Salmonellavirus S16, Salmonella virus STML198, Salmonella virus STP4a,Klebsiella virus JD18, Klebsiella virus PKO111, Enterobacter virusPG7, Escherichia virus CC31, Escherichia virus ECD7, Escherichiavirus GEC3S, Escherichia virus JSE, Escherichia virus phi1,Escherichia virus RB49, Citrobacter virus CF1, Citrobacter virusMerlin, Citrobacter virus Moon, Escherichia virus APCEc01,Escherichia virus HP3, Escherichia virus HX01, Escherichia virusJS09, Escherichia virus 0157tp3, Escherichia virus 0157tp6,Escherichia virus PhAPEC2, Escherichia virus RB69, Escherichiavirus ST0, Shigella virus SHSML521, Shigella virus UTAM, Vibriovirus KVP40, Vibrio virus nt1, Vibrio virus ValKK3, Enterobactervirus Eap3, Klebsiella virus KP15, Klebsiella virus KP27,Klebsiella virus Matisse, Klebsiella virus Miro, Klebsiella virusPMBT1, Escherichia virus AR1, Escherichia virus C40, Escherichiavirus CF2, Escherichia virus E112, Escherichia virus ECML134,Escherichia virus HY01, Escherichia virus HY03, Escherichia virusIme09, Escherichia virus RB3, Escherichia virus RB14, Escherichiavirus s1ur03, Escherichia virus s1ur04, Escherichia virus T4,Shigella virus Pss1, Shigella virus Sf21, Shigella virus Sf22,Shigella virus Sf24, Shigella virus SHBML501, Shigella virus Shf12,Yersinia virus D1, Yersinia virus PST, Acinetobacter virus 133,Aeromonas virus 65, Aeromonas virus Aeh1, Escherichia virus RB16,Escherichia virus RB32, Escherichia virus RB43, Pseudomonas virus42, Escherichia virus Av05, Cronobacter virus CR3, Cronobactervirus CR8, Cronobacter virus CR9, Cronobacter virus PBES02,Pectobacterium virus phiTE, Cronobacter virus GAP31, Escherichiavirus 4MG, Salmonella virus PVPSE1, Salmonella virus SSE121,Escherichia virus APECc02, Escherichia virus FFH2, Escherichiavirus FV3, Escherichia virus JES2013, Escherichia virus Murica,Escherichia virus slur16, Escherichia virus V5, Escherichia virusV18, Brevibacillus virus Abouo, Brevibacillus virus Davies,Synechococcus virus SMbCM100, Erwinia virus Deimos, Erwinia virusDesertfox, Erwinia virus Ea35-70, Erwinia virus RAY, Erwinia virusSimmy50, Erwinia virus SpecialG, Synechococcus virus SShM2,Klebsiella virus K64-1, Klebsiella virus RaK2, Dickeya virus AD1,Erwinia virus Alexandra, Lactobacillus virus LBR48, Synechococcusvirus SCAM1, Synechococcus virus SCBWM1, Vibrio virus Aphrodite1,Escherichia virus 121Q, Escherichia virus PBECO4, Synechococcusvirus AC2014fSyn7803C8, Synechococcus virus ACG2014f, Synechococcusvirus ACG2014fSyn7803US26, Synechococcus virus STIM5, Pseudomonasvirus PaBG, Rheinheimera virus Barba18A, Rheinheimera virusBarba19A, Rheinheimera virus Barba21A, Rheinheimera virus Barba5S,Rheinheimera virus Barba8S, Burkholderia virus BcepMu, Burkholderiavirus phiE255, Synechococcus virus Bellamy, Gordonia virus GMA6,Aeromonas virus 44RR2, Mycobacterium virus Alice, Mycobacteriumvirus Bxz1, Mycobacterium virus Dandelion, Mycobacterium virusHyRo, Mycobacterium virus I3, Mycobacterium virus Lukilu,Mycobacterium virus Nappy, Mycobacterium virus Sebata,Faecalibacterium virus Brigit, Prochlorococcus virus Syn33,Synechococcus virus SRIM12-01, Synechococcus virus SRIM12-06,Synechococcus virus SRIM12-08, Salmonella virus SEN34, Acidovoraxvirus ACP17, Xanthomonas virus Carpasina, Xanthomonas virus XcP1,Pseudomonas virus pf16, Synechococcus virus SCAM3, Ralstonia virusRSF1, Ralstonia virus RSL2, Synechococcus virus SWAM2, Erwiniavirus Derbicus, Pseudomonas virus EL, Sinorhizobium virus M7,Sinorhizobium virus M12, Sinorhizobium virus N3, Serratia virus BF,Yersinia virus Yen9-04, Faecalibacterium virus Epona, Erwinia virusAsesino, Erwinia virus EaH2, Prochlorococcus virus MED4-213,Prochlorococcus virus PHM1, Prochlorococcus virus PHM2,Flavobacterium virus FCL2, Flavobacterium virus FCV1, Pseudomonasvirus KIL2, Pseudomonas virus KIL4, Edwardsiella virus GF2,Escherichia virus Goslar, Halomonas virus HAP1, Vibrio virus VP882,Lactobacillus virus Lb, Erwinia virus EaH1, Iodobacter virus PLPE,Delftia virus PhiW14, Klebsiella virus JD001, Klebsiella virusKpV52, Klebsiella virus KpV80, Escherichia virus CVM10, Escherichiavirus EC0078, Escherichia virus ep3, Brevibacillus virus Jimmer,Brevibacillus virus Osiris, Synechococcus virus SCAM9, Rhizobiumvirus RHEph4, Faecalibacterium virus Lagaffe, Synechoccus virusSP4, Synechococcus virus Syn30, Prochlorococcus virus PTIM40,Synechococcus virus SSKS1, Salmonella virus ZCSE2, Clostridiumvirus phiC2, Clostridium virus phiCD27, Clostridium virus phiCD119,Erwinia virus Machina, Arthrobacter virus BarretLemon, Arthrobactervirus Beans, Arthrobacter virus Brent, Arthrobacter virus Jawnski,Arthrobacter virus Martha, Arthrobacter virus Piccoletto,Arthrobacter virus Shade, Arthrobacter virus Sonny, Synechococcusvirus SCAM7, Acinetobacter virus ME3, Ralstonia virus RSL1,Cronobacter virus GAP32, Pectinobacterium virus CBB,Faecalibacterium virus Mushu, Escherichia virus Mu, Shigella virusSfMu, Halobacterium virus phiH, Burkholderia virus Bcep1,Burkholderia virus Bcep43, Burkholderia virus Bcep781, Burkholderiavirus BcepNY3, Xanthomonas virus OP2, Synechococcus virus SMbCM6,Pseudomonas virus Ab03, Pseudomonas virus G1, Pseudomonas virusKPP10, Pseudomonas virus PAKP3, Pseudomonas virus PS24,Synechococcus virus SRIM8, Synechococcus virus SRIM50,Synechococcus virus ACG2014bSyn7803C61, Synechococcus virusACG2014bSyn9311C4, Synechococcus virus SRIM2, Synechococcus virusSPM2, Pseudomonas virus Noxifer, Acinetobacter virus AB1,Acinetobacter virus AB2, Acinetobacter virus AbC62, Acinetobactervirus AbP2, Acinetobacter virus AP22, Acinetobacter virus LZ35,Acinetobacter virus WCHABP1, Acinetobacter virus WCHABP12,Pseudomonas virus Psa374, Pseudomonas virus VCM, Pseudomonas virusCAb1, Pseudomonas virus CAb02, Pseudomonas virus JG004, Pseudomonasvirus MAGI, Pseudomonas virus PA10, Pseudomonas virus PAKP1,Pseudomonas virus PAKP2, Pseudomonas virus PAKP4, Pseudomonas virusPaP1, Pseudomonas virus phiMK, Pseudomonas virus Zigelbrucke,Prochlorococcus virus PSSM7, Burkholderia virus BcepF1, Pseudomonasvirus 141, Pseudomonas virus Ab28, Pseudomonas virus CEBDP1,Pseudomonas virus DL60, Pseudomonas virus DL68, Pseudomonas virusE215, Pseudomonas virus E217, Pseudomonas virus F8, Pseudomonasvirus JG024, Pseudomonas virus KPP12, Pseudomonas virus KTN6,Pseudomonas virus LBL3, Pseudomonas virus LMA2, Pseudomonas virusNH4, Pseudomonas virus PAS, Pseudomonas virus PB1, Pseudomonasvirus PS44, Pseudomonas virus SN, Pectinobacterium virus PEAT2,Edwardsiella virus pEtSU, Bordetella virus PHB04, Escherichia phageESCO13, Escherichia virus ESCO5, Escherichia virus phAPEC8,Escherichia virus Schickermooser, Klebsiella virus ZCKP1,Pseudomonas virus PA7, Pseudomonas virus phiKZ, Pseudomonas virusSL2, Pseudomonas virus PMW, Agrobacterium virus Atuph07,Synechococcus virus Syn19, Aeromonas virus 56, Aeromonas virus 43,Escherichia virus P1, Escherichia virus RCS47, Salmonella virusSJ46, Pseudoalteromonas virus J2-1, Arthrobacter virus ArV1,Arthrobacter virus Colucci, Arthrobacter virus Trina, Ralstoniavirus RP12, Erwinia virus Risingsun, Salmonella virus BP63,Acinetobacter virus Aci05, Acinetobacter virus Aci01-1,Acinetobacter virus Aci02-2, Prochlorococcus virus PSSM2, Dickeyavirus JA11, Dickeya virus JA29, Erwinia virus Y3, Agrobacteriumvirus 7-7-1, Salmonella virus SPN3US, Bacillus virus Shbh1,Bacillus virus 1, Geobacillus virus GBSV1, Pseudomonas virustabernarius, Synechococcus virus ST4, Faecalibacterium virusTaranis, Synechococcus virus SIOM18, Yersinia virus R1RT, Yersiniavirus TG1, Synechococcus virus STIM4, Synechococcus virus SSM1,Bacillus virus SP15, Vibrio virus pTD1, Vibrio virus VP4B,Tetrasphaera virus TJE1, Faecalibacterium virus Toutatis, Aeromonasvirus 25, Aeromonas virus Aes12, Aeromonas virus Aes508, Aeromonasvirus AS4, Aeromonas virus Asgz, Stenotrophomonas virus IME13,Prochlorococcus virus Syn1, Synechococcus virus SRIM44, Vibriovirus MAR, Vibrio virus VHML, Vibrio virus VP585, Escherichia virusECML4, Salmonella virus Marshall, Salmonella virus Maynard,Salmonella virus SJ2, Salmonella virus STML131, Salmonella virusViI, Erwinia virus Wellington, Escherichia virus ECML-117,Escherichia virus FEC19, Escherichia virus WFC, Escherichia virusWFH, Serratia virus CHI14, Edwardsiella virus MSW3, Edwardsiellavirus PEi21, Erwinia virus Yoloswag, Bacillus virus G, Bacillusvirus PBS1, Microcystis virus Ma-LMM01, Streptococcus virus Cp1,Streptococcus virus Cp1, Lactococcus virus WP2, Bacillus virusB103, Bacillus virus GA1, Bacillus virus phi29, Kurthia virus 6,Actinomyces virus Av1, Mycoplasma virus P1, Staphylococcus virusAndhra, Staphylococcus virus St134, Staphylococcus virus 66,Staphylococcus virus 44AHJD, Staphylococcus virus BP39,Staphylococcus virus CSA13, Staphylococcus virus GRCS,Staphylococcus virus Pabna, Staphylococcus virus phiAGO13,Staphylococcus virus PSa3, Staphylococcus virus S24-1,Staphylococcus virus SAP2, Staphylococcus virus SCH1,Staphylococcus virus SLPW, Shigella virus 7502Stx, Shigella virusPOCJ13, Escherichia virus 191, Escherichia virus PA2, Escherichiavirus TL2011, Shigella virus VASD, Escherichia virus 24B,Escherichia virus 933W, Escherichia virus Min27, Escherichia

virus PA28, Escherichia virus Stx2 II, Dinoroseobacter virus DFL12,Pseudomonas virus Bjorn, Pseudomonas virus Ab22, Pseudomonas virusCHU, Pseudomonas virus LUZ24, Pseudomonas virus PAA2, Pseudomonasvirus PaP3, Pseudomonas virus PaP4, Pseudomonas virus TL, Vibriovirus VC8, Vibrio virus VP2, Vibrio virus VP5, Escherichia virusN4, Flavobacterium virus Fpv1, Flavobacterium virus Fpv4,Streptococcus virus C1, Escherichia virus APEC5, Escherichia virusAPEC7, Escherichia virus Bp4, Escherichia virus EC1UPM, Escherichiavirus ECBP1, Escherichia virus G7C, Escherichia virus IME11,Shigella virus Sb1, Escherichia virus C1302, Pseudomonas virusF116, Pseudomonas virus H66, Escherichia virus Pollock, Salmonellavirus FSL SP-058, Salmonella virus FSL SP-076, Arthrobacter virusAdat, Arthrobacter virus Jasmine, Erwinia virus Ea9-2, Erwiniavirus Frozen, Achromobacter virus Axp3, Achromobacter virusJWAlpha, Edwardsiella virus KF1, Burkholderia virus KL4,Pseudomonas virus KPP25, Pseudomonas virus R18, Pseudomonas virustf, Escherichia virus 172-1, Escherichia virus ECB2, Escherichiavirus NJ01, Escherichia virus phiEco32, Escherichia virusSeptima11, Escherichia virus SU10, Escherichia virus HK620,Salmonella virus BTP1, Salmonella virus P22, Salmonella virusSE1Spa, Salmonella virus ST64T, Shigella virus Sf6, Burkholderiavirus Bcep22, Burkholderia virus Bcepi102, Burkholderia virusBcepmigl, Burkholderia virus DC1, Cellulophaga virus Cba41,Cellulophaga virus Cba172, Pseudomonas virus Ab09, Pseudomonasvirus LIT1, Pseudomonas virus PA26, Pseudomonas virus KPP21,Pseudomonas virus LUZ7, Vibrio virus 48B1, Vibrio virus 51A6,Vibrio virus 51A7, Vibrio virus 52B1, Myxococcus virus Mx8,Bacillus virus Page, Bacillus virus Palmer, Bacillus virus Pascal,Bacillus virus Pony, Bacillus virus Pookie, Brucella virus Pr,Brucella virus Tb, Bordetella virus BPP1, Burkholderia virusBcepC6B, Helicobacter virus 1961P, Helicobacter virus KHP30,Helicobacter virus KHP40, Pseudomonas virus phCDa, Escherichiavirus Skarpretter, Escherichia virus Sortsne, Klebsiella virusIME279, Escherichia virus phiV10, Salmonella virus Epsilon15,Salmonella virus SPN1S, Pseudomonas virus NV1, Pseudomonas virusUFVP2, Escherichia virus PTXU04, Hamiltonella virus APSE1,Lactococcus virus KSY1, Phormidium virus WMP3, Phormidium virusWMP4, Pseudomonas virus 119X, Roseobacter virus SIO1, Vibrio virusVpV262, Streptomyces virus ELB20, Streptomyces virus R4,Streptomyces virus Amela, Streptomyces virus phiCAM, Streptomycesvirus Aaronocolus, Streptomyces virus Caliburn, Streptomyces virusDanzina, Streptomyces virus Hydra, Streptomyces virus Izzy,Streptomyces virus Lannister, Streptomyces virus Lika, Streptomycesvirus Sujidade, Streptomyces virus Zemlya, Streptomyces virusphiHau3, Mycobacterium virus Acadian, Mycobacterium virus Baee,Mycobacterium virus Reprobate, Mycobacterium virus Adawi,Mycobacterium virus Banel, Mycobacterium virus BrownCNA,Mycobacterium virus Chrisnmich, Mycobacterium virus Cooper,Mycobacterium virus JAMaL, Mycobacterium virus Nigel, Mycobacteriumvirus Stinger, Mycobacterium virus Vincenzo, Mycobacterium virusZemanar, Mycobacterium virus Apizium, Mycobacterium virus Manad,Mycobacterium virus Oline, Mycobacterium virus Osmaximus,Mycobacterium virus Pg1, Mycobacterium virus Soto, Mycobacteriumvirus Suffolk, Mycobacterium virus Athena, Mycobacterium virusBernardo, Mycobacterium virus Gadjet, Mycobacterium virus Pipefish,Mycobacterium virus Godines, Mycobacterium virus Rosebush,Mycobacterium virus TA17a, Mycobacterium virus Babsiella,Mycobacterium virus Brujita, Mycobacterium virus Hawkeye,Mycobacterium virus Plot, Caulobacter virus CcrBL9, Caulobactervirus CcrSC, Caulobacter virus CcrColossus, Caulobacter virusCcrPW, Caulobacter virus CcrBL10, Caulobacter virus CcrRogue,Caulobacter virus phiCbK, Caulobacter virus Swift, Salmonella virusSP31, Salmonella virus AG11, Salmonella virus Ent1, Salmonellavirus f18SE, Salmonella virus Jersey, Salmonella virus L13,Salmonella virus LSPA1, Salmonella virus SE2, Salmonella virusSETP3, Salmonella virus SETP7, Salmonella virus SETP13, Salmonellavirus SP101, Salmonella virus SS3e, Salmonella virus wks13,Escherichia virus K1G, Escherichia virus K1H, Escherichia virusK1ind1, Escherichia virus K1ind2, Escherichia virus Golestan,Raoultella virus RP180, Gordonia virus Asapag, Gordonia virusBENtherdunthat, Gordonia virus Getalong, Gordonia virus Kenna,Gordonia virus Horus, Gordonia virus Phistory, Leuconostoc virusLmd1, Leuconostoc virus LN03, Leuconostoc virus LN04, Leuconostocvirus LN12, Leuconostoc virus LN6B, Leuconostoc virus P793,Leuconostoc virus 1A4, Leuconostoc virus Ln8, Leuconostoc virusLn9, Leuconostoc virus LN25, Leuconostoc virus LN34, Leuconostocvirus LNTR3, Mycobacterium virus Bongo, Mycobacterium virus Rey,Mycobacterium virus Butters, Mycobacterium virus Michelle,Mycobacterium virus Charlie, Mycobacterium virus Pipsqueaks,Mycobacterium virus Xeno, Mycobacterium virus Panchino,Mycobacterium virus Phrann, Mycobacterium virus Redi, Mycobacteriumvirus Skinnyp, Gordonia virus BaxterFox, Gordonia virus Yeezy,Gordonia virus Kita, Gordonia virus Nymphadora, Gordonia virusZirinka, Mycobacterium virus Bignuz, Mycobacterium virusBrusacoram, Mycobacterium virus Donovan, Mycobacterium virusFishburne, Mycobacterium virus Jebeks, Mycobacterium virus Malithi,Mycobacterium virus Phayonce, Lactobacillus virus B2, Lactobacillusvirus Lenus, Lactobacillus virus Nyseid, Lactobacillus virus SAC12,Lactobacillus virus Ldl1, Lactobacillus virus ViSo2018a,Lactobacillus virus Maenad, Lactobacillus virus P1, Lactobacillusvirus Satyr, Streptomyces virus AbbeyMikolon, Pseudomonas virusAb18, Pseudomonas virus Ab19, Pseudomonas virus PaMx11,Burkholderia virus AH2, Arthrobacter virus Amigo, Arthrobacteriavirus Molivia, Propionibacterium virus Anatole, Propionibacteriumvirus B3, Arthrobacter virus Andrew, Bacillus virus Andromeda,Bacillus virus Blastoid, Bacillus virus Curly, Bacillus virusEoghan, Bacillus virus Finn, Bacillus virus Glittering, Bacillusvirus Riggi, Bacillus virus Taylor, Microbacterium virus Appa,Gordonia virus Apricot, Microbacterium virus Armstrong, Gordoniavirus Attis, Streptomyces virus Attoomi, Streptomyces virusAustintatious, Streptomyces virus Ididsumtinwong, Streptomycesvirus PapayaSalad, Gordonia virus Bantam, Mycobacterium virusBarnyard, Mycobacterium virus Konstantine, Mycobacterium virusPredator, Pseudomonas virus B3, Pseudomonas virus JBD67,Pseudomonas virus JD18, Pseudomonas virus PM105, Mycobacteriumvirus Bernal13, Gordonia virus BetterKatz, Streptomyces virus Bing,Staphylococcus virus 13, Staphylococcus virus 77, Staphylococcusvirus 108PVL, Gordonia virus Bowser, Arthrobacter virus Bridgette,Arthrobacter virus Constance, Arthrobacter virus Eileen,Arthrobacter virus Judy, Arthrobacter virus Peas, Gordonia virusBritbrat, Mycobacterium virus Bron, Mycobacterium virus Faith1,Mycobacterium virus JoeDirt, Mycobacterium virus Rumpelstiltskin,Streptococcus virus 858, Streptococcus virus 2972, Streptococcusvirus ALQ132, Streptococcus virus 01205, Streptococcus virus Sfi11,Pseudomonas virus D3112, Pseudomonas virus DMS3, Pseudomonas virusFHA0480, Pseudomonas virus LPB1, Pseudomonas virus MP22,Pseudomonas virus MP29, Pseudomonas virus MP38, Pseudomonas virusPA1KOR, Cellulophaga virus ST, Bacillus virus 250, Bacillus virusIEBH, Lactococcus virus bIL67, Lactococcus virus c2,Corynebacterium virus C3PO, Corynebacterium virus Darwin,Corynebacterium virus Zion, Lactobacillus virus c5, Lactobacillusvirus Ld3, Lactobacillus virus Ld17, Lactobacillus virus Ld25A,Lactobacillus virus LLKu, Lactobacillus virus phiLdb, Mycobacteriumvirus Che9c, Mycobacterium virus Sbash, Mycobacterium virusArdmore, Mycobacterium virus Avani, Mycobacterium virus Boomer,Mycobacterium virus Che8, Mycobacterium virus Che9d, Mycobacteriumvirus DeadP, Mycobacterium virus Dlane, Mycobacterium virusDorothy, Mycobacterium virus DotProduct, Mycobacterium virus Drago,Mycobacterium virus Fruitloop, Mycobacterium virus GUmbie,Mycobacterium virus Ibhubesi, Mycobacterium virus Llij,Mycobacterium virus Mozy, Mycobacterium virus Mutaforma13,Mycobacterium virus Pacc40, Mycobacterium virus PMC, Mycobacteriumvirus Ramsey, Mycobacterium virus RockyHorror, Mycobacterium virusSG4, Mycobacterium virus Shauna1, Mycobacterium virus Shilan,Mycobacterium virus Spartacus, Mycobacterium virus Taj,Mycobacterium virus Tweety, Mycobacterium virus Wee, Mycobacteriumvirus Yoshi, Salmonella virus Chi, Salmonella virus FSLSP030,Salmonella virus FSLSP088, Salmonella virus iEPS5, Salmonella virusSPN19, Corynebacterium virus P1201, Clavibacter virus CMP1,Clavibacter virus CN1A, Lactobacillus virus ATCC8014, Lactobacillusvirus phiJL1, Pediococcus virus cIP1, Arthrobacter virus Coral,Arthrobacter virus Kepler, Mycobacterium virus Corndog,Mycobacterium virus Firecracker, Rhodobacter virus RcCronus,Gordonia virus DareDevil, Arthrobacter virus Decurro,Stenotrophomonas virus DLP5, Gordonia virus Demosthenes, Gordoniavirus Katyusha, Gordonia virus Kvothe, Pseudomonas virus D3,Pseudomonas virus PMG1, Escherichia virus EK99P1, Escherichia virusHK578, Escherichia virus JL1, Escherichia virus SSL2009a,Escherichia virus YD2008s, Shigella virus EP23, Sodalis virus S01,Microbacterium virus Dismas, Propionibacterium virus B22,Propionibacterium virus Doucette, Propionibacterium virus E6,Propionibacterium virus G4, Microbacterium virus Eden, Enterococcusvirus AL2, Enterococcus virus AL3, Enterococcus virus AUEF3,Enterococcus virus EcZZ2, Enterococcus virus EF3, Enterococcusvirus EF4, Enterococcus virus EfaCPT1, Enterococcus virus IME196,Enterococcus virus LY0322, Enterococcus virus phiSHEF2,Enterococcus virus phiSHEF4, Enterococcus virus phiSHEF5,Enterococcus virus PMBT2, Enterococcus virus SANTOR1, Edwardsiellavirus eiAU, Xanthomonas virus PhiL7, Microbacterium virus Eleri,Gordonia virus Cozz, Gordonia virus Emalyn, Gordonia virus GTE2,Gordonia virus Troje, Gordonia virus Eyre, Gordonia virusFairfaxidumvirus, Microbacterium virus ISF9, Erwinia virus Eho49,Erwinia virus Eho59, Staphylococcus virus 2638A, Staphylococcusvirus QT1, Colwellia virus 9A, Mycobacterium virus Alma,Mycobacterium virus Arturo, Mycobacterium virus Astro,Mycobacterium virus Backyardigan, Mycobacterium virus Benedict,Mycobacterium virus Bethlehem, Mycobacterium virus Billknuckles,Mycobacterium virus BPBiebs31, Mycobacterium virus Bruns,Mycobacterium virus Bxb 1, Mycobacterium virus Bxz2, Mycobacteriumvirus Che12, Mycobacterium virus Cuco, Mycobacterium virus D29,Mycobacterium virus Doom, Mycobacterium virus Ericb, Mycobacteriumvirus Euphoria, Mycobacterium virus George, Mycobacterium virusGladiator, Mycobacterium virus Goose, Mycobacterium virus Hammer,Mycobacterium virus Heldan, Mycobacterium virus Jasper,Mycobacterium virus JC27, Mycobacterium virus Jeffabunny,Mycobacterium virus JHC117, Mycobacterium virus KBG, Mycobacteriumvirus Kssjeb, Mycobacterium virus Kugel, Mycobacterium virus L5,Mycobacterium virus Lesedi, Mycobacterium virus LHTSCC,Mycobacterium virus lockley, Mycobacterium virus Marcell,Mycobacterium virus Microwolf, Mycobacterium virus Mrgordo,Mycobacterium virus Museum, Mycobacterium virus Nepal,Mycobacterium virus Packman, Mycobacterium virus Peaches,Mycobacterium virus Perseus, Mycobacterium virus Pukovnik,Mycobacterium virus Rebeuca, Mycobacterium virus Redrock,Mycobacterium virus Ridgecb, Mycobacterium virus Rockstar,Mycobacterium virus Saintus, Mycobacterium virus Skipole,Mycobacterium virus Solon, Mycobacterium virus Switzer,Mycobacterium virus SWU1, Mycobacterium virus Tiger, Mycobacteriumvirus Timshel, Mycobacterium virus Trixie, Mycobacterium virusTurbido, Mycobacterium virus Twister, Mycobacterium virus U2,Mycobacterium virus Violet, Mycobacterium virus Wonder,Mycobacterium virus Gaia, Arthrobacter virus Abidatro, Arthrobactervirus Galaxy, Gordonia virus GAL1, Gordonia virus GMA3, Gordoniavirus Gsput1, Gordonia virus GMAT, Gordonia virus GTE7, Gordoniavirus Ghobes, Mycobacterium virus Giles, Microbacterium virusOneinaGillian, Gordonia virus GodonK, Microbacterium virus Goodman,Arthrobacter virus Captnmurica, Arthrobacter virus Gordon, Gordoniavirus GordTnk2, Proteus virus Isfahan, Gordonia virus Jumbo,Gordonia virus Gustav, Gordonia virus Mandia, Paenibacillus virusHarrison, Gordonia virus Hedwig, Cellulophaga virus Cba121,Cellulophaga virus Cba171, Cellulophaga virus Cba181, Escherichiavirus HK022, Escherichia virus HK75, Escherichia virus HK97,Escherichia virus HK106, Escherichia virus HK446, Escherichia virusHK542, Escherichia virus HK544, Escherichia virus HK633,Escherichia virus mEp234, Escherichia virus mEpX1, Escherichiavirus mEpX2, Streptomyces virus Hiyaa, Salinibacter virus M1EM1,Salinibacter virus M8CR30-2, Listeria virus LP26, Listeria virusLP37, Listeria virus LP110, Listeria virus LP114, Listeria virusP70, Corynebacterium virus phi673, Corynebacterium virus phi674,Microbacterium virus Hamlet, Microbacterium virus Ilzat,Polaribacter virus P12002L, Polaribacter virus P12002S, Nonlabensvirus P12024L, Nonlabens virus P12024S, Gordonia virus Jace,Brevibacillus virus Jenst, Corynebacterium virus Juicebox,Salinibacter virus M31CR41-2, Salinibacter virus SRUTV1,Arthrobacter virus Kellezzio, Arthrobacter virus Kitkat,Burkholderia virus KL1, Xanthomonas virus CP1, Microbacterium virusGolden, Microbacterium virus Koji, Arthrobacter virus Bennie,Arthrobacter virus DrRobert, Arthrobacter virus Glenn, Arthrobactervirus HunterDalle, Arthrobacter virus Joann, Arthrobacter virusKorra, Arthrobacter virus Preamble, Arthrobacter virus Pumancara,Arthrobacter virus Wayne, Mycobacterium virus 244, Mycobacteriumvirus Bask21, Mycobacterium virus CJW1, Mycobacterium virus Eureka,Mycobacterium virus Kostya, Mycobacterium virus Porky,Mycobacterium virus Pumpkin, Mycobacterium virus Sirduracell,Mycobacterium virus Toto, Microbacterium virus Krampus,Salinibacter virus M8CC19, Salinibacter virus M8CRM1, Sphingobiumvirus Lacusarx, Escherichia virus DE3, Escherichia virus HK629,Escherichia virus HK630, Escherichia virus Lambda, Pseudomonasvirus Lana, Arthrobacter virus Laroye, Eggerthella virus PMBT5,Arthobacter virus Liebe, Mycobacterium virus Halo, Mycobacteriumvirus Liefie, Acinetobacter virus IMEAB3, Acinetobacter virus Loki,Streptomyces virus phiBT1, Streptomyces virus phiC31,Brevibacterium virus LuckyBarnes, Gordonia virus Lucky10,Faecalibacterium virus Lugh, Bacillus virus BMBtp2, Bacillus virusTP21, Bacillus virus Mgbh1, Arthrobacter virus Maj a, Arthrobactervirus DrManhattan, Mycobacterium virus Ff47, Mycobacterium virusMuddy, Vibrio virus MAR10, Vibrio virus SSP002, Mycobacterium virusMarvin, Mycobacterium virus Mosmoris, Pseudomonas virus PMBT3,Microbacterium virus MementoMori, Microbacterium virus Fireman,Microbacterium

virus Metamorphoo, Microbacterium virus RobsFeet, Microbacteriumvirus Min1, Streptococcus virus 7201, Streptococcus virus DT1,Streptococcus virus phiAbc2, Streptococcus virus Sfi19,Streptococcus virus Sfi21, Gordinia virus Birksandsocks, Gordoniavirus Flakey, Gordonia virus Monty, Gordonia virus Stevefrench,Arthrobacter virus Circum, Arthrobacter virus Mudcat, Escherichiavirus EC2, Salmonella virus Lumpael, Dinoroseobacter virus DSC,Burkholderia virus BcepNazgul, Microbacterium virus Neferthena,Pseudomonas virus nickie, Pseudomonas virus NP1, Pseudomonas virusPaMx25, Escherichia virus 9g, Escherichia virus JenK1, Escherichiavirus JenP1, Escherichia virus JenP2, Salmonella virus SE1Kor,Salmonella virus 9NA, Salmonella virus SP069, Gordonia virusNyceirae, Faecalibacterium virus Oengus, Mycobacterium virus Baka,Mycobacterium virus Courthouse, Mycobacterium virus Littlee,Mycobacterium virus Omega, Mycobacterium virus Optimus,Mycobacterium virus Thibault, Gordonia virus BrutonGaster, Gordoniavirus OneUp, Gordonia virus Orchid, Thermus virus P23-45, Thermusvirus P74-26, Propionibacterium virus ATCC29399BC,Propionibacterium virus ATCC29399BT, Propionibacterium virusAttacne, Propionibacterium virus Keiki, Propionibacterium virusKubed, Propionibacterium virus Lauchelly, Propionibacterium virusMrAK, Propionibacterium virus Ouroboros, Propionibacterium virusP91, Propionibacterium virus P105, Propionibacterium virus P144,Propionibacterium virus P1001, Propionibacterium virus P1.1,Propionibacterium virus P100A, Propionibacterium virus P100D,Propionibacterium virus P101A, Propionibacterium virus P104A,Propionibacterium virus PA6, Propionibacterium virus Pacnes201215,Propionibacterium virus PAD20, Propionibacterium virus PAS50,Propionibacterium virus PHL009M11, Propionibacterium virusPHL025M00, Propionibacterium virus PHL037M02, Propionibacteriumvirus PHL041M10, Propionibacterium virus PHL060L00,Propionibacterium virus PHL067M01, Propionibacterium virusPHL070N00, Propionibacterium virus PHL071N05, Propionibacteriumvirus PHL082M03, Propionibacterium virus PHL092M00,Propionibacterium virus PHL095N00, Propionibacterium virusPHL111M01, Propionibacterium virus PHL112N00, Propionibacteriumvirus PHL113M01, Propionibacterium virus PHL114L00,Propionibacterium virus PHL116M00, Propionibacterium virusPHL117M00, Propionibacterium virus PHL117M01, Propionibacteriumvirus PHL132N00, Propionibacterium virus PHL141N00,Propionibacterium virus PHL151M00, Propionibacterium virusPHL151N00, Propionibacterium virus PHL152M00, Propionibacteriumvirus PHL163M00, Propionibacterium virus PHL171M01,Propionibacterium virus PHL179M00, Propionibacterium virusPHL194M00, Propionibacterium virus PHL199M00, Propionibacteriumvirus PHL301M00, Propionibacterium virus PHL308M00,Propionibacterium virus Pirate, Propionibacterium virus Procrass1,Propionibacterium virus SKKY, Propionibacterium virus Solid,Propionibacterium virus Stormborn, Propionibacterium virus Wizzo,Pseudomonas virus PaMx28, Pseudomonas virus PaMx74, Mycobacteriumvirus Papyrus, Mycobacterium virus Send513, Mycobacterium virusPatience, Mycobacterium virus PBI1, Rhodococcus virus Pepy6,Rhodococcus virus Poco6, Staphylococcus virus 11, Staphylococcusvirus 29, Staphylococcus virus 37, Staphylococcus virus 53,Staphylococcus virus 55, Staphylococcus virus 69, Staphylococcusvirus 71, Staphylococcus virus 80, Staphylococcus virus 85,Staphylococcus virus 88, Staphylococcus virus 92, Staphylococcusvirus 96, Staphylococcus virus 187, Staphylococcus virus 52a,Staphylococcus virus 80alpha, Staphylococcus virus CNPH82,Staphylococcus virus EW, Staphylococcus virus IPLA5, Staphylococcusvirus IPLA7, Staphylococcus virus IPLA88, Staphylococcus virusPH15, Staphylococcus virus phiETA, Staphylococcus virus phiETA2,Staphylococcus virus phiETA3, Staphylococcus virus phiMR11,Staphylococcus virus phiMR25, Staphylococcus virus phiNM1,Staphylococcus virus phiNM2, Staphylococcus virus phiNM4,Staphylococcus virus SAP26, Staphylococcus virus X2, Enterococcusvirus FL1, Enterococcus virus FL2, Enterococcus virus FL3,Streptomyces virus Picard, Microbacterium virus Pikmin,Corynebacterium virus Poushou, Providencia virus PR1, Listeriavirus LP302, Listeria virus PSA, Psimunavirus psiM2,Propionibacterium virus PFR1, Microbacterium phage KaiHaiDragon,Microbacterium phage Paschalis, Microbacterium phage Quhwah,Streptomyces virus Darolandstone, Streptomyces virus Raleigh,Escherichia virus N15, Rhodococcus virus RER2, Rhizobium virusP106B, Strepomyces virus Drgrey, Strepomyces virus Rima,Microbacterium virus Hendrix, Gordonia virus Fryberger, Gordoniavirus Ronaldo, Aeromonas virus pIS4A, Streptomyces virus Rowa,Gordonia virus Ruthy, Streptomyces virus Jay2Jay, Streptomycesvirus Mildred21, Streptomyces virus NootNoot, Streptomyces virusParadiddles, Streptomyces virus Peebs, Streptomyces virusSamisti12, Pseudomonas virus SM1, Corynebacterium virus SamW,Xylella virus Salvo, Xylella virus Sano, Caulobacter virus Sansa,Enterococcus virus BC611, Enterococcus virus IMEEF1, Enterococcusvirus SAP6, Enterococcus virus VD13, Streptococcus virus SPQS1,Salmonella virus Sasha, Corynebacterium virus BFK20, Geobacillusvirus Tp84, Streptomyces virus Scap1, Gordonia virus Schnabeltier,Microbacterium virus Schubert, Pseudomonas virus 73, Pseudomonasvirus Ab26, Pseudomonas virus Kakheti25, Escherichia virus Cajan,Escherichia virus Seurat, Caulobacter virus Seuss, Staphylococcusvirus SEP9, Staphylococcus virus Sextaec, Paenibacillus virus Diva,Paenibacillus virus Hb10c2, Paenibacillus virus Rani, Paenibacillusvirus Shelly, Paenibacillus virus Sitara, Paenibacillus virusWillow, Lactococcus virus 712, Lactococcus virus ASCC191,Lactococcus virus ASCC273, Lactococcus virus ASCC281, Lactococcusvirus ASCC465, Lactococcus virus ASCC532, Lactococcus virus Bibb29,Lactococcus virus bIL170, Lactococcus virus CB13, Lactococcus virusCB14, Lactococcus virus CB19, Lactococcus virus CB20, Lactococcusvirus jj50, Lactococcus virus P2, Lactococcus virus P008,Lactococcus virus sk1, Lactococcus virus S14, Bacillus virus Slash,Bacillus virus Stahl, Bacillus virus Staley, Bacillus virus Stills,Gordonia virus Bachita, Gordonia virus ClubL, Gordonia virusSmoothie, Arthobacter virus Sonali, Gordonia virus Soups, Gordoniavirus Strosahl, Gordonia virus Wait, Gordonia virus Sour, Bacillusvirus SPbeta, Microbacterium virus Hyperion, Microbacterium virusSquash, Burkholderia virus phi6442, Burkholderia virus phi1026b,Burkholderia virus phiE125, Achromobacter virus 83-24,Achromobacter virus JWX, Arthrobacter virus Tank, Gordonia virusSuzy, Gordonia virus Terapin, Streptomyces virus TG1, Mycobacteriumvirus Anaya, Mycobacterium virus Angelica, Mycobacterium virusCrimD, Mycobacterium virus Fionnbharth, Mycobacterium virus JAWS,Mycobacterium virus Larva, Mycobacterium virus MacnCheese,Mycobacterium virus Pixie, Mycobacterium virus TM4, Tsukamurellavirus TIN2, Tsukamurella virus TIN3, Tsukamurella virus TIN4,Rhodobacter virus RcSpartan, Rhodobacter virus RcTitan,Mycobacterium virus Tortellini, Staphylococcus virus 47,Staphylococcus virus 3a, Staphylococcus virus 42e, Staphylococcusvirus IPLA35, Staphylococcus virus phi12, Staphylococcus virusphiSLT, Mycobacterium virus 32HC, Rhodococcus virus Trina, Gordoniavirus Trine, Paenibacillus virus Tripp, Flavobacterium virus 1H,Flavobacterium virus 23T, Flavobacterium virus 2A, Flavobacteriumvirus 6H, Streptomyces virus Lilbooboo, Streptomyces virus Vash,Paenibacillus virus Vegas, Gordonia virus Vendetta, Paracoccusvirus Shpa, Pantoea virus Vid5, Acinetobacter virus B1251,Acinetobacter virus R3177, Gordonia virus Brandonk123, Gordoniavirus Lennon, Gordonia virus Vivi2, Bordetella virus CN1,Bordetella virus CN2, Bordetella virus FP1, Bordetella virus MW2,Bacillus virus Wbeta, Rhodococcus virus Weasel, Mycobacterium virusWildcat, Gordonia virus Billnye, Gordonia virus Twister6, Gordoniavirus Wizard, Gordonia virus Hotorobo, Gordonia virus Woes,Streptomyces virus TP1604, Streptomyces virus YDN12, Roseobactervirus RDJL1, Roseobacter virus RDJL2, Xanthomonas virus OP1,Xanthomonas virus Xop411, Xanthomonas virus Xp10, Arthobacter virusYang, Alphaproteobacteria virus phiJl001, Pseudomonas virus LKO4,Pseudomonas virus M6, Pseudomonas virus MP1412, Pseudomonas virusPAE1, Pseudomonas virus Yua, Gordonia virus Yvonnetastic,Microbacterium virus Zeta1847, Rhodococcus virus RGL3,Paenibacillus virus Lily, Vibrio virus CTXphi, Propionibacteriumvirus B5, Vibrio virus KSF1, Xanthomonas virus Cf1c, Vibrio virusfs1, Vibrio virus VGJ, Ralstonia virus RS551, Ralstonia virusRS603, Ralstonia virus RSM1, Ralstonia virus RSM3, Escherichiavirus If1, Escherichia virus M13, Escherichia virus 122, Salmonellavirus IKe, Ralstonia virus PE226, Pseudomonas virus Pf1,Stenotrophomonas virus PSH1, Ralstonia virus RSS1, Vibrio virusfs2, Vibrio virus VFJ, Stenotrophomonas virus SMA6,Stenotrophomonas virus SMA5, Stenotrophomonas virus SMA7,Pseudomonas virus Pf3, Thermus virus OH3, Vibrio virus VfO3K6,Vibrio virus VCY, Vibrio virus Vf33, Xanthomonas virus Xf109,Acholeplasma virus L51, Spiroplasma virus SVTS2, Spiroplasma virusC74, Spiroplasma virus R8A2B, Spiroplasma virus SkV1CR23x,Escherichia virus alpha3, Escherichia virus ID21, Escherichia virusID32, Escherichia virus ID62, Escherichia virus NC28, Escherichiavirus NC29, Escherichia virus NC35, Escherichia virus phiK,Escherichia virus St1, Escherichia virus WA45, Escherichia virusG4, Escherichia virus ID52, Escherichia virus Talmos, Escherichiavirus phiX174, Bdellovibrio virus MAC1, Bdellovibrio virus MH2K,Chlamydia virus Chp1, Chlamydia virus Chp2, Chlamydia virus CPAR39,Chlamydia virus CPG1, Spiroplasma virus SpV4, Bombyx moribidensovirus, Acerodon celebensis polyomavirus 1, Artibeusplanirostris polyomavirus 2, Artibeus planirostris polyomavirus 3,Ateles paniscus polyomavirus 1, Cardioderma cor polyomavirus 1,Carollia perspicillata polyomavirus 1, Chlorocebus pygerythruspolyomavirus 1, Chlorocebus pygerythrus polyomavirus 3, Dobsoniamoluccensis polyomavirus 1, Eidolon helvum polyomavirus 1, Gorillagorilla polyomavirus 1, Human polyomavirus 5, Human polyomavirus 8,Human polyomavirus 9, Human polyomavirus 13, Human polyomavirus 14,Macaca fascicularis polyomavirus 1, Mesocricetus auratuspolyomavirus 1, Miniopterus schreibersii polyomavirus 1,Miniopterus schreibersii polyomavirus 2, Molossus molossuspolyomavirus 1, Mus musculus polyomavirus 1, Otomops martienssenipolyomavirus 1, Otomops martiensseni polyomavirus 2, Pantroglodytes polyomavirus 1, Pan troglodytes polyomavirus 2, Pantroglodytes polyomavirus 3, Pan troglodytes polyomavirus 4, Pantroglodytes polyomavirus 5, Pan troglodytes polyomavirus 6, Pantroglodytes polyomavirus 7, Papio cynocephalus polyomavirus 1,Piliocolobus badius polyomavirus 1, Piliocolobus rufomitratuspolyomavirus 1, Pongo abelii polyomavirus 1, Pongo pygmaeuspolyomavirus 1, Procyon lotor polyomavirus 1, Pteropus vampyruspolyomavirus 1, Rattus norvegicus polyomavirus 1, Sorex araneuspolyomavirus 1, Sorex coronatus polyomavirus 1, Sorex minutuspolyomavirus 1, Sturnira lilium polyomavirus 1, Tupaia belangeripolyomavirus 1, Acerodon celebensis polyomavirus 2, Artibeusplanirostris polyomavirus 1, Canis familiaris polyomavirus 1, Cebusalbifrons polyomavirus 1, Cercopithecus erythrotis polyomavirus 1,Chlorocebus pygerythrus polyomavirus 2, Desmodus rotunduspolyomavirus 1, Dobsonia moluccensis polyomavirus 2, Dobsoniamoluccensis polyomavirus 3, Enhydra lutris polyomavirus 1, Equuscaballus polyomavirus 1, Human polyomavirus 1, Human polyomavirus2, Human polyomavirus 3, Human polyomavirus 4, Leptonychotesweddellii polyomavirus 1, Loxodonta africana polyomavirus 1, Macacamulatta polyomavirus 1, Mastomys natalensis polyomavirus 1, Melesmeles polyomavirus 1, Microtus arvalis polyomavirus 1, Miniopterusafricanus polyomavirus 1, Mus musculus polyomavirus 2, Mus musculuspolyomavirus 3, Myodes glareolus polyomavirus 1, Myotis lucifuguspolyomavirus 1, Pan troglodytes polyomavirus 8, Papio cynocephaluspolyomavirus 2, Pteronotus davyi polyomavirus 1, Pteronotusparnellii polyomavirus 1, Rattus norvegicus polyomavirus 2,Rousettus aegyptiacus polyomavirus 1, Saimiri boliviensispolyomavirus 1, Saimiri sciureus polyomavirus 1, Vicugna pacospolyomavirus 1, Zalophus californianus polyomavirus 1, Humanpolyomavirus 6, Human polyomavirus 7, Human polyomavirus 10, Humanpolyomavirus 11, Anser anser polyomavirus 1, Ayes polyomavirus 1,Corvus monedula polyomavirus 1, Cracticus torquatus polyomavirus 1,Erythrura gouldiae polyomavirus 1, Lonchura maja polyomavirus 1,Pygoscelis adeliae polyomavirus 1, Pyrrhula pyrrhula polyomavirus1, Serinus canaria polyomavirus 1, Ailuropoda melanoleucapolyomavirus 1, Bos taurus polyomavirus 1, Centropristis striatapolyomavirus 1, Delphinus delphis polyomavirus 1, Procyon lotorpolyomavirus 2, Rhynchobatus djiddensis polyomavirus 1, Sparusaurata polyomavirus 1, Trematomus bernacchii polyomavirus 1,Trematomus pennellii polyomavirus 1, Alphapapillomavirus 1,Alphapapillomavirus 2, Alphapapillomavirus 3, Alphapapillomavirus4, Alphapapillomavirus 5, Alphapapillomavirus 6,Alphapapillomavirus 7, Alphapapillomavirus 8, Alphapapillomavirus9, Alphapapillomavirus 10, Alphapapillomavirus 11,Alphapapillomavirus 12, Alphapapillomavirus 13, Alphapapillomavirus14, Betapapillomavirus 1, Betapapillomavirus 2, Betapapillomavirus3, Betapapillomavirus 4, Betapapillomavirus 5, Betapapillomavirus6, Chipapillomavirus 1, Chipapillomavirus 2, Chipapillomavirus 3,Deltapapillomavirus 1, Deltapapillomavirus 2, Deltapapillomavirus3, Deltapapillomavirus 4, Deltapapillomavirus 5,Deltapapillomavirus 6, Deltapapillomavirus 7, Dyochipapillomavirus1, Dyodeltapapillomavirus 1, Dyoepsilonpapillomavirus 1,Dyoetapapillomavirus 1, Dyoiotapapillomavirus 1,Dyoiotapapillomavirus 2, Dyokappapapillomavirus 1,Dyokappapapillomavirus 2, Dyokappapapillomavirus 3,Dyokappapapillomavirus 4, Dyokappapapillomavirus 5,Dyolambdapapillomavirus 1, Dyomupapillomavirus 1,Dyonupapillomavirus 1, Dyoomegapapillomavirus 1,Dyoomikronpapillomavirus 1, Dyophipapillomavirus 1,Dyopipapillomavirus 1, Dyopsipapillomavirus 1, Dyorhopapillomavirus1, Dyosigmapapillomavirus 1, Dyotaupapillomavirus 1,Dyothetapapillomavirus 1, Dyoupsilonpapillomavirus 1,Dyoxipapillomavirus 1, Dyoxipapillomavirus 2, Dyozetapapillomavirus1, Epsilonpapillomavirus 1, Epsilonpapillomavirus 2,Etapapillomavirus 1, Gammapapillomavirus 1, Gammapapillomavirus 2,Gammapapillomavirus 3, Gammapapillomavirus 4, Gammapapillomavirus5, Gammapapillomavirus 6, Gammapapillomavirus 7,Gammapapillomavirus 8, Gammapapillomavirus 9, Gammapapillomavirus10, Gammapapillomavirus 11, Gammapapillomavirus 12,Gammapapillomavirus 13, Gammapapillomavirus 14, Gammapapillomavirus15, Gammapapillomavirus 16, Gammapapillomavirus 17,Gammapapillomavirus 18, Gammapapillomavirus 19, Gammapapillomavirus20, Gammapapillomavirus 21, Gammapapillomavirus 22,Gammapapillomavirus 23, Gammapapillomavirus 24, Gammapapillomavirus25, Gammapapillomavirus 26, Gammapapillomavirus 27,Iotapapillomavirus 1, Iotapapillomavirus 2, Kappapapillomavirus 1,Kappapapillomavirus 2, Lambdapapillomavirus 1, Lambdapapillomavirus2, Lambdapapillomavirus 3, Lambdapapillomavirus 4,Lambdapapillomavirus 5, Mupapillomavirus 1, Mupapillomavirus 2,Mupapillomavirus 3, Nupapillomavirus 1, Omegapapillomavirus 1,Omikronpapillomavirus 1, Phipapillomavirus 1, Pipapillomavirus 1,Pipapillomavirus 2, Psipapillomavirus 1, Psipapillomavirus 2,Psipapillomavirus 3, Rhopapillomavirus 1, Rhopapillomavirus 2,Sigmapapillomavirus 1, Taupapillomavirus 1, Taupapillomavirus 2,Taupapillomavirus 3, Taupapillomavirus 4, Thetapapillomavirus 1,Treisdeltapapillomavirus 1, Treisepsilonpapillomavirus 1,Treisetapapillomavirus 1, Treisiotapapillomavirus 1,Treiskappapapillomavirus 1, Treisthetapapillomavirus 1,Treiszetapapillomavirus 1, Upsilonpapillomavirus 1,Upsilonpapillomavirus 2, Upsilonpapillomavirus 3, Xipapillomavirus1, Xipapillomavirus 2, Xipapillomavirus 3, Xipapillomavirus 4,Xipapillomavirus 5, Zetapapillomavirus 1, Alefpapillomavirus 1,Asteroid aquambidensovirus 1, Decapod aquambidensovirus 1,Blattodean blattambidensovirus 1, Hemipteran hemiambidensovirus 1,Hemipteran hemiambidensovirus 2, Lepidopteran iteradensovirus 1,Lepidopteran iteradensovirus 2, Lepidopteran iteradensovirus 3,Lepidopteran iteradensovirus 4, Lepidopteran iteradensovirus 5,Orthopteran miniambidensovirus 1, Blattodean pefuambidensovirus 1,Dipteran protoambidensovirus 1, Lepidopteran protoambidensovirus 1,Hemipteran scindoambidensovirus 1, Hymenopteranscindoambidensovirus 1, Orthopteran scindoambidensovirus 1,Dipteran brevihamaparvovirus 1, Dipteran brevihamaparvovirus 2,Carnivore chaphamaparvovirus 1, Chiropteran chaphamaparvovirus 1,Galliform chaphamaparvovirus 1, Galliform chaphamaparvovirus 2,Galliform chaphamaparvovirus 3, Rodent chaphamaparvovirus 1,Rodent

chaphamaparvovirus 2, Ungulate chaphamaparvovirus 1, Decapodhepanhamaparvovirus 1, Syngnathid ichthamaparvovirus 1, Decapodpenstylhamaparvovirus 1, Carnivore amdoparvovirus 1, Carnivoreamdoparvovirus 2, Carnivore amdoparvovirus 3, Carnivoreamdoparvovirus 4, Carnivore amdoparvovirus 5, Chiropteranartiparvovirus 1, Galliform aveparvovirus 1, Gruiform aveparvovirus1, Carnivore bocaparvovirus 1, Carnivore bocaparvovirus 2,Carnivore bocaparvovirus 3, Carnivore bocaparvovirus 4, Carnivorebocaparvovirus 5, Carnivore bocaparvovirus 6, Chiropteranbocaparvovirus 1, Chiropteran bocaparvovirus 2, Chiropteranbocaparvovirus 3, Chiropteran bocaparvovirus 4, Lagomorphbocaparvovirus 1, Pinniped bocaparvovirus 1, Pinnipedbocaparvovirus 2, Primate bocaparvovirus 1, Primate bocaparvovirus2, Rodent bocaparvovirus 1, Rodent bocaparvovirus 2, Ungulatebocaparvovirus 1, Ungulate bocaparvovirus 2, Ungulatebocaparvovirus 3, Ungulate bocaparvovirus 4, Ungulatebocaparvovirus 5, Ungulate bocaparvovirus 6, Ungulatebocaparvovirus 7, Ungulate bocaparvovirus 8, Pinnipedcopiparvovirus 1, Ungulate copiparvovirus 1, Ungulatecopiparvovirus 2, Ungulate copiparvovirus 3, Ungulatecopiparvovirus 4, Ungulate copiparvovirus 5, Ungulatecopiparvovirus 6, Adeno-associated dependoparvovirus A,Adeno-associated dependoparvovirus B, Anseriform dependoparvovirus1, Avian dependoparvovirus 1, Chiropteran dependoparvovirus 1,Pinniped dependoparvovirus 1, Rodent dependoparvovirus 1, Rodentdependoparvovirus 2, Squamate dependoparvovirus 1, Squamatedependoparvovirus 2, Pinniped erythroparvovirus 1, Primateerythroparvovirus 1, Primate erythroparvovirus 2, Primateerythroparvovirus 3, Primate erythroparvovirus 4, Rodenterythroparvovirus 1, Ungulate erythroparvovirus 1, Primateloriparvovirus 1, Carnivore protoparvovirus, Carnivoreprotoparvovirus 1, Chiropteran protoparvovirus 1, Eulipotyphlaprotoparvovirus 1, Primate protoparvovirus 1, Primateprotoparvovirus 2, Primate protoparvovirus 3, Primateprotoparvovirus 4, Rodent protoparvovirus 1, Rodent protoparvovirus2, Rodent protoparvovirus 3, Ungulate protoparvovirus 1, Ungulateprotoparvovirus 2, Chiropteran tetraparvovirus 1, Primatetetraparvovirus 1, Ungulate tetraparvovirus 1, Ungulatetetraparvovirus 2, Ungulate tetraparvovirus 3, Ungulatetetraparvovirus 4, Chaetoceros diatodnavirus 1, Avon-HeathcoteEstuary associated kieseladnavirus, Chaetocerosprotobacilladnavirus 1, Chaetoceros protobacilladnavirus 2,Chaetoceros protobacilladnavirus 3, Chaetocerosprotobacilladnavirus 4, Marine protobacilladnavirus 1, Snailassociated protobacilladnavirus 1, Snail associatedprotobacilladnavirus 2, Barbel circovirus, Bat associatedcircovirus 1, Bat associated circovirus 2, Bat associatedcircovirus 3, Bat associated circovirus 4, Bat associatedcircovirus 5, Bat associated circovirus 6, Bat associatedcircovirus 7, Bat associated circovirus 8, Bat associatedcircovirus 9, Bat associated circovirus 10, Bat associatedcircovirus 11, Bat associated circovirus 12, Beak and featherdisease virus, Canary circovirus, Canine circovirus, Chimpanzeeassociated circovirus 1, Civet circovirus, Duck circovirus,European catfish circovirus, Finch circovirus, Goose circovirus,Gull circovirus, Human associated circovirus 1, Mink circovirus,Mosquito associated circovirus 1, Pigeon circovirus, Porcinecircovirus 1, Porcine circovirus 2, Porcine circovirus 3, Ravencircovirus, Rodent associated circovirus 1, Rodent associatedcircovirus 2, Rodent associated circovirus 3, Rodent associatedcircovirus 4, Rodent associated circovirus 5, Rodent associatedcircovirus 6, Rodent associated circovirus 7, Starling circovirus,Swan circovirus, Tick associated circovirus 1, Tick associatedcircovirus 2, Zebra finch circovirus, Ant associated cyclovirus 1,Bat associated cyclovirus 1, Bat associated cyclovirus 2, Batassociated cyclovirus 3, Bat associated cyclovirus 4, Batassociated cyclovirus 5, Bat associated cyclovirus 6, Batassociated cyclovirus 7, Bat associated cyclovirus 8, Batassociated cyclovirus 9, Bat associated cyclovirus 10, Batassociated cyclovirus 11, Bat associated cyclovirus 12, Batassociated cyclovirus 13, Bat associated cyclovirus 14, Batassociated cyclovirus 15, Bat associated cyclovirus 16, Bovineassociated cyclovirus 1, Chicken associated cyclovirus 1, Chickenassociated cyclovirus 2, Chimpanzee associated cyclovirus 1,Cockroach associated cyclovirus 1, Dragonfly associated cyclovirus1, Dragonfly associated cyclovirus 2, Dragonfly associatedcyclovirus 3, Dragonfly associated cyclovirus 4, Dragonflyassociated cyclovirus 5, Dragonfly associated cyclovirus 6,Dragonfly associated cyclovirus 7, Dragonfly associated cyclovirus8, Duck associated cyclovirus 1, Feline associated cyclovirus 1,Goat associated cyclovirus 1, Horse associated cyclovirus 1, Humanassociated cyclovirus 1, Human associated cyclovirus 2, Humanassociated cyclovirus 3, Human associated cyclovirus 4, Humanassociated cyclovirus 5, Human associated cyclovirus 6, Humanassociated cyclovirus 7, Human associated cyclovirus 8, Humanassociated cyclovirus 9, Human associated cyclovirus 10, Humanassociated cyclovirus 11, Human associated cyclovirus 12, Mouseassociated cyclovirus 1, Rodent associated cyclovirus 1, Rodentassociated cyclovirus 2, Spider associated cyclovirus 1, Squirrelassociated cyclovirus 1, Bovine associated bovismacovirus 1, Bovineassociated bovismacovirus 2, Dragonfly associated bovismacovirus 1,Bovine associated cosmacovirus 1, Dragonfly associateddragsmacovirus 1, Bovine associated drosmacovirus 1, Camelassociated drosmacovirus 1, Camel associated drosmacovirus2, Bovineassociated huchismacovirus 1, Bovine associated huchismacovirus 2,Chicken associated huchismacovirus 1, Chicken associatedhuchismacovirus 2, Human associated huchismacovirus 1, Humanassociated huchismacovirus 2, Human associated huchismacovirus 3,Bovine associated porprismacovirus 1, Camel associatedporprismacovirus 1, Camel associated porprismacovirus 2, Camelassociated porprismacovirus 3, Camel associated porprismacovirus 4,Chimpanzee associated porprismacovirus 1, Chimpanzee associatedporprismacovirus 2, Gorilla associated porprismacovirus 1, Howlermonkey associated porprismacovirus 1, Human associatedporprismacovirus 1, Human associated porprismacovirus 2, Lemurassociated porprismacovirus 1, Porcine associated porprismacovirus1, Porcine associated porprismacovirus 2, Porcine associatedporprismacovirus 3, Porcine associated porprismacovirus 4, Porcineassociated porprismacovirus 5, Porcine associated porprismacovirus6, Porcine associated porprismacovirus 7, Porcine associatedporprismacovirus 8, Porcine associated porprismacovirus 9, Porcineassociated porprismacovirus 10, Rat associated porprismacovirus 1,Sheep associated porprismacovirus 1, Sheep associatedporprismacovirus 2, Sheep associated porprismacovirus 3, Turkeyassociated porprismacovirus 1, Abaca bunchy top virus, Bananabunchy top virus, Cardamom bushy dwarf virus, Black medic leaf rollvirus,

Faba bean necrotic stunt virus, Faba bean necrotic yellows virus,Faba bean yellow leaf virus, Milk vetch dwarf virus, Pea necroticyellow dwarf virus, Pea yellow stunt virus, Subterranean cloverstunt virus, Coconut foliar decay virus, Brisavirus, Vientovirus,Beet curly top Iran virus, Exomis microphylla latent virus, Spinachcurly top Arizona virus, Abutilon golden mosaic virus, Abutilonmosaic Bolivia virus, Abutilon mosaic Brazil virus, Abutilon mosaicvirus, African cassava mosaic Burkina Faso virus, African cassavamosaic virus, Ageratum enation virus, Ageratum leaf curl Sichuanvirus, Ageratum leaf curl virus, Ageratum yellow vein Hualianvirus, Ageratum yellow vein Sri Lanka virus, Ageratum yellow veinvirus, Allamanda leaf curl virus, Allamanda leaf mottle distortionvirus, Alternanthera yellow vein virus, Andrographis yellow veinleaf curl virus, Asystasia mosaic Madagascar virus, Bean calicomosaic virus, Bean chlorosis virus, Bean dwarf mosaic virus, Beangolden mosaic virus, Bean golden yellow mosaic virus, Bean leafcrumple virus, Bean white chlorosis mosaic virus, Bean yellowmosaic Mexico virus, Bhendi yellow vein Bhubhaneswar virus, Bhendiyellow vein Haryana virus, Bhendi yellow vein mosaic Delhi virus,Bhendi yellow vein mosaic virus, Bitter gourd yellow mosaic virus,Blainvillea yellow spot virus, Blechum interveinal chlorosis virus,Blechum yellow vein virus, Boerhavia yellow spot virus, Cabbageleaf curl Jamaica virus, Cabbage leaf curl virus, Capraria yellowspot virus, Cassava mosaic Madagascar virus, Catharanthus yellowmosaic virus, Centrosema yellow spot virus, Chayote yellow mosaicvirus, Chenopodium leaf curl virus, Chilli leaf curl Ahmedabadvirus, Chilli leaf curl Bhavanisagar virus, Chilli leaf curl Gondavirus, Chilli leaf curl India virus, Chilli leaf curl Kanpur virus,Chilli leaf curl Sri Lanka virus, Chilli leaf curl Vellanad virus,Chilli leaf curl virus, Chino del tomate Amazonas virus, Chino deltomate virus, Cleome golden mosaic virus, Cleome leaf crumplevirus, Clerodendron golden mosaic virus, Clerodendron yellow mosaicvirus, Clerodendrum golden mosaic China virus, Clerodendrum goldenmosaic Jiangsu virus, Cnidoscolus mosaic leaf deformation virus,Coccinia mosaic Tamil Nadu virus, Common bean mottle virus, Commonbean severe mosaic virus, Corchorus golden mosaic virus, Corchorusyellow spot virus, Corchorus yellow vein mosaic virus, Corchorusyellow vein virus, Cotton chlorotic spot virus, Cotton leaf crumplevirus, Cotton leaf curl Alabad virus, Cotton leaf curl Bangalorevirus, Cotton leaf curl Barasat virus, Cotton leaf curl Geziravirus, Cotton leaf curl Kokhran virus, Cotton leaf curl Multanvirus, Cotton yellow mosaic virus, Cowpea bright yellow mosaicvirus, Cowpea golden mosaic virus, Crassocephalum yellow veinvirus, Croton golden mosaic virus, Croton yellow vein mosaic virus,Cucurbit leaf crumple virus, Dalechampia chlorotic mosaic virus,Datura leaf curl virus, Datura leaf distortion virus, Deinbolliamosaic virus, Desmodium leaf distortion virus, Desmodium mottlevirus, Dicliptera yellow mottle Cuba virus, Dicliptera yellowmottle virus, Dolichos yellow mosaic virus, Duranta leaf curlvirus, East African cassava mosaic Cameroon virus, East Africancassava mosaic Kenya virus, East African cassava mosaic Malawivirus, East African cassava mosaic virus, East African cassavamosaic Zanzibar virus, Eclipta yellow vein virus, Emilia yellowvein Fujian virus, Emilia yellow vein Thailand virus, Emilia yellowvein virus, Erectites yellow mosaic virus, Eupatorium yellow veinmosaic virus, Eupatorium yellow vein virus, Euphorbia leaf curlGuangxi virus, Euphorbia leaf curl virus, Euphorbia mosaic Peruvirus, Euphorbia mosaic virus, Euphorbia yellow leaf curl virus,Euphorbia yellow mosaic virus, French bean leaf curl virus,Hedyotis uncinella yellow mosaic virus, Hemidesmus yellow mosaicvirus, Hibiscus golden mosaic virus, Hollyhock leaf curl virus,Hollyhock yellow vein mosaic virus, Hollyhock yellow vein virus,Honeysuckle yellow vein virus, Horsegram yellow mosaic virus,Indian cassava mosaic virus, Jacquemontia mosaic Yucatan virus,Jacquemontia yellow mosaic virus, Jacquemontia yellow vein virus,Jatropha leaf curl Gujarat virus, Jatropha leaf curl virus,Jatropha leaf yellow mosaic virus, Jatropha mosaic India virus,Jatropha mosaic Nigeria virus, Jatropha mosaic virus, Jatrophayellow mosaic virus, Kudzu mosaic virus, Leonurus mosaic virus,Lindernia anagallis yellow vein virus, Lisianthus enation leaf curlvirus, Ludwigia yellow vein Vietnam virus, Ludwigia yellow veinvirus, Luffa yellow mosaic virus, Lycianthes yellow mosaic virus,Macroptilium bright mosaic virus, Macroptilium common mosaic virus,Macroptilium golden mosaic virus, Macroptilium mosaic Puerto Ricovirus, Macroptilium yellow mosaic Florida virus, Macroptiliumyellow mosaic virus, Macroptilium yellow spot virus, Macroptiliumyellow vein virus, Malvastrum bright yellow mosaic virus,Malvastrum leaf curl Philippines virus, Malvastrum leaf curl virus,Malvastrum yellow mosaic Helshire virus, Malvastrum yellow mosaicJamaica virus, Malvastrum yellow mosaic virus, Malvastrum yellowvein Cambodia virus, Malvastrum yellow vein Honghe virus,Malvastrum yellow vein Lahore virus, Malvastrum yellow vein virus,Malvastrum yellow vein Yunnan virus, Melochia mosaic virus,Melochia yellow mosaic virus, Melon chlorotic leaf curl virus,Melon chlorotic mosaic virus, Melon yellow mosaic virus, Merremiamosaic Puerto Rico virus, Merremia mosaic virus, Mesta yellow veinmosaic Bahraich virus, Mimosa yellow leaf curl virus, Mirabilisleaf curl virus, Mungbean yellow mosaic India virus, Mungbeanyellow mosaic virus, Okra enation leaf curl virus, Okra leaf curlOman virus, Okra mottle virus, Okra yellow crinkle virus, Okrayellow mosaic Mexico virus, Oxalis yellow vein virus, Papaya leafcrumple virus, Papaya leaf curl China virus, Papaya leaf curlGuandong virus, Papaya leaf curl virus, Passionfruit leaf curlvirus, Passionfruit leaf distortion virus, Passionfruit severe leafdistortion virus, Pavonia mosaic virus, Pavonia yellow mosaicvirus, Pea leaf distortion virus, Pedilanthus leaf curl virus,Pepper golden mosaic virus, Pepper huasteco yellow vein virus,Pepper leaf curl Bangladesh virus, Pepper leaf curl Lahore virus,Pepper leaf curl virus, Pepper leaf curl Yunnan virus, Pepperleafroll virus, Pepper yellow leaf curl Aceh virus, Pepper yellowleaf curl Indonesia virus, Pepper yellow leaf curl Indonesia virus2, Pepper yellow leaf curl Thailand virus, Pepper yellow leaf curlvirus, Pepper yellow vein Mali virus, Potato yellow mosaic Panamavirus, Potato yellow mosaic virus, Pouzolzia golden mosaic virus,Pouzolzia mosaic Guangdong virus, Pouzolzia yellow mosaic virus,Premna leaf curl virus, Pumpkin yellow mosaic virus, Radish leafcurl virus, Ramie mosaic Yunnan virus, Rhynchosia golden mosaicHavana virus, Rhynchosia golden mosaic Sinaloa virus, Rhynchosiagolden mosaic virus, Rhynchosia mild mosaic virus, Rhynchosiarugose golden mosaic virus, Rhynchosia yellow mosaic India virus,Rhynchosia yellow mosaic virus, Rose leaf curl virus, Sauropus leafcurl virus, Senecio yellow mosaic virus, Senna leaf curl virus,Sida angular mosaic virus, Sida bright yellow mosaic virus, Sidachlorotic mottle virus, Sida chlorotic vein virus, Sida ciliarisgolden mosaic virus, Sida common mosaic virus, Sida golden mosaicBraco virus, Sida golden mosaic Brazil virus, Sida golden mosaicBuckup virus, Sida golden mosaic Costa Rica virus, Sida goldenmosaic Florida virus, Sida golden mosaic Lara virus, Sida goldenmosaic virus, Sida golden mottle virus, Sida golden yellow spotvirus, Sida golden yellow vein virus, Sida leaf curl virus, Sidamicrantha mosaic virus, Sida mosaic Alagoas virus, Sida mosaicBolivia virus 1, Sida mosaic Bolivia virus 2, Sida mosaic Sinaloavirus, Sida mottle Alagoas virus, Sida mottle virus, Sida yellowblotch virus, Sida yellow leaf curl virus, Sida yellow mosaicAlagoas virus, Sida yellow mosaic China virus, Sida yellow mosaicvirus, Sida yellow mosaic Yucatan virus, Sida yellow mottle virus,Sida yellow net virus, Sida yellow vein Vietnam virus, Sida yellowvein virus, Sidastrum golden leaf spot virus, Siegesbeckia yellowvein Guangxi virus, Siegesbeckia yellow vein virus, Solanum mosaicBolivia virus, South African cassava mosaic virus, Soybeanblistering mosaic virus, Soybean chlorotic blotch virus, Soybeanmild mottle virus, Spilanthes yellow vein virus, Spinach yellowvein virus, Squash leaf curl China virus, Squash leaf curlPhilippines virus, Squash leaf curl virus, Squash leaf curl Yunnanvirus, Squash mild leaf curl virus, Sri Lankan cassava mosaicvirus, Stachytarpheta leaf curl virus, Sunn hemp leaf distortionvirus, Sweet potato golden vein Korea virus, Sweet potato leaf curlCanary virus, Sweet potato leaf curl China virus, Sweet potato leafcurl Georgia virus, Sweet potato leaf curl Guangxi virus, Sweetpotato leaf curl Henan virus, Sweet potato leaf curl Hubei virus,Sweet potato leaf curl Sao Paulo virus, Sweet potato leaf curlShandong virus, Sweet potato leaf curl Sichuan virus 1, Sweetpotato leaf curl Sichuan virus 2, Sweet potato leaf curl SouthCarolina virus, Sweet potato leaf curl virus, Sweet potato mosaicvirus, Synedrella yellow vein clearing virus, Telfairia goldenmosaic virus, Tobacco curly shoot virus, Tobacco leaf curl Comorosvirus, Tobacco leaf curl Cuba virus, Tobacco leaf curl DominicanRepublic virus, Tobacco leaf curl Pusa virus, Tobacco leaf curlThailand virus, Tobacco leaf curl Yunnan virus, Tobacco leaf curlZimbabwe virus, Tobacco leaf rugose virus, Tobacco mottle leaf curlvirus, Tobacco yellow crinkle virus, Tomato bright yellow mosaicvirus, Tomato bright yellow mottle virus, Tomato chino La Pazvirus, Tomato chlorotic leaf curl virus, Tomato chlorotic leafdistortion virus, Tomato chlorotic mottle Guyane virus, Tomatochlorotic mottle virus, Tomato common mosaic virus, Tomato curlystunt virus, Tomato dwarf leaf virus, Tomato enation leaf curlvirus, Tomato golden leaf distortion virus, Tomato golden leaf spotvirus, Tomato golden mosaic virus, Tomato golden mottle virus,Tomato golden vein virus, Tomato interveinal chlorosis virus,Tomato latent virus, Tomato leaf curl Anjouan virus, Tomato leafcurl Arusha virus, Tomato leaf curl Bangalore virus, Tomato leafcurl Bangladesh virus, Tomato leaf curl Burkina Faso virus, Tomatoleaf curl Cebu virus, Tomato leaf curl China virus, Tomato leafcurl Comoros virus, Tomato leaf curl Diana virus, Tomato leaf curlGhana virus, Tomato leaf curl Guangdong virus, Tomato leaf curlGuangxi virus, Tomato leaf curl Gujarat virus, Tomato leaf curlHainan virus, Tomato leaf curl Hanoi virus, Tomato leaf curlHsinchu virus, Tomato leaf curl Iran virus, Tomato leaf curl Japanvirus, Tomato leaf curl Java virus, Tomato leaf curl Joydebpurvirus, Tomato leaf curl Karnataka virus, Tomato leaf curl Karnatakavirus 2, Tomato leaf curl Karnataka virus 3, Tomato leaf curlKerala virus, Tomato leaf curl Laos virus, Tomato leaf curl Liwavirus, Tomato leaf curl Madagascar virus, Tomato leaf curl Mahevirus, Tomato leaf curl Malaysia virus, Tomato leaf curl Malivirus, Tomato leaf curl Mindanao virus, Tomato leaf curl Mohelivirus, Tomato leaf curl Namakely virus, Tomato leaf curl New Delhivirus, Tomato leaf curl New Delhi virus 2, Tomato leaf curl NewDelhi virus 4, Tomato leaf curl New Delhi virus 5, Tomato leaf curlNigeria virus, Tomato leaf curl Palampur virus, Tomato leaf curlPatna virus, Tomato leaf curl Philippines virus, Tomato leaf curlPune virus, Tomato leaf curl purple vein virus, Tomato leaf curlRajasthan virus, Tomato leaf curl Seychelles virus, Tomato leafcurl Sinaloa virus, Tomato leaf curl Sri Lanka virus, Tomato leafcurl Sudan virus, Tomato leaf curl Sulawesi virus, Tomato leaf curlTaiwan virus, Tomato leaf curl Tanzania virus, Tomato leaf curlToliara virus, Tomato leaf curl Uganda virus, Tomato leaf curlVietnam virus, Tomato leaf curl virus, Tomato leaf deformationvirus, Tomato leaf distortion virus, Tomato mild mosaic virus,Tomato mild yellow leaf curl Aragua virus, Tomato mosaic Havanavirus, Tomato mottle leaf curl virus, Tomato mottle Taino virus,Tomato mottle virus, Tomato mottle wrinkle virus, Tomato rugosemosaic virus, Tomato rugose yellow leaf curl virus, Tomato severeleaf curl Kalakada virus, Tomato severe leaf curl virus, Tomatosevere rugose virus, Tomato twisted leaf virus, Tomato wrinkledmosaic virus, Tomato yellow leaf curl Axarquia virus, Tomato yellowleaf curl China virus, Tomato yellow leaf curl Guangdong virus,Tomato yellow leaf curl Indonesia virus, Tomato yellow leaf curlKanchanaburi virus, Tomato yellow leaf curl Malaga virus, Tomatoyellow leaf curl Mali virus, Tomato yellow leaf curl Sardiniavirus, Tomato yellow leaf curl Shuangbai virus, Tomato yellow leafcurl Thailand virus, Tomato yellow leaf curl Vietnam virus, Tomatoyellow leaf curl virus, Tomato yellow leaf curl Yunnan virus,Tomato yellow leaf distortion virus, Tomato yellow margin leaf curlvirus, Tomato yellow mottle virus, Tomato yellow spot virus, Tomatoyellow vein streak virus, Triumfetta yellow mosaic virus, Velvetbean golden mosaic virus, Velvet bean severe mosaic virus, Vernoniacrinkle virus, Vernonia yellow vein Fujian virus, Vernonia yellowvein virus, Vigna yellow mosaic virus, Vinca leaf curl virus,Watermelon chlorotic stunt virus, West African Asystasia virus 1,West African Asystasia virus 2, West African Asystasia virus 3,Whitefly-associated begomovirus 1, Whitefly-associated begomovirus2, Whitefly-associated begomovirus 3, Whitefly-associatedbegomovirus 4, Whitefly-associated begomovirus 6,Whitefly-associated begomovirus 7, Wissadula golden mosaic virus,Wissadula yellow mosaic virus, Alfalfa leaf curl virus, Euphorbiacaput-medusae latent virus, French bean severe leaf curl virus,Plantago lanceolata latent virus, Beet curly top virus, Horseradishcurly top virus, Spinach severe curly top virus, Eragrostis curvulastreak virus, Grapevine red blotch virus, Prunus latent virus, WildVitis latent virus, Axonopus compressus streak virus, Bromuscatharticus striate mosaic virus, Chickpea chlorosis Australiavirus, Chickpea chlorosis virus, Chickpea chlorotic dwarf virus,Chickpea redleaf virus, Chickpea yellow dwarf virus, Chickpeayellows virus, Chloris striate mosaic virus, Digitaria ciliarisstriate mosaic virus, Digitaria didactyla striate mosaic virus,Digitaria streak virus, Dragonfly-associated mastrevirus,Eragrostis minor streak virus, Eragrostis streak virus, Maizestreak dwarfing virus, Maize streak Reunion virus, Maize streakvirus, Maize striate mosaic virus, Miscanthus streak virus, Oatdwarf virus, Panicum streak virus, Paspalum dilatatum striatemosaic virus, Paspalum striate mosaic virus, Rice latent virus 1,Rice latent virus 2, Saccharum streak virus, Sporobolus striatemosaic

virus 1, Sporobolus striate mosaic virus 2, Sugarcane chloroticstreak virus, Sugarcane streak Egypt virus, Sugarcane streakReunion virus, Sugarcane streak virus, Sugarcane striate virus,Sugarcane white streak virus, Sweet potato symptomless virus 1,Switchgrass mosaic-associated virus, Tobacco yellow dwarf virus,Urochloa streak virus, Wheat dwarf India virus, Wheat dwarf virus,Tomato pseudo-curly top virus, Sesame curly top virus, Turnip curlytop virus, Turnip leaf roll virus, Citrus chlorotic dwarfassociated virus, Mulberry mosaic dwarf associated virus, Blackbirdassociated gemycircularvirus 1, Bovine associated gemycircularvirus1, Bromus associated gemycircularvirus 1, Cassava associatedgemycircularvirus 1, Chickadee associated gemycircularvirus 1,Chicken associated gemycircularvirus 1, Chicken associatedgemycircularvirus 2, Dragonfly associated gemycircularvirus 1,Equine associated gemycircularvirus 1, Fur seal associatedgemycircularvirus 1, Gerygone associated gemycircularvirus 1,Gerygone associated gemycircularvirus 2, Gerygone associatedgemycircularvirus 3, Hypericum associated gemycircularvirus 1, Lamaassociated gemycircularvirus 1, Mallard associatedgemycircularvirus 1, Miniopterus associated gemycircularvirus 1,Mongoose associated gemycircularvirus 1, Mosquito associatedgemycircularvirus 1, Odonata associated gemycircularvirus 1,Odonata associated gemycircularvirus 2, Poaceae associatedgemycircularvirus 1, Porcine associated gemycircularvirus 1,Porcine associated gemycircularvirus 2, Pteropus associatedgemycircularvirus 1, Pteropus associated gemycircularvirus 2,Pteropus associated gemycircularvirus 3, Pteropus associatedgemycircularvirus 4, Pteropus associated gemycircularvirus 5,Pteropus associated gemycircularvirus 6, Pteropus associatedgemycircularvirus 7, Pteropus associated gemycircularvirus 8,Pteropus associated gemycircularvirus 9, Pteropus associatedgemycircularvirus 10, Rat associated gemycircularvirus 1,Sclerotinia gemycircularvirus 1, Sewage derived gemycircularvirus1, Sewage derived gemycircularvirus 2, Sewage derivedgemycircularvirus 3, Sewage derived gemycircularvirus 4, Sewagederived gemycircularvirus 5, Sheep associated gemycircularvirus 1,Soybean associated gemycircularvirus 1, Dragonfly associatedgemyduguivirus 1, Canine associated gemygorvirus 1, Mallardassociated gemygorvirus 1, Pteropus associated gemygorvirus 1,Sewage derived gemygorvirus 1, Starling associated gemygorvirus 1,Badger associated gemykibivirus 1, Black robin associatedgemykibivirus 1, Blackbird associated gemykibivirus 1, Bovineassociated gemykibivirus 1, Dragonfly associated gemykibivirus 1,Human associated gemykibivirus 1, Human associated gemykibivirus 2,Human associated gemykibivirus 3, Human associated gemykibivirus 4,Human associated gemykibivirus 5, Mongoose associated gemykibivirus1, Pteropus associated gemykibivirus 1, Rhinolophus associatedgemykibivirus 1, Rhinolophus associated gemykibivirus 2, Sewagederived gemykibivirus 1, Sewage derived gemykibivirus 2, Pteropusassociated gemykolovirus 1, Pteropus associated gemykolovirus 2,Bovine associated gemykrogvirus 1, Caribou associated gemykrogvirus1, Sewage derived gemykrogvirus 1, Rabbit associatedgemykroznavirus 1, Ostrich associated gemytondvirus 1, Humanassociated gemyvongvirus 1, Alphapleolipovirus HHPV1,Alphapleolipovirus HHPV2, Alphapleolipovirus HRPV1,Alphapleolipovirus HRPV2, Alphapleolipovirus HRPV6,Betapleolipovirus HGPV1, Betapleolipovirus HHPV3, BetapleolipovirusHHPV4, Betapleolipovirus HRPV3, Betapleolipovirus HRPV9,Betapleolipovirus HRPV10, Betapleolipovirus HRPV11,Betapleolipovirus HRPV12, Betapleolipovirus SNJ2,Gammapleolipovirus His2, Amasya cherry disease associatedchrysovirus, Anthurium mosaic-associated chrysovirus, Aspergillusfumigatus chrysovirus, Brassica campestris chrysovirus,Colletotrichum gloeosporioides chrysovirus, Cryphonectria nitschkeichrysovirus 1, Fusarium oxysporum chrysovirus 1, Helminthosporiumvictoriae virus 145S, Isaria javanica chrysovirus, Macrophominaphaseolina chrysovirus, Penicillium brevicompactum virus,Penicillium chrysogenum virus, Penicillium cyaneofulvum virus,Persea americana chrysovirus, Raphanus sativus chrysovirus,Shuangao insect-associated chrysovirus, Verticillium dahliaechrysovirus 1, Alternaria alternata chrysovirus, Botryosphaeriadothidea chrysovirus, Colletotrichum fructicola chrysovirus 1,Fusarium graminearum chrysovirus, Fusarium oxysporum chrysovirus 2,Magnaporthe oryzae chrysovirus, Penicillium janczewskii chrysovirus1, Penicillium janczewskii chrysovirus 2, Rosellinia necatrixmegabirnavirus 1, Rosellinia necatrix quadrivirus 1, Giardialamblia virus, Leishmania RNA virus 1, Leishmania RNA virus 2,Saccharomyces cerevisiae virus L-A, Saccharomyces cerevisiae virusLBCLa, Scheffersomyces segobiensis virus L, Tuber aestivum virus 1,Ustilago maydis virus H1, Xanthophyllomyces dendrorhous virus L1A,Xanthophyllomyces dendrorhous virus L1B, Trichomonas vaginalisvirus 1, Trichomonas vaginalis virus 2, Trichomonas vaginalis virus3, Trichomonas vaginalis virus 4, Aspergillus foetidus slow virus1, Beauveria bassiana victorivirus 1, Chalara elegans RNA Virus 1,Coniothyrium minitans RNA virus, Epichloe festucae virus 1,Gremmeniella abietina RNA virus L1, Helicobasidium mompa totivirus1-17, Helminthosporium victoriae virus 190S, Magnaporthe oryzaevirus 1, Magnaporthe oryzae virus 2, Rosellinia necatrixvictorivirus 1, Sphaeropsis sapinea RNA virus 1, Sphaeropsissapinea RNA virus 2, Tolypocladium cylindrosporum virus 1,Eriocheir sinensis reovirus, Micromonas pusilla reovirus, Africanhorse sickness virus, Bluetongue virus, Changuinola virus, Chenudavirus, Chobar Gorge virus, Corriparta virus, Epizootic hemorrhagicdisease virus, Equine encephalosis virus, Eubenangee virus, GreatIsland virus, Teri virus, Lebombo virus, Orungo virus, Palyamvirus, Peruvian horse sickness virus, St Croix River virus,Umatilla virus, Wad Medani virus, Wallal virus, Warrego virus,Wongorr virus, Yunnan orbivirus, Rice dwarf virus, Rice gall dwarfvirus, Wound tumor virus, Rotavirus A, Rotavirus B, Rotavirus C,Rotavirus D, Rotavirus F, Rotavirus G, Rotavirus H, Rotavirus I,Rotavirus J, Banna virus, Kadipiro virus, Liao ning virus,Aquareovirus A, Aquareovirus B, Aquareovirus C, Aquareovirus D,Aquareovirus E, Aquareovirus F, Aquareovirus G, Colorado tick fevercoltivirus, Eyach coltivirus, Kundal coltivirus, Tai Forestcoltivirus, Tarumizu coltivirus, Cypovirus 1, Cypovirus 2,Cypovirus 3, Cypovirus 4, Cypovirus 5, Cypovirus 6, Cypovirus 7,Cypovirus 8, Cypovirus 9, Cypovirus 10, Cypovirus 11, Cypovirus 12,Cypovirus 13, Cypovirus 14, Cypovirus 15, Cypovirus 16, Aedespseudoscutellaris reovirus, Fiji disease virus, Garlic dwarf virus,Maize rough dwarf virus, Mal de Rio Cuarto virus, Nilaparvatalugens reovirus, Oat sterile dwarf virus, Pangola stunt virus, Riceblack streaked dwarf virus, Southern rice black-streaked dwarfvirus, Idnoreovirus 1, Idnoreovirus 2, Idnoreovirus 3, Idnoreovirus4, Idnoreovirus 5, Mycoreovirus 1, Mycoreovirus 2, Mycoreovirus 3,Avian orthoreovirus, Baboon orthoreovirus, Broome orthoreovirus,Mahlapitsi orthoreovirus, Mammalian orthoreovirus, Nelson Bayorthoreovirus, Neoavian orthoreovirus, Piscine orthoreovirus,Reptilian orthoreovirus, Testudine orthoreovirus, Echinochloaragged stunt virus, Rice ragged stunt virus, Pseudomonas virusphi6, Pseudomonas virus phi8, Pseudomonas virus phi12, Pseudomonasvirus phi13, Pseudomonas virus phi2954, Pseudomonas virus phiNN,Pseudomonas virus phiYY, Antheraea eucalypti virus, Darna trimavirus, Dasychira pudibunda virus, Nudaurelia capensis beta virus,Philosamia cynthia x ricini virus, Pseudoplusia includens virus,Trichoplusia ni virus, Dendrolimus punctatus virus, Helicoverpaarmigera stunt virus, Nudaurelia capensis omega virus, Beetnecrotic yellow vein virus, Beet soil-borne mosaic virus, Burdockmottle virus, Rice stripe necrosis virus, Orthohepevirus A,Orthohepevirus B, Orthohepevirus C, Orthohepevirus D,Piscihepevirus A, Rubella virus, Alfalfa mosaic virus, Amazon lilymild mottle virus, Pelargonium zonate spot virus, Broad bean mottlevirus, Brome mosaic virus, Cassia yellow blotch virus, Cowpeachlorotic mottle virus, Melandrium yellow fleck virus, Springbeauty latent virus, Cucumber mosaic virus, Gayfeather mild mottlevirus, Peanut stunt virus, Tomato aspermy virus, Ageratum latentvirus, American plum line pattern virus, Apple mosaic virus,Asparagus virus 2, Blackberry chlorotic ringspot virus, Blueberryshock virus, Citrus leaf rugose virus, Citrus variegation virus,Elm mottle virus, Fragaria chiloensis latent virus, Humulusjaponicus latent virus, Lilac leaf chlorosis virus, Lilac ringmottle virus, Parietaria mottle virus, Privet ringspot virus, Prunedwarf virus, Prunus necrotic ringspot virus, Spinach latent virus,Strawberry necrotic shock virus, Tobacco streak virus, Tomatonecrotic streak virus, Tulare apple mosaic virus, Olive latentvirus 2, Air potato ampelovirus 1, Blackberry veinbanding-associated virus, Grapevine leafroll-associated virus 1,Grapevine leafroll-associated virus 3, Grapevineleafroll-associated virus 4, Grapevine leafroll-associated virus13, Little cherry virus 2, Pineapple mealybug wilt-associated virus1, Pineapple mealybug wilt-associated virus 2, Pineapple mealybugwilt-associated virus 3, Pistachio ampelovirus A, Plum barknecrosis stem pitting-associated virus, Arracacha virus 1, Beetyellow stunt virus, Beet yellows virus, Blackcurrant closterovirus1, Burdock yellows virus, Carnation necrotic fleck virus, Carrotyellow leaf virus, Citrus tristeza virus, Grapevineleafroll-associated virus 2, Mint virus 1, Raspberry leaf mottlevirus, Rehmannia virus 1, Rose leaf rosette-associated virus,Strawberry chlorotic fleck-associated virus, Tobacco virus 1, Wheatyellow leaf virus, Abutilon yellows virus, Bean yellow disordervirus, Beet pseudoyellows virus, Blackberry yellow vein-associatedvirus, Cucurbit yellow stunting disorder virus, Diodia veinchlorosis virus, Lettuce chlorosis virus, Lettuce infectiousyellows virus, Potato yellow vein virus, Strawberrypallidosis-associated virus, Sweet potato chlorotic stunt virus,Tetterwort vein chlorosis virus, Tomato chlorosis virus, Tomatoinfectious chlorosis virus, Areca palm velarivirus 1, Cordylinevirus 1, Cordyline virus 2, Cordyline virus 3, Cordyline virus 4,Grapevine leafroll-associated virus 7, Little cherry virus 1,Actinidia virus 1, Alligatorweed stunting virus, Blueberry virus A,Megakepasma mosaic virus, Mint vein banding-associated virus, Oliveleaf yellowing-associated virus, Persimmon virus B, Agaricusbisporus alphaendornavirus 1, Basella alba alphaendornavirus 1,Bell pepper alphaendornavirus, Cluster bean alphaendornavirus 1,Cucumis melo alphaendornavirus, Erysiphe cichoracearumalphaendornavirus, Grapevine endophyte alphaendornavirus,Helianthus annuus alphaendornavirus, Helicobasidium mompaalphaendornavirus 1, Hordeum vulgare alphaendornavirus, Hot pepperalphaendornavirus, Lagenaria siceraria alphaendornavirus, Oryzarufipogon alphaendornavirus, Oryza sativa alphaendornavirus, Perseaamericana alphaendornavirus 1, Phaseolus vulgaris alphaendornavirus1, Phaseolus vulgaris alphaendornavirus 2, Phaseolus vulgarisalphaendornavirus 3, Phytophthora alphaendornavirus 1, Rhizoctoniacerealis alphaendornavirus 1, Rhizoctonia solani alphaendornavirus2, Vicia faba alphaendornavirus, Winged bean alphaendornavirus 1,Yerba mate alphaendornavirus, Alternaria brassicicolabetaendornavirus 1, Botrytis cinerea betaendornavirus 1,Gremmeniella abietina betaendornavirus 1, Rosellinia necatrixbetaendornavirus 1, Sclerotinia minor betaendornavirus 1,Sclerotinia sclerotiorum betaendornavirus 1, Tuber aestivumbetaendornavirus, Blueberry necrotic ring blotch virus, Tea plantnecrotic ring blotch virus, Citrus leprosis virus C, Citrusleprosis virus C2, Hibiscus green spot virus 2, Privet idaeovirus,Raspberry bushy dwarf virus, Japanese holly fern mottlepteridovirus, Maize associated pteridovirus, Aura virus, BarmahForest virus, Bebaru virus, Cabassou virus, Chikungunya virus,Eastern equine encephalitis virus, Eilat virus, Everglades virus,Fort Morgan virus, Getah virus, Highlands J virus, Madariaga virus,Mayaro virus, Middelburg virus, Mosso das Pedras virus, Mucambovirus, Ndumu virus, Onyong-nyong virus, Pixuna virus, Rio Negrovirus, Ross River virus, Salmon pancreas disease virus, SemlikiForest virus, Sindbis virus, Southern elephant seal virus, Tonatevirus, Trocara virus, Una virus, Venezuelan equine encephalitisvirus, Western equine encephalitis virus, Whataroa virus, Chinesewheat mosaic virus, Japanese soil-borne wheat mosaic virus, Oatgolden stripe virus, Soil-borne cereal mosaic virus, Soil-bornewheat mosaic virus, Sorghum chlorotic spot virus, Drakaea virus A,Gentian ovary ringspot virus, Anthoxanthum latent blanching virus,Barley stripe mosaic virus, Lychnis ringspot virus, Poa semilatentvirus, Indian peanut clump virus, Peanut clump virus, Beetsoil-borne virus, Beet virus Q, Broad bean necrosis virus,Colombian potato soil-borne virus, Potato mop-top virus, Bellpepper mottle virus, Brugmansia mild mottle virus, Cactus mildmottle virus, Clitoria yellow mottle virus, Cucumber fruit mottlemosaic virus, Cucumber green mottle mosaic virus, Cucumber mottlevirus, Frangipani mosaic virus, Hibiscus latent Fort Pierce virus,Hibiscus latent Singapore virus, Kyuri green mottle mosaic virus,Maracuj a mosaic virus, Obuda pepper virus, Odontoglossum ringspotvirus, Opuntia chlorotic ringspot virus, Paprika mild mottle virus,Passion fruit mosaic virus, Pepper mild mottle virus, Plumeriamosaic virus, Rattail cactus necrosis-associated virus, Rehmanniamosaic virus, Ribgrass mosaic virus, Streptocarpus flower breakvirus, Sunn-hemp mosaic virus, Tobacco latent virus, Tobacco mildgreen mosaic virus, Tobacco mosaic virus, Tomato brown rugose fruitvirus, Tomato mosaic virus, Tomato mottle mosaic virus, Tropicalsoda apple mosaic virus, Turnip vein-clearing virus, Ullucus mildmottle virus, Wasabi mottle virus, Yellow tailflower mild mottlevirus, Youcai mosaic virus, Zucchini green mottle mosaic virus, Peaearly-browning virus, Pepper ringspot virus, Tobacco rattle virus,Alfalfa virus S, Arachis pintoi virus, Blackberry virus E, Garlicmite-borne filamentous virus, Garlic virus A, Garlic virus B,Garlic virus C, Garlic virus D, Garlic virus E, Garlic virus X,Shallot virus X, Vanilla latent virus, Botrytis virus X, Loliumlatent virus, Citrus yellow vein clearing virus, Indian citrusringspot virus, Donkey orchid symptomless virus, Actinidia virus X,Allium virus X, Alstroemeria virus X, Alternanthera mosaic virus,Asparagus virus 3, Bamboo mosaic virus, Cactus virus X, Cassavacommon mosaic virus, Cassava virus X, Clover yellow mosaic virus,Cymbidium mosaic

virus, Foxtail mosaic virus, Hosta virus X, Hydrangea ringspotvirus, Lagenaria mild mosaic virus, Lettuce virus X, Lily virus X,Malva mosaic virus, Mint virus X, Narcissus mosaic virus, Nerinevirus X, Opuntia virus X, Papaya mosaic virus, Pepino mosaic virus,Phaius virus X, Pitaya virus X, Plantago asiatica mosaic virus,Plantain virus X, Potato aucuba mosaic virus, Potato virus X,Schlumbergera virus X, Strawberry mild yellow edge virus, Tamus redmosaic virus, Tulip virus X, Vanilla virus X, White clover mosaicvirus, Yam virus X, Zygocactus virus X, Sclerotinia sclerotiorumdebilitation-associated RNA virus, Aconitum latent virus, Americanhop latent virus, Atractylodes mottle virus, Blueberry scorchvirus, Butterbur mosaic virus, Cactus virus 2, Caper latent virus,Carnation latent virus, Chrysanthemum virus B, Cole latent virus,Coleus vein necrosis virus, Cowpea mild mottle virus, Cucumbervein-clearing virus, Daphne virus S, Gaillardia latent virus,Garlic common latent virus, Helenium virus S, Helleborus mosaicvirus, Helleborus net necrosis virus, Hippeastrum latent virus, Hoplatent virus, Hop mosaic virus, Hydrangea chlorotic mottle virus,Kalanchoe latent virus, Ligustrum necrotic ringspot virus,Ligustrum virus A, Lily symptomless virus, Melonyellowing-associated virus, Mirabilis jalapa mottle virus,Narcissus common latent virus, Nerine latent virus, Passifloralatent virus, Pea streak virus, Phlox virus B, Phlox virus M, Phloxvirus S, Poplar mosaic virus, Potato latent virus, Potato virus H,Potato virus M, Potato virus P, Potato virus S, Red clover veinmosaic virus, Sambucus virus C, Sambucus virus D, Sambucus virus E,Shallot latent virus, Sint-Jan onion latent virus, Strawberrypseudo mild yellow edge virus, Sweet potato C6 virus, Sweet potatochlorotic fleck virus, Verbena latent virus, Yam latent virus,Apple stem pitting virus, Apricot latent virus, Asian prunus virus1, Asian prunus virus 2, Grapevine rupestris stempitting-associated virus, Grapevine virus T, Peach chlorotic mottlevirus, Rubus canadensis virus 1, African oil palm ringspot virus,Cherry green ring mottle virus, Cherry necrotic rusty mottle virus,Cherry rusty mottle associated virus, Cherry twisted leafassociated virus, Banana mild mosaic virus, Banana virus X,Sugarcane striate mosaic-associated virus, Apple stem groovingvirus, Cherry virus A, Currant virus A, Mume virus A, Carrot Chvirus 1, Carrot Ch virus 2, Citrus leaf blotch virus, Diuris virusA, Diuris virus B, Hardenbergia virus A, Actinidia seed bornelatent virus, Apricot vein clearing associated virus, Caucasusprunus virus, Ribes americanum virus A, Potato virus T, Prunusvirus T, Apple chlorotic leaf spot virus, Apricot pseudo-chloroticleaf spot virus, Cherry mottle leaf virus, Grapevine berry innernecrosis virus, Grapevine Pinot gris virus, Peach mosaic virus,Phlomis mottle virus, Actinidia virus A, Actinidia virus B,Arracacha virus V, Blackberry virus A, Grapevine virus A, Grapevinevirus B, Grapevine virus D, Grapevine virus E, Grapevine virus F,Grapevine virus G, Grapevine virus H, Grapevine virus I, Grapevinevirus J, Heracleum latent virus, Mint virus 2, Watermelon virus A,Fusarium deltaflexivirus 1, Sclerotinia deltaflexivirus 1,Soybean-associated deltaflexivirus 1, Botrytis virus F, Grapevinefleck virus, Bermuda grass etched-line virus, Blackberry virus S,Citrus sudden death-associated virus, Grapevine asteroid mosaicassociated virus, Grapevine Syrah virus 1, Maize rayado fino virus,Nectarine marafivirus M, Oat blue dwarf virus, Olive latent virus3, Peach marafivirus D, Anagyris vein yellowing virus, Andeanpotato latent virus, Andean potato mild mosaic virus, Belladonnamottle virus, Cacao yellow mosaic virus, Calopogonium yellow veinvirus, Chayote mosaic virus, Chiltepin yellow mosaic virus,Clitoria yellow vein virus, Desmodium yellow mottle virus,Dulcamara mottle virus, Eggplant mosaic virus, Erysimum latentvirus, Kennedya yellow mosaic virus, Melon rugose mosaic virus,Nemesia ring necrosis virus, Okra mosaic virus, Ononis yellowmosaic virus, Passion fruit yellow mosaic virus, Peanut yellowmosaic virus, Petunia vein banding virus, Physalis mottle virus,Plantago mottle virus, Scrophularia mottle virus, Tomato blisteringmosaic tymovirus, Turnip yellow mosaic virus, Voandzeia necroticmosaic virus, Wild cucumber mosaic virus, Bombyx mori latent virus,Poinsettia mosaic virus, Apoi virus, Aroa virus, Bagaza virus,Banzi virus, Bouboui virus, Bukalasa bat virus, Cacipacore virus,Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Denguevirus, Edge Hill virus, Entebbe bat virus, Gadgets Gully virus,Ilheus virus, Israel turkey meningoencephalomyelitis virus,Japanese encephalitis virus, Jugra virus, Jutiapa virus, Kadamvirus, Kedougou virus, Kokobera virus, Koutango virus, KyasanurForest disease virus, Langat virus, Louping ill virus, Meabanvirus, Modoc virus, Montana myotis leukoencephalitis virus, MurrayValley encephalitis virus, Ntaya virus, Omsk hemorrhagic fevervirus, Phnom Penh bat virus, Powassan virus, Rio Bravo virus, RoyalFarm virus, Saboya virus, Saint Louis encephalitis virus, Sal Viejavirus, San Perlita virus, Saumarez Reef virus, Sepik virus, Tembusuvirus, Tick-borne encephalitis virus, Tyuleniy virus, Uganda Svirus, Usutu virus, Wesselsbron virus, West Nile virus, Yaoundevirus, Yellow fever virus, Yokose virus, Zika virus, Hepacivirus A,Hepacivirus B, Hepacivirus C, Hepacivirus D, Hepacivirus E,Hepacivirus F, Hepacivirus G, Hepacivirus H, Hepacivirus I,Hepacivirus J, Hepacivirus K, Hepacivirus L, Hepacivirus M,Hepacivirus N, Pegivirus A, Pegivirus B, Pegivirus C, Pegivirus D,Pegivirus E, Pegivirus F, Pegivirus G, Pegivirus H, Pegivirus I,Pegivirus J, Pegivirus K, Pestivirus A, Pestivirus B, Pestivirus C,Pestivirus D, Pestivirus E, Pestivirus F, Pestivirus G, PestivirusH, Pestivirus I, Pestivirus J, Pestivirus K, Black beetle virus,Boolarra virus, Flock House virus, Nodamura virus, Pariacoto virus,Barfin flounder nervous necrosis virus, Redspotted grouper nervousnecrosis virus, Striped jack nervous necrosis virus, Tiger puffernervous necrosis virus, Lake Sinai virus 1, Lake Sinai virus 2,Providence virus, Alfalfa enamovirus 1, Birdsfoot trefoilenamovirus 1, Citrus vein enation virus, Grapevine enamovirus 1,Pea enation mosaic virus 1, Apple associated luteovirus, Appleluteovirus 1, Barley yellow dwarf virus kern, Barley yellow dwarfvirus kerIII, Barley yellow dwarf virus MAV, Barley yellow dwarfvirus PAS, Barley yellow dwarf virus PAV, Bean leafroll virus,Cherry associated luteovirus, Nectarine stem pitting associatedvirus, Red clover associated luteovirus, Rose springdwarf-associated virus, Soybean dwarf virus, Beet chlorosis virus,Beet mild yellowing virus, Beet western yellows virus, Carrot redleaf virus, Cereal yellow dwarf virus RPS, Cereal yellow dwarfvirus RPV, Chickpea chlorotic stunt virus, Cotton leafroll dwarfvirus, Cucurbit aphid-borne yellows virus, Faba bean polerovirus 1,Maize yellow dwarf virus RMV, Maize yellow mosaic virus, Melonaphid-borne yellows virus, Pepo aphid-borne yellows virus, Peppervein yellows virus 1, Pepper vein yellows virus 2, Pepper veinyellows virus 3, Pepper vein yellows virus 4, Pepper vein yellowsvirus 5, Pepper vein yellows virus 6, Potato leafroll virus,Pumpkin polerovirus, Suakwa aphid-borne yellows virus, Sugarcaneyellow leaf virus, Tobacco vein distorting virus, Turnip yellowsvirus, Barley yellow dwarf virus GPV, Barley yellow dwarf virusSGV, Chickpea stunt disease associated virus, Groundnut rosetteassistor virus, Indonesian soybean dwarf virus, Sweet potato leafspeckling virus, Tobacco necrotic dwarf virus, Carrot mottle mimicvirus, Carrot mottle virus, Ethiopian tobacco bushy top virus,Groundnut rosette virus, Lettuce speckles mottle virus, Opium poppymosaic virus, Pea enation mosaic virus 2, Tobacco bushy top virus,Tobacco mottle virus, Angelonia flower break virus, Calibrachoamottle virus, Carnation mottle virus, Honeysuckle ringspot virus,Nootka lupine vein clearing virus, Pelargonium flower break virus,Saguaro cactus virus, Olive latent virus 1, Olive mild mosaicvirus, Potato necrosis virus, Tobacco necrosis virus A, Cucumberleaf spot virus, Johnsongrass chlorotic stripe mosaic virus, Maizewhite line mosaic virus, Pothos latent virus, Yam spherical virus,Oat chlorotic stunt virus, Cardamine chlorotic fleck virus,Hibiscus chlorotic ringspot virus, Japanese iris necrotic ringvirus, Turnip crinkle virus, Beet black scorch virus, Leek whitestripe virus, Tobacco necrosis virus D, Galinsoga mosaic virus,Cowpea mottle virus, Melon necrotic spot virus, Pea stem necrosisvirus, Soybean yellow mottle mosaic virus, Furcraea necrotic streakvirus, Maize chlorotic mottle virus, Cocksfoot mild mosaic virus,Panicum mosaic virus, Thin paspalum asymptomatic virus, Clematischlorotic mottle virus, Elderberry latent virus, Pelargoniumchlorotic ring pattern virus, Pelargonium line pattern virus,Pelargonium ringspot virus, Rosa rugosa leaf distortion virus,Artichoke mottled crinkle virus, Carnation Italian ringspot virus,Cucumber Bulgarian latent virus, Cucumber necrosis virus, Cymbidiumringspot virus, Eggplant mottled crinkle virus, Grapevine Algerianlatent virus, Havel River virus, Lato River virus, Limonium flowerdistortion virus, Moroccan pepper virus, Neckar River virus,Pelargonium leaf curl virus, Pelargonium necrotic spot virus,Petunia asteroid mosaic virus, Sitke waterborne virus, Tomato bushystunt virus, Maize necrotic streak virus, Ahlum waterborne virus,Bean mild mosaic virus, Chenopodium necrosis virus, Cucumbersoil-borne virus, Trailing lespedeza virus 1, Weddel waterbornevirus, Carnation ringspot virus, Red clover necrotic mosaic virus,Sweet clover necrotic mosaic virus, Escherichia virus FI,Escherichia virus Qbeta, Escherichia virus BZ13, Escherichia virusMS2, Saccharomyces 20S RNA narnavirus, Saccharomyces 23S RNAnarnavirus, Cryphonectria mitovirus 1, Ophiostoma mitovirus 4,Ophiostoma mitovirus 5, Ophiostoma mitovirus 6, Ophiostomamitovirus 3a, Botrytis botoulivirus, Sclerotinia botoulivirus 2,Magnaporthe magoulivirus 1, Rhizoctonia magoulivirus 1, Cassavavirus C, Epirus cherry virus, Ourmia melon virus, Sclerotiniascleroulivirus 1, Soybean scleroulivirus 1, Soybean scleroulivirus2, Beihai yingvirus, Charybdis yingvirus, Hubei yingvirus, Sanxiayingvirus, Shahe yingvirus, Wenzhou yingvirus, Wuhan yingvirus,Xinzhou yingvirus, Blueberry mosaic associated ophiovirus, Citruspsorosis ophiovirus, Freesia sneak ophiovirus, Lettuce ringnecrosis ophiovirus, Mirafiori lettuce big-vein ophiovirus,Ranunculus white mottle ophiovirus, Tulip mild mottle mosaicophiovirus, Argas mivirus, Barnacle mivirus, Beetle mivirus, Bolemivirus, Brunnich mivirus, Changping mivirus, Charybdis mivirus,Cockroach mivirus, Crab mivirus, Crustacean mivirus, Dermacentormivirus, Hermit mivirus, Hippoboscid mivirus, Hubei mivirus, Hubeiodonate mivirus, Imjin mivirus, Lacewing mivirus, Lishi mivirus,Lonestar mivirus, Louse fly mivirus, Mosquito mivirus, Myriapodmivirus, Odonate mivirus, Sanxia mivirus, Shayang mivirus, Suffolkmivirus, Taiyuan mivirus, Wenling mivirus, Wuhan mivirus, Xinzhoumivirus, Barnacle hexartovirus, Caligid hexartovirus, Beihaiperopuvirus, Hubei peropuvirus, Odonate peropuvirus, Pillwormperopuvirus, Pteromalus puparum peropuvirus, Woodlouse peropuvirus,Queensland carbovirus, Southwest carbovirus, Sharpbellycultervirus, Elapid 1 orthobornavirus, Mammalian 1 orthobornavirus,Mammalian 2 orthobornavirus, Passeriform 1 orthobornavirus,Passeriform 2 orthobornavirus, Psittaciform 1 orthobornavirus,Psittaciform 2 orthobornavirus, Waterbird 1 orthobornavirus, Lloviucuevavirus, Mengla dianlovirus, Bombali ebolavirus, Bundibugyoebolavirus, Reston ebolavirus, Sudan ebolavirus, Tai Forestebolavirus, Zaire ebolavirus, Marburg marburgvirus, Xilangstriavirus, Huangjiao thamnovirus, Gerrid arlivirus, Hubeiarlivirus, Lishi arlivirus, Odonate arlivirus, Tacheng arlivirus,Wuchang arlivirus, Hubei hubramonavirus, Lentinula hubramonavirus,Dadou sclerotimonavirus, Drop sclerotimonavirus, Glycinesclerotimonavirus, Hubei sclerotimonavirus, Illinoissclerotimonavirus, Phyllosphere sclerotimonavirus, Sclerotiniasclerotimonavirus, Beihai berhavirus, Echinoderm berhavirus,Sipunculid berhavirus, Beihai crustavirus, Wenling crustavirus,Wenzhou crustavirus, Midway nyavirus, Nyamanini nyavirus, SierraNevada nyavirus, Orinoco orinovirus, Soybean cyst nematodesocyvirus, Tapeworm tapwovirus, Avian metaavulavirus 2, Avianmetaavulavirus 5, Avian metaavulavirus 6, Avian metaavulavirus 7,Avian metaavulavirus 8, Avian metaavulavirus 10, Avianmetaavulavirus 11, Avian metaavulavirus 14, Avian metaavulavirus15, Avian metaavulavirus 20, Avian orthoavulavirus 1, Avianorthoavulavirus 9, Avian orthoavulavirus 12, Avian orthoavulavirus13, Avian orthoavulavirus 16, Avian orthoavulavirus 17, Avianorthoavulavirus 18, Avian orthoavulavirus 19, Avian orthoavulavirus21, Avian orthovulavirus 21, Avian paraavulavirus 3, Avianparaavulavirus 4, Synodus synodonvirus, Oncorhynchusaquaparamyxovirus, Salmo aquaparamyxovirus, Reptilian ferlavirus,Cedar henipavirus, Ghanaian bat henipavirus, Hendra henipavirus,Mojiang henipavirus, Nipah henipavirus, Beilong jeilongvirus, Junjeilongvirus, Lophuromys jeilongvirus 1, Lophuromys jeilongvirus 2,Miniopteran jeilongvirus, Myodes jeilongvirus, Tailam jeilongvirus,Canine morbillivirus, Cetacean morbillivirus, Feline morbillivirus,Measles morbillivirus, Phocine morbillivirus, Rinderpestmorbillivirus, Small ruminant morbillivirus, Mossman narmovirus,Myodes narmovirus, Nariva narmovirus, Tupaia narmovirus, Bovinerespirovirus 3, Caprine respirovirus 3, Human respirovirus 1, Humanrespirovirus 3, Murine respirovirus, Porcine respirovirus 1,Squirrel respirovirus, Salem salemvirus, Human orthorubulavirus 2,Human orthorubulavirus 4, Mammalian orthorubulavirus 5, Mammalianorthorubulavirus 6, Mapuera orthorubulavirus, Mumpsorthorubulavirus, Porcine orthorubulavirus, Simianorthorubulavirus, Achimota pararubulavirus 1, Achimotapararubulavirus 2, Hervey pararubulavirus, Menanglepararubulavirus, Sosuga pararubulavirus, Teviot pararubulavirus,Tioman pararubulavirus, Tuhoko pararubulavirus 1, Tuhokopararubulavirus 2, Tuhoko pararubulavirus 3, Cynoglossuscynoglossusvirus, Hoplichthys hoplichthysvirus, Scoliodonscoliodonvirus, Avian metapneumovirus, Human metapneumovirus,Bovine orthopneumovirus, Human orthopneumovirus, Murineorthopneumovirus, Arboretum almendravirus, Balsa almendravirus,Coot Bay almendravirus, Menghai almendravirus, Puerto Almendrasalmendravirus, Rio Chico almendravirus, Xingshan alphanemrhavirus,Xinzhou alphanemrhavirus, Eggplant mottled dwarfalphanucleorhabdovirus, Maize Iranian mosaicalphanucleorhabdovirus, Maize mosaic alphanucleorhabdovirus,

Morogoro maize-associated alphanucleorhabdovirus, Physostegiachlorotic mottle alphanucleorhabdovirus, Potato yellow dwarfalphanucleorhabdovirus, Rice yellow stunt alphanucleorhabdovirus,Taro vein chlorosis alphanucleorhabdovirus, Wheat yellow striatealphanucleorhabdovirus, Aruac arurhavirus, Inhangapi arurhavirus,Santabarbara arurhavirus, Xiburema arurhavirus, Bahia barhavirus,Muir barhavirus, Alfalfa betanucleorhabdovirus, Blackcurrantbetanucleorhabdovirus, Datura yellow vein betanucleorhabdovirus,Sonchus yellow net betanucleorhabdovirus, Sowthistle yellow veinbetanucleorhabdovirus, Trefoil betanucleorhabdovirus, Caliguscaligrhavirus, Lepeophtheirus caligrhavirus, Salmonlousecaligrhavirus, Curionopolis curiovirus, Iriri curiovirus,Itacaiunas curiovirus, Rochambeau curiovirus, Alfalfa dwarfcytorhabdovirus, Barley yellow striate mosaic cytorhabdovirus,Broccoli necrotic yellows cytorhabdovirus, Cabbage cytorhabdovirus,Colocasia bobone disease-associated cytorhabdovirus, Festuca leafstreak cytorhabdovirus, Lettuce necrotic yellows cytorhabdovirus,Lettuce yellow mottle cytorhabdovirus, Maize yellow striatecytorhabdovirus, Maize-associated cytorhabdovirus, Northern cerealmosaic cytorhabdovirus, Papaya cytorhabdovirus, Persimmoncytorhabdovirus, Raspberry vein chlorosis cytorhabdovirus, Ricestripe mosaic cytorhabdovirus, Sonchus cytorhabdovirus 1,Strawberry crinkle cytorhabdovirus, Tomato yellow mottle-associatedcytorhabdovirus, Wheat American striate mosaic cytorhabdovirus,Wuhan 4 insect cytorhabdovirus, Wuhan 5 insect cytorhabdovirus,Wuhan 6 insect cytorhabdovirus, Yerba mate chlorosis-associatedcytorhabdovirus, Citrus chlorotic spot dichorhavirus, Citrusleprosis N dichorhavirus, Clerodendrum chlorotic spotdichorhavirus, Coffee ringspot dichorhavirus, Orchid fleckdichorhavirus, Adelaide River ephemerovirus, Berrimahephemerovirus, Bovine fever ephemerovirus, Kimberley ephemerovirus,Koolpinyah ephemerovirus, Kotonkan ephemerovirus, Obodhiangephemerovirus, Yata ephemerovirus, Maize fine streakgammanucleorhabdovirus, Flanders hapavirus, Gray Lodge hapavirus,Hart Park hapavirus, Holmes hapavirus, Joinjakaka hapavirus, Kamesehapavirus, La Joya hapavirus, Landjia hapavirus, Manitobahapavirus, Marco hapavirus, Mosqueiro hapavirus, Mossurilhapavirus, Ngaingan hapavirus, Ord River hapavirus, Parry Creekhapavirus, Wongabel hapavirus, Barur ledantevirus, Fikiriniledantevirus, Fukuoka ledantevirus, Kanyawara ledantevirus, KernCanyon ledantevirus, Keuraliba ledantevirus, Kolente ledantevirus,Kumasi ledantevirus, Le Dantec ledantevirus, Mount Elgon batledantevirus, Nishimuro ledantevirus, Nkolbisson ledantevirus, Oitaledantevirus, Vaprio ledantevirus, Wuhan ledantevirus, Yongjialedantevirus, Lonestar zarhavirus, Aravan lyssavirus, Australianbat lyssavirus, Bokeloh bat lyssavirus, Duvenhage lyssavirus,European bat 1 lyssavirus, European bat 2 lyssavirus, Gannoruwa batlyssavirus, Ikoma lyssavirus, Irkut lyssavirus, Khuj andlyssavirus, Lagos bat lyssavirus, Lleida bat lyssavirus, Mokolalyssavirus, Rabies lyssavirus, Shimoni bat lyssavirus, Taiwan batlyssavirus, West Caucasian bat lyssavirus, Moussa mousrhavirus,Hirame novirhabdovirus, Piscine novirhabdovirus, Salmonidnovirhabdovirus, Snakehead novirhabdovirus, Culex ohlsrhavirus,Northcreek ohlsrhavirus, Ohlsdorf ohlsrhavirus, Riversideohlsrhavirus, Tongilchon ohlsrhavirus, Anguillid perhabdovirus,Perch perhabdovirus, Sea trout perhabdovirus, Connecticutsawgrhavirus, Island sawgrhavirus, Minto sawgrhavirus, Sawgrasssawgrhavirus, Drosophila affinis sigmavirus, Drosophila ananassaesigmavirus, Drosophila immigrans sigmavirus, Drosophilamelanogaster sigmavirus, Drosophila obscura sigmavirus, Drosophilatristis sigmavirus, Muscina stabulans sigmavirus, Carp sprivivirus,Pike fry sprivivirus, Almpiwar sripuvirus, Chaco sripuvirus,Charleville sripuvirus, Cuiaba sripuvirus, Hainan sripuvirus,Niakha sripuvirus, Sena Madureira sripuvirus, Sripur sripuvirus,Garba sunrhavirus, Harrison sunrhavirus, Kwatta sunrhavirus,Oakvale sunrhavirus, Sunguru sunrhavirus, Walkabout sunrhavirus,Bas-Congo tibrovirus, Beatrice Hill tibrovirus, Coastal Plainstibrovirus, Ekpoma 1 tibrovirus, Ekpoma 2 tibrovirus, SweetwaterBranch tibrovirus, Tibrogargan tibrovirus, Durham tupavirus,Klamath tupavirus, Tupaia tupavirus, Lettuce big-vein associatedvaricosavirus, Alagoas vesiculovirus, American bat vesiculovirus,Carajas vesiculovirus, Chandipura vesiculovirus, Cocalvesiculovirus, Indiana vesiculovirus, Isfahan vesiculovirus, Juronavesiculovirus, Malpais Spring vesiculovirus, Maraba vesiculovirus,Morreton vesiculovirus, New Jersey vesiculovirus, Perinetvesiculovirus, Piry vesiculovirus, Radi vesiculovirus, YugBogdanovac vesiculovirus, Zahedan zarhavirus, Reptile sunshinevirus1, Bolahun anphevirus, Dipteran anphevirus, Drosophilid anphevirus,Odonate anphevirus, Orthopteran anphevirus, Shuangao anphevirus,Xincheng anphevirus, Beihai yuyuevirus, Shahe yuyuevirus, Hairyantennavirus, Striated antennavirus, Haartman hartmanivirus,Muikkunen hartmanivirus, Schoolhouse hartmanivirus, Zurichhartmanivirus, Allpahuayo mammarenavirus, Alxa mammarenavirus,Argentinian mammarenavirus, Bear Canyon mammarenavirus, Brazilianmammarenavirus, Cali mammarenavirus, Chapare mammarenavirus,Chevrier mammarenavirus, Cupixi mammarenavirus, Flexalmammarenavirus, Gairo mammarenavirus, Guanarito mammarenavirus,Ippy mammarenavirus, Lassa mammarenavirus, Latino mammarenavirus,Loei River mammarenavirus, Lujo mammarenavirus, Lunamammarenavirus, Lunk mammarenavirus, Lymphocytic choriomeningitismammarenavirus, Machupo mammarenavirus, Mariental mammarenavirus,Merino Walk mammarenavirus, Mobala mammarenavirus, Mopeiamammarenavirus, Okahandja mammarenavirus, Oliveros mammarenavirus,Paraguayan mammarenavirus, Pirital mammarenavirus, Planaltomammarenavirus, Ryukyu mammarenavirus, Serra do Naviomammarenavirus, Solwezi mammarenavirus, Souris mammarenavirus,Tacaribe mammarenavirus, Tamiami mammarenavirus, Wenzhoumammarenavirus, Whitewater Arroyo mammarenavirus, Xapurimammarenavirus, California reptarenavirus, Giessen reptarenavirus,Golden reptarenavirus, Ordinary reptarenavirus, Rotterdamreptarenavirus, Crustacean lincruvirus, Actinidia chloroticringspot-associated emaravirus, Blackberry leaf mottle associatedemaravirus, European mountain ash ringspot-associated emaravirus,Fig mosaic emaravirus, High Plains wheat mosaic emaravirus,Pigeonpea sterility mosaic emaravirus 1, Pigeonpea sterility mosaicemaravirus 2, Pistacia emaravirus B, Raspberry leaf blotchemaravirus, Redbud yellow ringspot-associated emaravirus, Roserosette emaravirus, Batfish actinovirus, Goosefish actinovirus,Spikefish actinovirus, Hagfish agnathovirus, Brno loanvirus,Longquan loanvirus, Laibin mobatvirus, Nova mobatvirus, Quezonmobatvirus, Andes orthohantavirus, Asama orthohantavirus, Asikkalaorthohantavirus, Bayou orthohantavirus, Black Creek Canalorthohantavirus, Bowe orthohantavirus, Bruges orthohantavirus, CanoDelgadito orthohantavirus, Cao Bang orthohantavirus, Chocloorthohantavirus, Dabieshan orthohantavirus, Dobrava-Belgradeorthohantavirus, El Moro Canyon orthohantavirus, Fugongorthohantavirus, Fusong orthohantavirus, Hantaan orthohantavirus,Jeju orthohantavirus, Kenkeme orthohantavirus, Khabarovskorthohantavirus, Laguna Negra orthohantavirus, Luxiorthohantavirus, Maporal orthohantavirus, Montano orthohantavirus,Necocli orthohantavirus, Oxbow orthohantavirus, Prospect Hillorthohantavirus, Puumala orthohantavirus, Rockport orthohantavirus,Sangassou orthohantavirus, Seewis orhtohantavirus, Seoulorthohantavirus, Sin Nombre orthohantavirus, Thailandorthohantavirus, Tigray orthohantavirus, Tula orthohantavirus,Yakeshi orthohantavirus, Imjin thottimvirus, Thottopalayamthottimvirus, Gecko reptillovirus, Leptomonas shilevirus, Myriapodhubavirus, Artashat orthonairovirus, Chim orthonairovirus,Crimean-Congo hemorrhagic fever orthonairovirus, Dera Ghazi Khanorthonairovirus, Dugbe orthonairovirus, Estero Realorthonairovirus, Hazara orthonairovirus, Hughes orthonairovirus,Kasokero orthonairovirus, Keterah orthonairovirus, Nairobi sheepdisease orthonairovirus, Qalyub orthonairovirus, Sakhalinorthonairovirus, Tamdy orthonairovirus, Thiafora orthonairovirus,Spider shaspivirus, Strider striwavirus, Herbert herbevirus, Kibaleherbevirus, Tai herbevirus, Acara orthobunyavirus, Ainoorthobunyavirus, Akabane orthobunyavirus, Alajuela orthobunyavirus,Anadyr orthobunyavirus, Anhembi orthobunyavirus, Anopheles Aorthobunyavirus, Anopheles B orthobunyavirus, Bakauorthobunyavirus, Batai orthobunyavirus, Batama orthobunyavirus,Bellavista orthobunyavirus, Benevides orthobunyavirus, Bertiogaorthobunyavirus, Bimiti orthobunyavirus, Birao orthobunyavirus,Botambi orthobunyavirus, Bozo orthobunyavirus, Bunyamweraorthobunyavirus, Bushbush orthobunyavirus, Buttonwilloworthobunyavirus, Bwamba orthobunyavirus, Cache Valleyorthobunyavirus, Cachoeira Porteira orthobunyavirus, Californiaencephalitis orthobunyavirus, Capim orthobunyavirus, Caraparuorthobunyavirus, Cat Que orthobunyavirus, Catu orthobunyavirus,Enseada orthobunyavirus, Faceys paddock orthobunyavirus, FortSherman orthobunyavirus, Gamboa orthobunyavirus, Guajaraorthobunyavirus, Guama orthobunyavirus, Guaroa orthobunyavirus,Iaco orthobunyavirus, Ilesha orthobunyavirus, Ingwavumaorthobunyavirus, Jamestown Canyon orthobunyavirus, Jatobalorthobunyavirus, Kaeng Khoi orthobunyavirus, Kairi orthobunyavirus,Keystone orthobunyavirus, Koongol orthobunyavirus, La Crosseorthobunyavirus, Leanyer orthobunyavirus, Lumbo orthbunyavirus,Macaua orthobunyavirus, Madrid orthobunyavirus, Maguariorthobunyavirus, Main Drain orthobunyavirus, Manzanillaorthobunyavirus, Marituba orthobunyavirus, Melao orthobunyavirus,Mermet orthobunyavirus, Minatitlan orthobunyavirus, MPokoorthobunyavirus, Nyando orthobunyavirus, Olifantsvleiorthobunyavirus, Oriboca orthobunyavirus, Oropoucheorthobunyavirus, Patois orthobunyavirus, Peaton orthobunyavirus,Potosi orthobunyavirus, Sabo orthobunyavirus, San Angeloorthobunyavirus, Sango orthobunyavirus, Schmallenbergorthobunyavirus, Serra do Navio orthobunyavirus, Shuniorthobunyavirus, Simbu orthobunyavirus, Snowshoe hareorthobunyavirus, Sororoca orthobunyavirus, Tacaiumaorthobunyavirus, Tahyna orthobunyavirus, Tataguine orthobunyavirus,Tensaw orthobunyavirus, Tete orthobunyavirus, Thimiriorthobunyavirus, Timboteua orthobunyavirus, Trivittatusorthobunyavirus, Turlock orthobunyavirus, Utinga orthobunyavirus,Witwatersrand orthobunyavirus, Wolkberg orthobunyavirus, Wyeomyiaorthobunyavirus, Zegla orthobunyavirus, Caimito pacuvirus, Chilibrepacuvirus, Pacui pacuvirus, Rio Preto da Eva pacuvirus, Tapirapepacuvirus, Insect shangavirus, Ferak feravirus, Jonchet jonvirus,Anopheles orthophasmavirus, Culex orthophasmavirus, Gandaorthophasmavirus, Kigluaik phantom orthophasmavirus, Odonateorthophasmavirus, Qingling orthophasmavirus, Wuchang cockroachorthophasmavirus 1, Wuhan mosquito orthophasmavirus 1, Wuhanmosquito orthophasmavirus 2, Sanxia sawastrivirus, Insectwuhivirus, Bhanja bandavirus, Dabie bandavirus, Guertu bandavirus,Heartland bandavirus, Hunter Island bandavirus, Kismaayobandavirus, Lone Star bandavirus, Dipteran beidivirus, Citruscoguvirus, Coguvirus eburi, Entoleuca entovirus, Cumuto goukovirus,Gouleako goukovirus, Yichang insect goukovirus, Horseflyhorwuvirus, Dipteran hudivirus, Lepidopteran hudovirus, Blacklegixovirus, Norway ixovirus, Scapularis ixovirus, Laurel Lakelaulavirus, Lentinula lentinuvirus, Mothra mobuvirus, Baduphasivirus, Dipteran phasivirus, Fly phasivirus, Phasi Charoen-likephasivirus, Wutai mosquito phasivirus, Adana phlebovirus, Aguacatephlebovirus, Alcube phlebovirus, Alenquer phlebovirus, Ambephlebovirus, Anhanga phlebovirus, Arumowot phlebovirus,Buenaventura phlebovirus, Bujam phlebovirus, Cacao phlebovirus,Campana phlebovirus, Candiru phlebovirus, Chagres phlebovirus, Codephlebovirus, Dashli phlebovirus, Durania phlebovirus, Echaratephlebovirus, Frijoles phlebovirus, Gabek phlebovirus, Gordilphlebovirus, Icoaraci phlebovirus, Itaituba phlebovirus, Itaporangaphlebovirus, Ixcanal phlebovirus, Karimabad phlebovirus, La Gloriaphlebovirus, Lara phlebovirus, Leticia phlebovirus, Maldonadophlebovirus, Massilia phlebovirus, Medjerda phlebovirus, Mona Gritaphlebovirus, Mukawa phlebovirus, Munguba phlebovirus, Naplesphlebovirus, Nique phlebovirus, Ntepes phlebovirus, Odrenisrouphlebovirus, Oriximina phlebovirus, Pena Blanca phlebovirus,Punique phlebovirus, Punta Toro phlebovirus, Rift Valley feverphlebovirus, Rio Grande phlebovirus, Saint Floris phlebovirus,Salanga phlebovirus, Salehabad phlebovirus, Salobo phlabovirus,Sicilian phlebovirus, Tapara phlebovirus, Tehran phlebovirus, Ticophebovirus, Toros phlebovirus, Toscana phlebovirus, Tres Almendrasphlebovirus, Turuna phlebovirus, Uriurana phlebovirus, Urucuriphlebovirus, Viola phlebovirus, Zerdali phlebovirus, Pidgeypidchovirus, Apple rubodvirus 1, Apple rubodvirus 2, Echinochloahoja blanca tenuivirus, Iranian wheat stripe tenuivirus, Maizestripe tenuivirus, Melon tenuivirus, Rice grassy stunt tenuivirus,Rice hoja blanca tenuivirus, Rice stripe tenuivirus, Urochloa hojablanca tenuivirus, American dog uukuvirus, Dabieshan uukuvirus,Grand Arbaud uukuvirus, Huangpi uukuvirus, Kabuto mountainuukuvirus, Kaisodi uukuvirus, Lihan uukuvirus, Murre uukuvirus,Pacific coast uukuvirus, Precarious Point uukuvirus, Rukutamauukuvirus, Schmidt uukuvirus, Silverwater uukuvirus, Tachenguukuvirus, Uukuniemi uukuvirus, Yongjia uukuvirus, Zaliv Terpeniyauukuvirus, Shrimp wenrivirus, Alstroemeria necrotic streakorthotospovirus, Alstroemeria yellow spot orthotospovirus, Beannecrotic mosaic orthotospovirus, Calla lily chlorotic spotorthotospovirus, Capsicum chlorosis orthotospovirus, Chrysanthemumstem necrosis orthotospovirus, Groundnut bud necrosisorthotospovirus, Groundnut chlorotic fan spot orthotospovirus,Groundnut ringspot orthotospovirus, Groundnut yellow spotorthotospovirus, Hippeastrum chlorotic ringspot orthotospovirus,Impatiens necrotic spot orthotospovirus, Iris yellow spotorthotospovirus, Melon severe mosaic orthotospovirus, Melon yellowspot orthotospovirus, Mulberry vein banding associatedorthotospovirus, Pepper chlorotic spot orthotospovirus, Polygonumringspot orthotospovirus, Soybean vein necrosis orthotospovirus,Tomato chlorotic spot orthotospovirus, Tomato spotted wiltorthotospovirus, Tomato yellow ring orthotospovirus, Tomato zonatespot orthotospovirus, Watermelon bud necrosis orthotospovirus,Watermelon silver mottle orthotospovirus, Zucchini lethal chlorosisorthotospovirus, Millipede wumivirus, Tilapia tilapinevirus,Influenza A virus, Influenza B virus, Influenza D virus, InfluenzaC virus, Salmon isavirus, Johnston Atoll quaranjavirus, Quaranfilquaranjavirus, Dhori thogotovirus, Thogoto thogotovirus,

Allium cepa amalgavirus 1, Allium cepa amalgavirus 2, Blueberrylatent virus, Rhododendron virus A, Southern tomato virus, Spinachamalgavirus 1, Vicia cryptic virus M, Zoostera marina amalgavirus1, Zoostera marina amalgavirus 2, Zygosaccharomyces bailii virus Z,Cryphonectria hypovirus 1, Cryphonectria hypovirus 2, Cryphonectriahypovirus 3, Cryphonectria hypovirus 4, Beet cryptic virus 1,Carrot cryptic virus, Cherry chlorotic rusty spot associatedpartitivirus, Chondrostereum purpureum cryptic virus 1, Flammulinavelutipes browning virus, Helicobasidium mompa partitivirus V70,Heterobasidion partitivirus 1, Heterobasidion partitivirus 3,Heterobasidion partitivirus 12, Heterobasidion partitivirus 13,Heterobasidion partitivirus 15, Rosellinia necatrix partitivirus 2,Vicia cryptic virus, White clover cryptic virus 1, Atkinsonellahypoxylon virus, Cannabis cryptic virus, Ceratocystis resiniferavirus 1, Crimson clover cryptic virus 2, Dill cryptic virus 2,Fusarium poae virus 1, Heterobasidion partitivirus 2,Heterobasidion partitivirus 7, Heterobasidion partitivirus 8,Heterobasidion partitivirus P, Hop trefoil cryptic virus 2,Pleurotus ostreatus virus 1, Primula malacoides virus 1, Red clovercryptic virus 2, Rhizoctonia solani virus 717, Rosellinia necatrixvirus 1, White clover cryptic virus 2, Cryptosporidium parvum virus1, Beet cryptic virus 2, Beet cryptic virus 3, Fig cryptic virus,Pepper cryptic virus 1, Pepper cryptic virus 2, Aspergillusochraceous virus, Discula destructiva virus 1, Discula destructivavirus 2, Fusarium solani virus 1, Gremmeniella abietina RNA virusMS1, Ophiostoma partitivirus 1, Penicillium stoloniferum virus F,Penicillium stoloniferum virus S, Agaricus bisporus virus 4,Alfalfa cryptic virus 1, Carnation cryptic virus 1, Carrottemperate virus 1, Carrot temperate virus 2, Carrot temperate virus3, Carrot temperate virus 4, Gaeumannomyces graminis virus 0196A,Gaeumannomyces graminis virus T1A, Hop trefoil cryptic virus 1, Hoptrefoil cryptic virus 3, Radish yellow edge virus, Ryegrass crypticvirus, Spinach temperate virus, White clover cryptic virus 3,Beihai picobirnavirus, Equine picobirnavirus, Human picobirnavirus,Aplysia abyssovirus 1, Muarterivirus afrigant, Alphaarterivirusequid, Lambdaarterivirus afriporav, Deltaarterivirus hemfev,Epsilonarterivirus hemcep, Epsilonarterivirus safriver,Epsilonarterivirus zamalb, Etaarterivirus ugarco 1, Iotaarterivirusdebrazmo, Iotaarterivirus kibreg 1, Iotaarterivirus pejah,Thetaarterivirus kafuba, Thetaarterivirus mikelba 1,Zetaarterivirus ugarco 1, Betaarterivirus suid 2, Betaarteriviruschinrav 1, Betaarterivirus ninrav, Betaarterivirus sheoin,Betaarterivirus suid 1, Betaarterivirus timiclar, Gammaarteriviruslacdeh, Nuarterivirus guemel, Kappaarterivirus wobum,Chinturpovirus 1, Ptyasnivirus 1, Oligodon snake nidovirus 1,Microhyla letovirus 1, Bat coronavirus CDPHE15, Bat coronavirusHKU10, Rhinolophus ferrumequinum alphacoronavirus HuB-2013, Humancoronavirus 229E, Lucheng Rn rat coronavirus, Mink coronavirus 1,Miniopterus bat coronavirus 1, Miniopterus bat coronavirus HKU8,Myotis ricketti alphacoronavirus Sax-2011, Nyctalus velutinusalphacoronavirus SC-2013, Pipistrellus kuhlii coronavirus 3398,Porcine epidemic diarrhea virus, Scotophilus bat coronavirus 512,Rhinolophus bat coronavirus HKU2, Human coronavirus NL63,NL63-related bat coronavirus strain BtKYNL63-9b, Sorex araneuscoronavirus T14, Suncus murinus coronavirus X74, Alphacoronavirus1, Betacoronavirus 1, China Rattus coronavirus HKU24, Humancoronavirus HKU1, Murine coronavirus, Myodes coronavirus 2JL14, BatHp-betacoronavirus Zhejiang2013, Hedgehog coronavirus 1, MiddleEast respiratory syndrome-related coronavirus, Pipistrellus batcoronavirus HKU5, Tylonycteris bat coronavirus HKU4, Eidolon batcoronavirus C704, Rousettus bat coronavirus GCCDC1, Rousettus batcoronavirus HKU9, Severe acute respiratory syndrome-relatedcoronavirus, Wigeon coronavirus HKU20, Bulbul coronavirus HKU11,Common moorhen coronavirus HKU21, Coronavirus HKU15, Muniacoronavirus HKU13, White-eye coronavirus HKU16, Night heroncoronavirus HKU19, Goose coronavirus CB17, Beluga whale coronavirusSW1, Avian coronavirus, Avian coronavirus 9203, Duck coronavirus2714, Turrinivirus 1, Botrylloides leachii nidovirus,Alphamesonivirus 4, Alphamesonivirus 8, Alphamesonivirus 5,Alphamesonivirus 7, Alphamesonivirus 2, Alphamesonivirus 3,Alphamesonivirus 9, Alphamesonivirus 1, Alphamesonivirus 10,Alphamesonivirus 6, Planidovirus 1, Nangarvirus 1, Halfbeaknidovirus 1, Charybnivirus 1, Decronivirus 1, Paguronivirus 1,Gill-associated virus, Okavirus 1, Yellow head virus, White breamvirus, Fathead minnow nidovirus 1, Chinook salmon nidovirus 1,Bovine nidovirus 1, Hebius tobanivirus 1, Infratovirus 1, Lycodontobanivirus 1, Ball python nidovirus 1, Morelia tobanivirus 1,Berisnavirus 1, Shingleback nidovirus 1, Sectovirus 1, Bovinetorovirus, Equine torovirus, Porcine torovirus, Bavaria virus,European brown hare syndrome virus, Rabbit hemorrhagic diseasevirus, Minovirus A, Nacovirus A, Newbury 1 virus, Norwalk virus,Recovirus A, Nordland virus, Sapporo virus, Saint Valerien virus,Feline calicivirus, Vesicular exanthema of swine virus, Acute beeparalysis virus, Israeli acute paralysis virus, Kashmir bee virus,Mud crab virus, Solenopsis invicta virus 1, Taura syndrome virus,Aphid lethal paralysis virus, Cricket paralysis virus, Drosophila Cvirus, Rhopalosiphum padi virus, Black queen cell virus, Himetobi Pvirus, Homalodisca coagulata virus 1, Plautia stali intestinevirus, Triatoma virus, Antheraea pernyi iflavirus, Brevicorynebrassicae virus, Deformed wing virus, Dinocampus coccinellaeparalysis virus, Ectropis obliqua virus, Infectious flacherievirus, Lygus lineolaris virus 1, Lymantria dispar iflavirus 1,Nilaparvata lugens honeydew virus 1, Perina nuda virus, Sacbroodvirus, Slow bee paralysis virus, Spodoptera exigua iflavirus 1,Spodoptera exigua iflavirus 2, Varroa destructor virus 1,Chaetoceros socialis forma radians RNA virus 1, Chaetocerostenuissimus RNA virus 01, Rhizosolenia setigera RNA virus 01,Astarnavirus, Aurantiochytrium single-stranded RNA virus 01,Jericarnavirus B, Sanfarnavirus 1, Sanfarnavirus 2, Sanfarnavirus3, Heterosigma akashiwo RNA virus, Britarnavirus 1, Britarnavirus4, Palmarnavirus 128, Palmarnavirus 473, Britarnavirus 2,Britarnavirus 3, Chaetarnavirus 2, Chaetenuissarnavirus II,Jericarnavirus A, Palmarnavirus 156, Aalivirus A, Ailurivirus A,Ampivirus A, Anativirus A, Anativirus B, Bovine rhinitis A virus,Bovine rhinitis B virus, Equine rhinitis A virus, Foot-and-mouthdisease virus, Aquamavirus A, Avihepatovirus A, Avisivirus A,Avisivirus B, Avisivirus C, Boosepivirus A, Boosepivirus B,Boosepivirus C, Bopivirus A, Cardiovirus A, Cardiovirus B,Cardiovirus C, Cardiovirus D, Cardiovirus E, Cardiovirus F,Cosavirus A, Cosavirus B, Cosavirus D, Cosavirus E, Cosavirus F,Crahelivirus A, Crohivirus A, Crohivirus B, Cadicivirus A,Cadicivirus B, Diresapivirus A, Diresapivirus B, Enterovirus A,Enterovirus B, Enterovirus C, Enterovirus D, Enterovirus E,Enterovirus F, Enterovirus G, Enterovirus H, Enterovirus I,Enterovirus J, Enterovirus K, Enterovirus L, Rhinovirus A,Rhinovirus B, Rhinovirus C, Erbovirus A, Felipivirus A, FipivirusA, Fipivirus B, Fipivirus C, Fipivirus D, Fipivirus E, GallivirusA, Gruhelivirus A, Grusopivirus A, Grusopivirus B, Harkavirus A,Hemipivirus A, Hepatovirus A, Hepatovirus B, Hepatovirus C,Hepatovirus D, Hepatovirus E, Hepatovirus F, Hepatovirus G,Hepatovirus H, Hepatovirus I, Hunnivirus A, Aichivirus A,Aichivirus B, Aichivirus C, Aichivirus D, Aichivirus E, AichivirusF, Kunsagivirus A, Kunsagivirus B, Kunsagivirus C, Limnipivirus A,Limnipivirus B, Limnipivirus C, Livupivirus A, Ludopivirus A,Malagasivirus A, Malagasivirus B, Megrivirus A, Megrivirus B,Megrivirus C, Megrivirus D, Megrivirus E, Mischivirus A,Mischivirus B, Mischivirus C, Mischivirus D, Mosavirus A, MosavirusB, Mupivirus A, Myrropivirus A, Orivirus A, Oscivirus A,Parabovirus A, Parabovirus B, Parabovirus C, Parechovirus A,Parechovirus B, Parechovirus C, Parechovirus D, Parechovirus E,Parechovirus F, Pasivirus A, Passerivirus A, Passerivirus B,Pemapivirus A, Poecivirus A, Potamipivirus A, Potamipivirus B,Rabovirus A, Rabovirus B, Rabovirus C, Rabovirus D, Rafivirus A,Rafivirus B, Rafivirus C, Rohelivirus A, Rosavirus A, Rosavirus B,Rosavirus C, Sakobuvirus A, Salivirus A, Sapelovirus A, SapelovirusB, Senecavirus A, Shanbavirus A, Sicinivirus A, Symapivirus A,Teschovirus A, Teschovirus B, Torchivirus A, Tottorivirus A,Tremovirus A, Tremovirus B, Tropivirus A, Chironomus riparius virus1, Hubei chipolycivirus, Hubei hupolycivirus, Formica exsecta virus3, Lasius neglectus virus 1, Lasius neglectus virus 2, Lasius nigervirus 1, Linepithema humile virus 2, Monomorium pharaonis virus 1,Monomorium pharaonis virus 2, Myrmica scabrinodis virus 1, Shuangaoinsect virus 8, Solenopsis invicta virus 2, Solenopsis invictavirus 4, Andean potato mottle virus, Bean pod mottle virus, Beanrugose mosaic virus, Broad bean stain virus, Broad bean true mosaicvirus, Cowpea mosaic virus, Cowpea severe mosaic virus, Glycinemosaic virus, Pea green mottle virus, Pea mild mosaic virus, Quailpea mosaic virus, Radish mosaic virus, Red clover mottle virus,Squash mosaic virus, Ullucus virus C, Broad bean wilt virus 1,Broad bean wilt virus 2, Cucurbit mild mosaic virus, Gentian mosaicvirus, Grapevine fabavirus, Lamium mild mosaic virus, Prunus virusF, Aeonium ringspot virus, Apricot latent ringspot virus, Arabismosaic virus, Arracacha virus A, Artichoke Aegean ringspot virus,Artichoke Italian latent virus, Artichoke yellow ringspot virus,Beet ringspot virus, Blackcurrant reversion virus, Blueberry latentspherical virus, Blueberry leaf mottle virus, Cassava Americanlatent virus, Cassava green mottle virus, Cherry leaf roll virus,Chicory yellow mottle virus, Cocoa necrosis virus, Crimson cloverlatent virus, Cycas necrotic stunt virus, Grapevine Anatolianringspot virus, Grapevine Bulgarian latent virus, Grapevine chromemosaic virus, Grapevine deformation virus, Grapevine fanleaf virus,Grapevine Tunisian ringspot virus, Hibiscus latent ringspot virus,Lucerne Australian latent virus, Melon mild mottle virus, Mulberrymosaic leaf roll associated virus, Mulberry ringspot virus,Myrobalan latent ringspot virus, Olive latent ringspot virus, Peachrosette mosaic virus, Potato black ringspot virus, Potato virus B,Potato virus U, Raspberry ringspot virus, Soybean latent sphericalvirus, Tobacco ringspot virus, Tomato black ring virus, Tomatoringspot virus, Apple latent spherical virus, Arracacha virus B,Cherry rasp leaf virus, Currant latent virus, Stocky prune virus,Chocolate lily virus A, Dioscorea mosaic associated virus, Satsumadwarf virus, Black raspberry necrosis virus, Strawberry mottlevirus, Carrot necrotic dieback virus, Dandelion yellow mosaicvirus, Parsnip yellow fleck virus, Carrot torradovirus 1, Lettucenecrotic leaf curl virus, Motherwort yellow mottle virus, Squashchlorotic leaf spot virus, Tomato marchitez virus, Tomato torradovirus, Anthriscus yellows virus, Bellflower vein chlorosis virus,Maize chlorotic dwarf virus, Rice tungro spherical virus,Strawberry latent ringspot virus, Solenopsis invicta virus 3,Nylanderia fulva virus 1, Heterocapsa circularisquama RNA virus 01,Mushroom bacilliform virus, Poinsettia latent virus, Artemisiavirus A, Blueberry shoestring virus, Cocksfoot mottle virus,Cymbidium chlorotic mosaic virus, Imperata yellow mottle virus,Lucerne transient streak virus, Papaya lethal yellowing virus, Riceyellow mottle virus, Rottboellia yellow mottle virus, Ryegrassmottle virus, Sesbania mosaic virus, Solanum nodiflorum mottlevirus, Southern bean mosaic virus, Southern cowpea mosaic virus,Sowbane mosaic virus, Soybean yellow common mosaic virus,Subterranean clover mottle virus, Turnip rosette virus, Velvettobacco mottle virus, Areca palm necrotic ringspot virus, Arecapalm necrotic spindle-spot virus, Bellflower veinal mottle virus,Blackberry virus Y, Barley mild mosaic virus, Barley yellow mosaicvirus, Oat mosaic virus, Rice necrosis mosaic virus, Wheat spindlestreak mosaic virus, Wheat yellow mosaic virus, Celery latentvirus, Cassava brown streak virus, Coccinia mottle virus, Cucumbervein yellowing virus, Squash vein yellowing virus, Sweet potatomild mottle virus, Tomato mild mottle virus, Ugandan cassava brownstreak virus, Alpinia mosaic virus, Alpinia oxyphylla mosaic virus,Artichoke latent virus, Broad-leafed dock virus A, Cardamom mosaicvirus, Chinese yam necrotic mosaic virus, Maclura mosaic virus,Narcissus latent virus, Yam chlorotic mosaic virus, Yam chloroticnecrosis virus, Caladenia virus A, Sugarcane streak mosaic virus,Triticum mosaic virus, African eggplant mosaic virus, Algerianwatermelon mosaic virus, Alstroemeria mosaic virus, Alternantheramild mosaic virus, Amaranthus leaf mottle virus, Amazon lily mosaicvirus, Angelica virus Y, Apium virus Y, Araujia mosaic virus,Arracacha mottle virus, Asparagus virus 1, Banana bract mosaicvirus, Barbacena virus Y, Basella rugose mosaic virus, Bean commonmosaic necrosis virus, Bean common mosaic virus, Bean yellow mosaicvirus, Beet mosaic virus, Bidens mosaic virus, Bidens mottle virus,Blue squill virus A, Brugmansia mosaic virus, Brugmansia suaveolensmottle virus, Butterfly flower mosaic virus, Calanthe mild mosaicvirus, Calla lily latent virus, Callistephus mottle virus, Cannayellow streak virus, Carnation vein mottle virus, Carrot thin leafvirus, Carrot virus Y, Catharanthus mosaic virus, Celery mosaicvirus, Ceratobium mosaic virus, Chilli ringspot virus, Chilliveinal mottle virus, Chinese artichoke mosaic virus, Clitoria virusY, Clover yellow vein virus, Cocksfoot streak virus, Colombiandatura virus, Commelina mosaic virus, Cowpea aphid-borne mosaicvirus, Cucurbit vein banding virus, Cypripedium virus Y, Cyrtanthuselatus virus A, Daphne mosaic virus, Daphne virus Y, Dasheen mosaicvirus, Datura shoestring virus, Dendrobium chlorotic mosaic virus,Dioscorea mosaic virus, Diuris virus Y, Donkey orchid virus A, EastAsian Passiflora distortion virus, East Asian Passiflora virus,Endive necrotic mosaic virus, Euphorbia ringspot virus, Freesiamosaic virus, Fritillary virus Y, Gloriosa stripe mosaic virus,Gomphocarpus mosaic virus, Habenaria mosaic virus, Hardenbergiamosaic virus, Henbane mosaic virus, Hibbertia virus Y, Hippeastrummosaic virus, Hyacinth mosaic virus, Impatiens flower break virus,Iris fulva mosaic virus, Iris mild mosaic virus, Iris severe mosaicvirus, Japanese yam mosaic virus, Jasmine virus T, Johnsongrassmosaic virus, Kalanchoe mosaic virus, Keunjorong mosaic virus,Konjac mosaic virus, Leek yellow stripe virus, Lettuce Italiannecrotic virus, Lettuce mosaic virus, Lily mottle virus, Lily virusY,

Lupinus mosaic virus, Lycoris mild mottle virus, Maize dwarf mosaicvirus, Malva vein clearing virus, Mashua virus Y, Meadow saffronbreaking virus, Mediterranean ruda virus, Moroccan watermelonmosaic virus, Narcissus degeneration virus, Narcissus late seasonyellows virus, Narcissus yellow stripe virus, Nerine yellow stripevirus, Nothoscordum mosaic virus, Onion yellow dwarf virus,Ornithogalum mosaic virus, Ornithogalum virus 2, Ornithogalum virus3, Panax virus Y, Papaya leaf distortion mosaic virus, Papayaringspot virus, Paris mosaic necrosis virus, Parsnip mosaic virus,Passiflora chlorosis virus, Passion fruit woodiness virus, Peaseed-borne mosaic virus, Peanut mottle virus, Pecanmosaic-associated virus, Pennisetum mosaic virus, Pepper mottlevirus, Pepper severe mosaic virus, Pepper veinal mottle virus,Pepper yellow mosaic virus, Peru tomato mosaic virus, Pfaffiamosaic virus, Platycodon mild mottle virus, Pleione virus Y, Plumpox virus, Pokeweed mosaic virus, Potato virus A, Potato virus V,Potato virus Y, Potato yellow blotch virus, Ranunculus leafdistortion virus, Ranunculus mild mosaic virus, Ranunculus mosaicvirus, Rhopalanthe virus Y, Saffron latent virus, Sarcochilus virusY, Scallion mosaic virus, Shallot yellow stripe virus, Sorghummosaic virus, Soybean mosaic virus, Spiranthes mosaic virus 3,Sudan watermelon mosaic virus, Sugarcane mosaic virus, Sunflowerchlorotic mottle virus, Sunflower mild mosaic virus, Sunflowermosaic virus, Sunflower ring blotch virus, Sweet potato featherymottle virus, Sweet potato latent virus, Sweet potato mildspeckling virus, Sweet potato virus 2, Sweet potato virus C, Sweetpotato virus G, Tamarillo leaf malformation virus, Telfairia mosaicvirus, Telosma mosaic virus, Thunberg fritillary mosaic virus,Tobacco etch virus, Tobacco mosqueado virus, Tobacco vein bandingmosaic virus, Tobacco vein mottling virus, Tomato necrotic stuntvirus, Tradescantia mild mosaic virus, Tuberose mild mosaic virus,Tuberose mild mottle virus, Tulip breaking virus, Tulip mosaicvirus, Turnip mosaic virus, Twisted-stalk chlorotic streak virus,Vallota mosaic virus, Vanilla distortion mosaic virus, Verbenavirus Y, Watermelon leaf mottle virus, Watermelon mosaic virus,Wild melon banding virus, Wild onion symptomless virus, Wild potatomosaic virus, Wild tomato mosaic virus, Wisteria vein mosaic virus,Yam mild mosaic virus, Yam mosaic virus, Yambean mosaic virus,Zantedeschia mild mosaic virus, Zea mosaic virus, Zucchinishoestring virus, Zucchini tigre mosaic virus, Zucchini yellowfleck virus, Zucchini yellow mosaic virus, Passiflora edulissymptomless virus, Rose yellow mosaic virus, Agropyron mosaicvirus, Hordeum mosaic virus, Ryegrass mosaic virus, Brome streakmosaic virus, Oat necrotic mottle virus, Tall oatgrass mosaicvirus, Wheat eqlid mosaic virus, Wheat streak mosaic virus, Yellowoat grass mosaic virus, Common reed chlorotic stripe virus, Longanwitches broom-associated virus, Spartina mottle virus, Avastrovirus1, Avastrovirus 2, Avastrovirus 3, Mamastrovirus 1, Mamastrovirus2, Mamastrovirus 3, Mamastrovirus 4, Mamastrovirus 5, Mamastrovirus6, Mamastrovirus 7, Mamastrovirus 8, Mamastrovirus 9, Mamastrovirus10, Mamastrovirus 11, Mamastrovirus 12, Mamastrovirus 13,Mamastrovirus 14, Mamastrovirus 15, Mamastrovirus 16, Mamastrovirus17, Mamastrovirus 18, Mamastrovirus 19, Infectious pancreaticnecrosis virus, Tellina virus, Yellowtail ascites virus, Infectiousbursal disease virus, Blotched snakehead virus, Lates calcariferbirnavirus, Drosophina B birnavirus, Drosophila X virus, Mosquito Xvirus, Rotifer birnavirus, Tellina virus 1, Euprosterna elaeasavirus, Thosea asigna virus, Botrytis porri botybirnavirus 1, Duckhepatitis B virus, Heron hepatitis B virus, Parrot hepatitis Bvirus, Tibetan frog hepatitis B virus, Blue gill hepatitis B virus,Capuchin monkey hepatitis B virus, Chinese shrew hepatitis B virus,Domestic cat hepatitis B virus, Ground squirrel hepatitis virus,Hepatitis B virus, Long-fingered bat hepatitis B virus, Pomona bathepatitis B virus, Roundleaf bat hepatitis B virus, Tai Foresthepatitis B virus, Tent-making bat hepatitis B virus, Woodchuckhepatitis virus, Woolly monkey hepatitis B virus, White suckerhepatitis B virus, Anopheles gambiae Moose virus, Antheraeasemotivirus Tamy, Ascaris lumbricoides Tas virus, Bombyx mori Paovirus, Caenorhabditis elegans Cer13 virus, Drosophila melanogasterBel virus, Drosophila melanogaster Roo virus, Drosophilasemotivirus Max, Drosophila simulans Ninja virus, Schistosomasemotivirus Sinbad, Takifugu rubripes Suzu virus, Aglaonemabacilliform virus, Banana streak GF virus, Banana streak IM virus,Banana streak MY virus, Banana streak OL virus, Banana streak UAvirus, Banana streak UI virus, Banana streak UL virus, Bananastreak UM virus, Banana streak VN virus, Birch leaf roll-associatedvirus, Blackberry virus F, Bougainvillea chlorotic vein bandingvirus, Cacao bacilliform Sri Lanka virus, Cacao mild mosaic virus,Cacao swollen shoot CD virus, Cacao swollen shoot CE virus, Cacaoswollen shoot Ghana M virus, Cacao swollen shoot Ghana N virus,Cacao swollen shoot Ghana Q virus, Cacao swollen shoot Togo Avirus, Cacao swollen shoot Togo B virus, Cacao yellow vein bandingvirus, Canna yellow mottle associated virus, Canna yellow mottlevirus, Citrus yellow mosaic virus, Codonopsis vein clearing virus,Commelina yellow mottle virus, Dioscorea bacilliform AL virus,Dioscorea bacilliform AL virus 2, Dioscorea bacilliform ES virus,Dioscorea bacilliform RT virus 1, Dioscorea bacilliform RT virus 2,Dioscorea bacilliform SN virus, Dioscorea bacilliform TR virus, Figbadnavirus 1, Gooseberry vein banding associated virus, Grapevinebadnavirus 1, Grapevine Roditis leaf discoloration-associatedvirus, Grapevine vein clearing virus, Jujube mosaic-associatedvirus, Kalanchoe top-spotting virus, Mulberry badnavirus 1, Pagodayellow mosaic associated virus, Pineapple bacilliform CO virus,Pineapple bacilliform ER virus, Piper yellow mottle virus, Rubusyellow net virus, Schefflera ringspot virus, Spiraea yellowleafspot virus, Sugarcane bacilliform Guadeloupe A virus, Sugarcanebacilliform Guadeloupe D virus, Sugarcane bacilliform IM virus,Sugarcane bacilliform MO virus, Sweet potato pakakuy virus, Tarobacilliform CH virus, Taro bacilliform virus, Wisteria badnavirus1, Yacon necrotic mottle virus, Angelica bushy stunt virus,Atractylodes mild mottle virus, Carnation etched ring virus,Cauliflower mosaic virus, Dahlia mosaic virus, Figwort mosaicvirus, Horseradish latent virus, Lamium leaf distortion virus,Mirabilis mosaic virus, Rudbeckia flower distortion virus, SoybeanPutnam virus, Strawberry vein banding virus, Thistle mottle virus,Cassava vein mosaic virus, Sweet potato collusive virus, Dioscoreanummularia associated virus, Petunia vein clearing virus, Roseyellow vein virus, Sweet potato vein clearing virus, Tobacco veinclearing virus, Blueberry red ringspot virus, Cestrum yellow leafcurling virus, Peanut chlorotic streak virus, Soybean chloroticmottle virus, Rice tungro bacilliform virus, Blueberry fruit dropassociated virus, Ceratitis capitata Yoyo virus, Drosophilaananassae Tom virus, Drosophila melanogaster 17-6 virus, Drosophilamelanogaster 297 virus, Drosophila melanogaster Gypsy virus,Drosophila melanogaster Idefix virus, Drosophila melanogasterTirant virus, Drosophila melanogaster Zam virus, Drosophila virilisTv1 virus, Trichoplusia ni TED virus, Arabidopsis thaliana Athilavirus, Arabidopsis thaliana Tat4 virus, Bombyx mori Mag virus,Caenorhabditis elegans Cerl virus, Cladosporium fulvum T-1 virus,Dictyostelium discoideum Skipper virus, Drosophila buzzatii Osvaldovirus, Drosophila melanogaster 412 virus, Drosophila melanogasterBlastopia virus, Drosophila melanogaster Mdg1 virus, Drosophilamelanogaster Mdg3 virus, Drosophila melanogaster Micropia virus,Drosophila virilis Ulysses virus, Fusarium oxysporum Skippy virus,Lilium henryi Dell virus, Saccharomyces cerevisiae Ty3 virus,Schizosaccharomyces pombe Tf1 virus, Schizosaccharomyces pombe Tf2virus, Takifugu rubripes Sushi virus, Tribolium castaneum Wootvirus, Tripneustis gratilla SURL virus, Aedes aegypti Mosqcopiavirus, Candida albicans Tca2 virus, Candida albicans Tca5 virus,Drosophila melanogaster 1731 virus, Drosophila melanogaster copiavirus, Saccharomyces cerevisiae Ty5 virus, Volvox carteriLueckenbuesser virus, Volvox carteri Osser virus, Arabidopsisthaliana Art1 virus, Arabidopsis thaliana AtRE1 virus, Arabidopsisthaliana evelknievel virus, Arabidopsis thaliana Tal virus,Brassica oleracea Melmoth virus, Cajanus cajan Panzee virus,Glycine max Tgmr virus, Hordeum vulgare BARE-1 virus, Nicotianatabacum Tnt1 virus, Nicotiana tabacum Tto1 virus, Oryzaaustraliensis RIRE1 virus, Oryza longistaminata Retrofit virus,Physarum polycephalum Tp1 virus, Saccharomyces cerevisiae Ty1virus, Saccharomyces cerevisiae Ty2 virus, Saccharomyces cerevisiaeTy4 virus, Solanum tuberosum Tst1 virus, Triticum aestivum WIS2virus, Zea mays Hopscotch virus, Zea mays Sto4 virus, Arabidopsisthaliana Endovir virus, Glycine max SIRE1 virus, Lycopersiconesculentum ToRTL1 virus, Zea mays Opie2 virus, Zea mays Prem2virus, Phaseolus vulgaris Tpv2-6 virus, Avian carcinoma Mill Hillvirus 2, Avian leukosis virus, Avian myeloblastosis virus, Avianmyelocytomatosis virus 29, Avian sarcoma virus CT10, Fujinamisarcoma virus, Rous sarcoma virus, UR2 sarcoma virus, Y73 sarcomavirus, Jaagsiekte sheep retrovirus, Langur virus, Mason-Pfizermonkey virus, Mouse mammary tumor virus, Squirrel monkeyretrovirus, Bovine leukemia virus, Primate T-lymphotropic virus 1,Primate T-lymphotropic virus 2, Primate T-lymphotropic virus 3,Walleye dermal sarcoma virus, Walleye epidermal hyperplasia virus1, Walleye epidermal hyperplasia virus 2, Chick syncytial virus,Feline leukemia virus, Finkel-Biskis-Jinkins murine sarcoma virus,Gardner-Arnstein feline sarcoma virus, Gibbon ape leukemia virus,Guinea pig type-C oncovirus, Hardy-Zuckerman feline sarcoma virus,Harvey murine sarcoma virus, Kirsten murine sarcoma virus, Koalaretrovirus, Moloney murine sarcoma virus, Murine leukemia virus,Porcine type-C oncovirus, Reticuloendotheliosis virus,Snyder-Theilen feline sarcoma virus, Trager duck spleen necrosisvirus, Viper retrovirus, Woolly monkey sarcoma virus, Bovineimmunodeficiency virus, Caprine arthritis encephalitis virus,Equine infectious anemia virus, Feline immunodeficiency virus,Human immunodeficiency virus 1, Human immunodeficiency virus 2,Jembrana disease virus, Puma lentivirus, Simian immunodeficiencyvirus, Visna-maedi virus, Bovine foamy virus, Equine foamy virus,Feline foamy virus, Brown greater galago prosimian foamy virus,Bornean orangutan simian foamy virus, Central chimpanzee simianfoamy virus, Cynomolgus macaque simian foamy virus, Easternchimpanzee simian foamy virus, Grivet simian foamy virus, Guenonsimian foamy virus, Japanese macaque simian foamy virus, Rhesusmacaque simian foamy virus, Spider monkey simian foamy virus,Squirrel monkey simian foamy virus, Taiwanese macaque simian foamyvirus, Western chimpanzee simian foamy virus, Western lowlandgorilla simian foamy virus, White-tufted-ear marmoset simian foamyvirus, Yellow-breasted capuchin simian foamy virus, Aspergillusfumigatus polymycovirus 1, Aspergillus spelaeus polymycovirus 1,Beauveria bassiana polymycovirus 1, Botryoshaeria dothideapolymycovirus 1, Cladosporium cladosporioides polymycovirus 1,Colletotrichum camelliae polymycovirus 1, Fusarium redolenspolymycovirus 1, Magnaporthe oryzae polymycovirus 1, Penicilliumdigitatum polymycovirus 1, Penicillum brevicompactum polymycovirus1, Macrobrachium satellite virus 1, Tobacco albetovirus 1, Tobaccoalbetovirus 2, Tobacco albetovirus 3, Maize aumaivirus 1, Panicumpapanivirus 1, Tobacco virtovirus 1, Acanthocystis turfaceachlorella virus 1, Hydra viridis Chlorella virus 1, Parameciumbursaria Chlorella virus 1, Paramecium bursaria Chlorella virus A1,Paramecium bursaria Chlorella virus AL1A, Paramecium bursariaChlorella virus AL2A, Paramecium bursaria Chlorella virus BJ2C,Paramecium bursaria Chlorella virus CA4A, Paramecium bursariaChlorella virus CA4B, Paramecium bursaria Chlorella virus IL3A,Paramecium bursaria Chlorella virus NC1A, Paramecium bursariaChlorella virus NE8A, Paramecium bursaria Chlorella virus NY2A,Paramecium bursaria Chlorella virus NYs1, Paramecium bursariaChlorella virus SC1A, Paramecium bursaria Chlorella virus XY6E,Paramecium bursaria Chlorella virus XZ3A, Paramecium bursariaChlorella virus XZ4A, Paramecium bursaria Chlorella virus XZ4C,Emiliania huxleyi virus 86, Ectocarpus fasciculatus virus a,Ectocarpus siliculosus virus 1, Ectocarpus siliculosus virus a,Feldmannia irregularis virus a, Feldmannia species virus,Feldmannia species virus a, Hincksia hinckiae virus a, Myriotrichiaclavaeformis virus a, Pilayella littoralis virus 1, Micromonaspusilla virus SP1, Ostreococcus tauri virus OtV5, Chrysochromulinabrevifilum virus PW1, Heterosigma akashiwo virus 01, Cafeteriaroenbergensis virus, Acanthamoeba polyphaga mimivirus, Heliothisvirescens ascovirus 3a, Spodoptera frugiperda ascovirus 1a,Trichoplusia ni ascovirus 2a, Diadromus pulchellus toursvirus,Lymphocystis disease virus 1, Lymphocystis disease virus 2,Lymphocystis disease virus 3, Infectious spleen and kidney necrosisvirus, Scale drop disease virus, Ambystoma tigrinum virus, Commonmidwife toad virus, Epizootic haematopoietic necrosis virus, Frogvirus 3, Santee-Cooper ranavirus, Singapore grouper iridovirus,Anopheles minimus iridovirus, Invertebrate iridescent virus 3,Invertebrate iridescent virus 9, Invertebrate iridescent virus 22,Invertebrate iridescent virus 25, Decapod iridescent virus 1,Invertebrate iridescent virus 6, Invertebrate iridescent virus 31,Marseillevirus marseillevirus, Senegalvirus marseillevirus,Lausannevirus, Tunisvirus, African swine fever virus, Canarypoxvirus, Flamingopox virus, Fowlpox virus, Juncopox virus, Mynahpoxvirus, Penguinpox virus, Pigeonpox virus, Psittacinepox virus,Quailpox virus, Sparrowpox virus, Starlingpox virus, Turkeypoxvirus, Goatpox virus, Lumpy skin disease virus, Sheeppox virus,Murmansk microtuspox virus, Yokapox virus, Mule deerpox virus, Nilecrocodilepox virus, Hare fibroma virus, Myxoma virus, Rabbitfibroma virus, Squirrel fibroma virus, Eastern kangaroopox virus,Western kangaroopox virus, Molluscum contagiosum virus, Seaotterpox virus, Abatino macacapox virus, Akhmeta virus, Camelpoxvirus, Cowpox virus, Ectromelia virus, Monkeypox virus, Raccoonpoxvirus, Skunkpox virus, Taterapox virus, Vaccinia virus, Variolavirus, Volepox virus, Cotia virus, Bovine papular stomatitis virus,Grey sealpox virus, Orf virus, Pseudocowpox virus, Red deerpoxvirus, Pteropox virus, Salmon gillpox virus, Squirrelpox virus,Swinepox virus, Eptesipox virus, Tanapox virus, Yaba monkey tumorvirus,

Anomala cuprea entomopoxvirus, Aphodius tasmaniae entomopoxvirus,Demodema bonariensis entomopoxvirus, Dermolepida albohirtumentomopoxvirus, Figulus sublaevis entomopoxvirus, Geotrupessylvaticus entomopoxvirus, Melolontha melolontha entomopoxvirus,Acrobasis zelleri entomopoxvirus, Adoxophyes honmai entomopoxvirus,Amsacta moorei entomopoxvirus, Arphia conspersa entomopoxvirus,Choristoneura biennis entomopoxvirus, Choristoneura conflictaentomopoxvirus, Choristoneura diversuma entomopoxvirus,Choristoneura fumiferana entomopoxvirus, Choristoneura rosaceanaentomopoxvirus, Chorizagrotis auxiliaris entomopoxvirus, Heliothisarmigera entomopoxvirus, Locusta migratoria entomopoxvirus,Mythimna separata entomopoxvirus, Oedaleus senegalensisentomopoxvirus, Operophtera brumata entomopoxvirus, Schistocercagregaria entomopoxvirus, Melanoplus sanguinipes entomopoxvirus,Aedes aegypti entomopoxvirus, Camptochironomus tentansentomopoxvirus, Chironomus attenuatus entomopoxvirus, Chironomusluridus entomopoxvirus, Chironomus plumosus entomopoxvirus,Goeldichironomus holoprasinus entomopoxvirus, Diachasmimorphaentomopoxvirus, Cafeteriavirus-dependent mavirus,Mimivirus-dependent virus Sputnik, Mimivirus-dependent virusZamilon, Sulfolobus turreted icosahedral virus 1, Sulfolobusturreted icosahedral virus 2, Pseudomonas virus PR4, Pseudomonasvirus PRD1, Bacillus virus AP50, Bacillus virus Bam35, Bacillusvirus GIL16, Bacillus virus Wip1, Gluconobacter virus GC1, Bovineatadenovirus D, Deer atadenovirus A, Duck atadenovirus A, Lizardatadenovirus A, Ovine atadenovirus D, Possum atadenovirus A,Psittacine atadenovirus A, Snake atadenovirus A, Duck aviadenovirusB, Falcon aviadenovirus A, Fowl aviadenovirus A, Fowl aviadenovirusB, Fowl aviadenovirus C, Fowl aviadenovirus D, Fowl aviadenovirusE, Goose aviadenovirus A, Pigeon aviadenovirus A, Pigeonaviadenovirus B, Psittacine aviadenovirus B, Psittacineaviadenovirus C, Turkey aviadenovirus B, Turkey aviadenovirus C,Turkey aviadenovirus D, Sturgeon ichtadenovirus A, Batmastadenovirus A, Bat mastadenovirus B, Bat mastadenovirus C, Batmastadenovirus D, Bat mastadenovirus E, Bat mastadenovirus F, Batmastadenovirus G, Bat mastadenovirus H, Bat mastadenovirus I, Batmastadenovirus J, Bovine mastadenovirus A, Bovine mastadenovirus B,Bovine mastadenovirus C, Canine mastadenovirus A, Deermastadenovirus B, Dolphin mastadenovirus A, Dolphin mastadenovirusB, Equine mastadenovirus A, Equine mastadenovirus B, Humanmastadenovirus A, Human mastadenovirus B, Human mastadenovirus C,Human mastadenovirus D, Human mastadenovirus E, Humanmastadenovirus F, Human mastadenovirus G, Murine mastadenovirus A,Murine mastadenovirus B, Murine mastadenovirus C, Ovinemastadenovirus A, Ovine mastadenovirus B, Ovine mastadenovirus C,Platyrrhini mastadenovirus A, Polar bear mastadenovirus A, Porcinemastadenovirus A, Porcine mastadenovirus B, Porcine mastadenovirusC, Sea lion mastadenovirus A, Simian mastadenovirus A, Simianmastadenovirus B, Simian mastadenovirus C, Simian mastadenovirus D,Simian mastadenovirus E, Simian mastadenovirus F, Simianmastadenovirus G, Simian mastadenovirus H, Simian mastadenovirus I,Skunk mastadenovirus A, Squirrel mastadenovirus A, Tree shrewmastadenovirus A, Frog siadenovirus A, Great tit siadenovirus A,Penguin siadenovirus A, Raptor siadenovirus A, Skua siadenovirus A,Turkey siadenovirus A, Pseudoalteromonas virus Cr39582,Pseudoalteromonas virus PM2, Haloarcula hispanica icosahedral virus2, Haloarcula hispanica virus PH1, Haloarcula hispanica virus SH1,Haloarcula virus HCIV1, Natrinema virus SNJ1, Thermus virus IN93,Thermus virus P23-77, Alphalipothrixvirus SBFV2,Alphalipothrixvirus SFV1, Acidianus filamentous virus 3, Acidianusfilamentous virus 6, Acidianus filamentous virus 7, Acidianusfilamentous virus 8, Acidianus filamentous virus 9, Sulfolobusislandicus filamentous virus, Acidianus filamentous virus 2,Deltalipothrixvirus SBFV3, Acidianus filamentous virus 1, Acidianusrod-shaped virus 1, Sulfolobus islandicus rod-shaped virus 1,Sulfolobus islandicus rod-shaped virus 2, Ageratum yellow veinSingapore alphasatellite, Cotton leaf curl Saudi Arabiaalphasatellite, Ash gourd yellow vein mosaic alphasatellite,Capsicum India alphasatellite, Cleome leaf crumple alphasatellite,Croton yellow vein mosaic alphasatellite, Euphorbia yellow mosaicalphasatellite, Melon chlorotic mosaic alphasatellite, Sida Cubaalphasatellite, Tomato leaf curl New Delhi alphasatellite, Tomatoleaf curl Virudhunagar alphasatellite, Tomato yellow spotalphasatellite, Whitefly associated Guatemala alphasatellite 2,Whitefly associated Puerto Rico alphasatellite 1, Ageratum enationalphasatellite, Ageratum yellow vein alphasatellite, Ageratumyellow vein China alphasatellite, Ageratum yellow vein Indiaalphasatellite, Bhendi yellow vein alphasatellite, Cassava mosaicMadagascar alphasatellite, Chilli leaf curl alphasatellite, Cottonleaf curl Egypt alphasatellite, Cotton leaf curl Geziraalphasatellite, Cotton leaf curl Lucknow alphasatellite, Cottonleaf curl Multan alphasatellite, Gossypium darwinii symptomlessalphasatellite, Malvastrum yellow mosaic alphasatellite, Malvastrumyellow mosaic Cameroon alphasatellite, Pedilanthus leaf curlalphasatellite, Sida leaf curl alphasatellite, Sida yellow veinVietnam alphasatellite, Sunflower leaf curl Karnatakaalphasatellite, Synedrella leaf curl alphasatellite, Tobacco curlyshoot alphasatellite, Tomato leaf curl Buea alphasatellite, Tomatoleaf curl Cameroon alphasatellite, Tomato leaf curl Pakistanalphasatellite, Tomato yellow leaf curl China alphasatellite,Tomato yellow leaf curl Thailand alphasatellite, Tomato yellow leafcurl Yunnan alphasatellite, Eclipta yellow vein alphasatellite,Gossypium mustelinum symptomless alphasatellite, Hollyhock yellowvein alphasatellite, Mesta yellow vein mosaic alphasatellite, Okraenation leaf curl alphasatellite, Okra yellow crinkle Cameroonalphasatellite, Vernonia yellow vein Fujian alphasatellite,Dragonfly associated alphasatellite, Whitefly associated Guatemalaalphasatellite 1, Banana bunchy top alphasatellite 1, Banana bunchytop alphasatellite 2, Banana bunchy top alphasatellite 3, Cardamombushy dwarf alphasatellite, Milk vetch dwarf alphasatellite 2, Peanecrotic yellow dwarf alphasatellite 2, Sophora yellow stuntalphasatellite 4, Sophora yellow stunt alphasatellite 5,Subterranean clover stunt alphasatellite 2, Faba bean necroticyellows alphasatellite 2, Milk vetch dwarf alphasatellite 3, Fababean necrotic stunt alphasatellite, Milk vetch dwarf alphasatellite1, Pea necrotic yellow dwarf alphasatellite 1, Sophora yellow stuntalphasatellite 2, Cow vetch latent alphasatellite, Sophora yellowstunt alphasatellite 3, Faba bean necrotic yellows alphasatellite1, Faba bean necrotic yellows alphasatellite 3, Sophora yellowstunt alphasatellite 1, Subterranean clover stunt alphasatellite 1,Coconut foliar decay alphasatellite, Acidianus bottle-shaped virus,Torque teno virus 1, Torque teno virus 2, Torque teno virus 3,Torque teno virus 4, Torque teno virus 5, Torque teno virus 6,Torque teno virus 7, Torque teno virus 8, Torque teno virus 9,Torque teno virus 10, Torque teno virus 11, Torque teno virus 12,Torque teno virus 13, Torque teno virus 14, Torque teno virus 15,Torque teno virus 16, Torque teno virus 17, Torque teno virus 18,Torque teno virus 19, Torque teno virus 20, Torque teno virus 21,Torque teno virus 22, Torque teno virus 23, Torque teno virus 24,Torque teno virus 25, Torque teno virus 26, Torque teno virus 27,Torque teno virus 28, Torque teno virus 29, Torque teno mini virus1, Torque teno mini virus 2, Torque teno mini virus 3, Torque tenomini virus 4, Torque teno mini virus 5, Torque teno mini virus 6,Torque teno mini virus 7, Torque teno mini virus 8, Torque tenomini virus 9, Torque teno mini virus 10, Torque teno mini virus 11,Torque teno mini virus 12, Torque teno tupaia virus, Torque tenotamarin virus, Torque teno felis virus, Torque teno felis virus 2,Torque teno midi virus 1, Torque teno midi virus 2, Torque tenomidi virus 3, Torque teno midi virus 4, Torque teno midi virus 5,Torque teno midi virus 6, Torque teno midi virus 7, Torque tenomidi virus 8, Torque teno midi virus 9, Torque teno midi virus 10,Torque teno midi virus 11, Torque teno midi virus 12, Torque tenomidi virus 13, Torque teno midi virus 14, Torque teno midi virus15, Chicken anemia virus, Torque teno sus virus 1a, Torque teno susvirus 1b, Torque teno sus virus k2a, Torque teno sus virus k2b,Torque teno seal virus 1, Torque teno seal virus 2, Torque tenoseal virus 3, Torque teno seal virus 8, Torque teno seal virus 9,Torque teno zalophus virus 1, Torque teno equus virus 1, Torqueteno seal virus 4, Torque teno seal virus 5, Torque teno canisvirus, Torque teno douroucouli virus, Avocado sunblotch viroid,Eggplant latent viroid, Apple hammerhead viroid, Chrysanthemumchlorotic mottle viroid, Peach latent mosaic viroid, Adoxophyeshonmai nucleopolyhedrovirus, Agrotis ipsilon multiplenucleopolyhedrovirus, Agrotis segetum nucleopolyhedrovirus A,Agrotis segetum nucleopolyhedrovirus B, Antheraea pernyinucleopolyhedrovirus, Anticarsia gemmatalis multiplenucleopolyhedrovirus, Autographa californica multiplenucleopolyhedrovirus, Bombyx mori nucleopolyhedrovirus, Buzurasuppressaria nucleopolyhedrovirus, Catopsilia pomonanucleopolyhedrovirus, Choristoneura fumiferana DEF multiplenucleopolyhedrovirus, Choristoneura fumiferana multiplenucleopolyhedrovirus, Choristoneura murinana nucleopolyhedrovirus,Choristoneura rosaceana nucleopolyhedrovirus, Chrysodeixischalcites nucleopolyhedrovirus, Chrysodeixis includensnucleopolyhedrovirus, Clanis bilineata nucleopolyhedrovirus,Condylorrhiza vestigialis nucleopolyhedrovirus, Cryptophlebiapeltastica nucleopolyhedrovirus, Cyclophragma undansnucleopolyhedrovirus, Ectropis obliqua nucleopolyhedrovirus,Epiphyas postvittana nucleopolyhedrovirus, Euproctispseudoconspersa nucleopolyhedrovirus, Helicoverpa armigeranucleopolyhedrovirus, Hemileuca species nucleopolyhedrovirus,Hyphantria cunea nucleopolyhedrovirus, Hyposidra talacanucleopolyhedrovirus, Lambdina fiscellaria nucleopolyhedrovirus,Leucania separata nucleopolyhedrovirus, Lonomia obliquanucleopolyhedrovirus, Lymantria dispar multiplenucleopolyhedrovirus, Lymantria xylina nucleopolyhedrovirus,Mamestra brassicae multiple nucleopolyhedrovirus, Mamestraconfigurata nucleopolyhedrovirus A, Mamestra configuratanucleopolyhedrovirus B, Maruca vitrata nucleopolyhedrovirus,Mythimna unipuncta nucleopolyhedrovirus A, Mythimna unipunctanucleopolyhedrovirus B, Operophtera brumata nucleopolyhedrovirus,Orgyia leucostigma nucleopolyhedrovirus, Orgyia pseudotsugatamultiple nucleopolyhedrovirus, Oxyplax ochraceanucleopolyhedrovirus, Peridroma saucia nucleopolyhedrovirus,Perigonia lusca nucleopolyhedrovirus, Spodoptera eridanianucleopolyhedrovirus, Spodoptera exempta nucleopolyhedrovirus,Spodoptera exigua multiple nucleopolyhedrovirus, Spodopterafrugiperda multiple nucleopolyhedrovirus, Spodoptera littoralisnucleopolyhedrovirus, Spodoptera litura nucleopolyhedrovirus, Sucrajujuba nucleopolyhedrovirus, Thysanoplusia orichalceanucleopolyhedrovirus, Trichoplusia ni single nucleopolyhedrovirus,Urbanus proteus nucleopolyhedrovirus, Wiseana signatanucleopolyhedrovirus, Adoxophyes orana granulovirus, Agrotissegetum granulovirus, Artogeia rapae granulovirus, Choristoneurafumiferana granulovirus, Clostera anachoreta granulovirus, Closteraanastomosis granulovirus A, Clostera anastomosis granulovirus B,Cnaphalocrocis medinalis granulovirus, Cryptophlebia leucotretagranulovirus, Cydia pomonella granulovirus, Diatraea saccharalisgranulovirus, Epinotia aporema granulovirus, Erinnyis ellogranulovirus, Harrisina brillians granulovirus, Helicoverpaarmigera granulovirus, Lacanobia oleracea granulovirus, Mocislatipes granulovirus, Mythimna unipuncta granulovirus A, Mythimnaunipuncta granulovirus B, Phthorimaea operculella granulovirus,Plodia interpunctella granulovirus, Plutella xylostellagranulovirus, Spodoptera frugiperda granulovirus, Spodoptera lituragranulovirus, Trichoplusia ni granulovirus, Xestia c-nigrumgranulovirus, Culex nigripalpus nucleopolyhedrovirus, Neodiprionlecontei nucleopolyhedrovirus, Neodiprion sertifernucleopolyhedrovirus, Acidianus two-tailed virus, Aeropyrum pernixbacilliform virus 1, Flavobacterium virus FLiP, Sulfolobusspindle-shaped virus 1, Sulfolobus spindle-shaped virus 2,Sulfolobus spindle-shaped virus 4, Sulfolobus spindle-shaped virus5, Sulfolobus spindle-shaped virus 7, Sulfolobus spindle-shapedvirus 8, Sulfolobus spindle-shaped virus 9, Acidianusspindle-shaped virus 1, Sulfolobus spindle-shaped virus 6,Pyrobaculum spherical virus, Thermoproteus tenax spherical virus 1,Sulfolobus newzealandicus droplet-shaped virus, Aeropyrum pernixovoid virus 1, Salterprovirus His1, Glossina hytrosavirus, Muscahytrosavirus, White spot syndrome virus, Gryllus bimaculatusnudivirus, Oryctes rhinoceros nudivirus, Heliothis zea nudivirus,Sulfolobus ellipsoid virus 1, Acholeplasma virus L2, Apantelescrassicornis bracovirus, Apanteles fumiferanae bracovirus,Ascogaster argentifrons bracovirus, Ascogaster quadridentatabracovirus, Cardiochiles nigriceps bracovirus, Chelonus altitudinisbracovirus, Chelonus blackburni bracovirus, Chelonus inanitusbracovirus, Chelonus insularis bracovirus, Chelonus nearcurvimaculatus bracovirus, Chelonus texanus bracovirus, Cotesiacongregata bracovirus, Cotesia flavipes bracovirus, Cotesiaglomerata bracovirus, Cotesia hyphantriae bracovirus, Cotesiakariyai bracovirus, Cotesia marginiventris bracovirus, Cotesiamelanoscela bracovirus, Cotesia rubecula bracovirus, Cotesiaschaeferi bracovirus, Diolcogaster facetosa bracovirus,Glyptapanteles flavicoxis bracovirus, Glyptapanteles indiensisbracovirus, Glyptapanteles liparidis bracovirus, Hypomicrogastercanadensis bracovirus, Hypomicrogaster ectdytolophae bracovirus,Microplitis croceipes bracovirus, Microplitis demolitor bracovirus,Phanerotoma flavitestacea bracovirus, Pholetesor ornigisbracovirus, Protapanteles paleacritae bracovirus, Tranosemarostrale bracovirus, Campoletis aprilis ichnovirus, Campoletisflavicincta ichnovirus, Campoletis sonorensis ichnovirus, Casinariaarjuna ichnovirus, Casinaria forcipata ichnovirus, Casinariainfesta ichnovirus, Diadegma acronyctae ichnovirus, Diadegmainterruptum ichnovirus, Diadegma terebrans ichnovirus, Enytusmontanus ichnovirus, Eriborus terebrans ichnovirus, Glyptafumiferanae ichnovirus, Hyposoter annulipes ichnovirus, Hyposoterexiguae ichnovirus, Hyposoter fugitivus ichnovirus, Hyposoterlymantriae ichnovirus, Hyposoter pilosulus ichnovirus, Hyposoterrivalis ichnovirus, Olesicampe benefactor ichnovirus, Olesicampegeniculatae ichnovirus, Synetaeris tenuifemur ichnovirus,Alphaportoglobovirus SPV2, Sulfolobus alphaportoglobovirus 1, Appledimple fruit viroid, Apple scar skin viroid, Australian grapevineviroid, Citrus bent leaf viroid, Citrus dwarfing viroid, Citrusviroid V, Citrus viroid VI, Grapevine yellow speckle viroid 1,Grapevine yellow speckle viroid 2, Pear blister canker viroid,Citrus bark cracking viroid, Coconut cadang-cadang viroid, Coconuttinangaja viroid, Hop latent viroid,

Coleus blumei viroid 1, Coleus blumei viroid 2, Coleus blumeiviroid 3, Dahlia latent viroid, Hop stunt viroid, Chrysanthemumstunt viroid, Citrus exocortis viroid, Columnea latent viroid,Iresine viroid 1, Pepper chat fruit viroid, Potato spindle tuberviroid, Tomato apical stunt viroid, Tomato chlorotic dwarf viroid,Tomato planta macho viroid, Aeropyrum coil-shaped virus,Nitmarvirus NSV1, Ageratum leaf curl Buea betasatellite, Ageratumleaf curl Cameroon betasatellite, Ageratum yellow leaf curlbetasatellite, Ageratum yellow vein betasatellite, Ageratum yellowvein India betasatellite, Ageratum yellow vein Sri Lankabetasatellite, Alternanthera yellow vein betasatellite,Andrographis yellow vein leaf curl betasatellite, Bhendi yellowvein mosaic betasatellite, Cardiospermum yellow leaf curlbetasatellite, Chili leaf curl betasatellite, Chili leaf curlJaunpur betasatellite, Chili leaf curl Sri Lanka betasatellite,Cotton leaf curl Gezira betasatellite, Cotton leaf curl Multanbetasatellite, Croton yellow vein mosaic betasatellite, Eupatoriumyellow vein betasatellite, Eupatorium yellow vein mosaicbetasatellite, French bean leaf curl betasatellite, Hedyotis yellowmosaic betasatellite, Honeysuckle yellow vein betasatellite,Honeysuckle yellow vein mosaic betasatellite, Malvastrum leaf curlbetasatellite, Malvastrum leaf curl Guangdong betasatellite,Mirabilis leaf curl betasatellite, Momordica yellow mosaicbetasatellite, Mungbean yellow mosaic betasatellite, Okra leaf curlOman betasatellite, Papaya leaf curl betasatellite, Papaya leafcurl China betasatellite, Papaya leaf curl India betasatellite,Rhynchosia yellow mosaic betasatellite, Rose leaf curlbetasatellite, Siegesbeckia yellow vein betasatellite, Tobaccocurly shoot betasatellite, Tobacco leaf curl betasatellite, Tobaccoleaf curl Japan betasatellite, Tobacco leaf curl Patnabetasatellite, Tomato leaf curl Bangalore betasatellite, Tomatoleaf curl Bangladesh betasatellite, Tomato leaf curl betasatellite,Tomato leaf curl China betasatellite, Tomato leaf curl Gandhinagarbetasatellite, Tomato leaf curl Java betasatellite, Tomato leafcurl Joydebpur betasatellite, Tomato leaf curl Lagunabetasatellite, Tomato leaf curl Laos betasatellite, Tomato leafcurl Malaysia betasatellite, Tomato leaf curl Nepal betasatellite,Tomato leaf curl Patna betasatellite, Tomato leaf curl Philippinebetasatellite, Tomato leaf curl Sri Lanka betasatellite, Tomatoleaf curl Yemen betasatellite, Tomato yellow leaf curl Chinabetasatellite, Tomato yellow leaf curl Rajasthan betasatellite,Tomato yellow leaf curl Shandong betasatellite, Tomato yellow leafcurl Thailand betasatellite, Tomato yellow leaf curl Vietnambetasatellite, Tomato yellow leaf curl Yunnan betasatellite,Vernonia yellow vein betasatellite, Vernonia yellow vein Fujianbetasatellite, Croton yellow vein deltasatellite, Malvastrum leafcurl deltasatellite, Sida golden yellow vein deltasatellite 1, Sidagolden yellow vein deltasatellite 2, Sida golden yellow veindeltasatellite 3, Sweet potato leaf curl deltasatellite 1, Sweetpotato leaf curl deltasatellite 2, Sweet potato leaf curldeltasatellite 3, Tomato leaf curl deltasatellite, Tomato yellowleaf distortion deltasatellite 1, Tomato yellow leaf distortiondeltasatellite 2, Pyrobaculum filamentous virus 1, Thermoproteustenax virus 1, Hepatitis delta virus, Heterocapsa circularisquamaDNA virus 01, and Rhizidiomyces virus. Other viruses include theICTV Master species list(https://talk.ictvonline.org/files/master-species-lists/m/msl/9601),which is incorporated by reference herein.

Amino Acid and Nucleic Acid Sequences

[0418] Table 2 provides a summary of the amino acid and nucleicacid sequences.

TABLE-US-00002 TABLE 2 Summary of sequences SEQ ID NO TypeDescription 1 Amino Acid PspCas13b 2 Amino Acid PspCas13bTruncation 3 Amino Acid AspCas13b 4 Amino Acid AspCas13c 5 AminoAcid BmaCas13a 6 Amino Acid BzoCas13b 7 Amino Acid CamCas13a 8Amino Acid CcaCas13b 9 Amino Acid Cga2Cas13a 10 Amino AcidCgaCas13a 11 Amino Acid EbaCas13a 12 Amino Acid EreCas13a 13 AminoAcid EsCas13d 14 Amino Acid FbrCas13b 15 Amino Acid FnbCas13c 16Amino Acid FndCas13c 17 Amino Acid FnfCas13c 18 Amino AcidFnsCas13c 19 Amino Acid FpeCas13c 20 Amino Acid FulCas13c 21 AminoAcid HheCas13a 22 Amino Acid LbfCas13a 23 Amino Acid LbmCas13a 24Amino Acid LbnCas13a 25 Amino Acid LbuCas13a 26 Amino AcidLseCas13a 27 Amino Acid LshCas13a 28 Amino Acid LspCas13a 29 AminoAcid Lwa2Cas13a 30 Amino Acid LwaCas13a 31 Amino Acid LweCas13a 32Amino Acid PauCas13b 33 Amino Acid PbuCas13b 34 Amino AcidPgiCas13b 35 Amino Acid PguCas13b 36 Amino Acid Pin2Cas13b 37 AminoAcid Pin3Cas13b 38 Amino Acid PinCas13b 39 Amino Acid PprCas13a 40Amino Acid PsaCas13b 41 Amino Acid PsmCas13b 42 Amino AcidRanCas13b 43 Amino Acid RcdCas13a 44 Amino Acid RcrCas13a 45 AminoAcid RcsCas13a 46 Amino Acid UrCas13d 47 Amino Acid dPspCas13b 48Amino Acid dPspCas13b truncation 49 Amino Acid eGFP 50 Amino AcidmCherry 51 Amino Acid sfCHERRY(1-10) 52 Amino AcidsfCHERRY(1-10)-L-(11) 53 Amino Acid 7xS11 54 Amino Acid sfGFP 55Amino Acid sfGFP(1-10) 56 Amino Acid sfGFP(1-10)-L-(11) 57 AminoAcid Linker sequence 1 58 Amino Acid Linker sequence 2 59 AminoAcid Linker sequence 3 60 Amino Acid Linker sequence 4 61 AminoAcid Linker sequence 5 62 Amino Acid Linker sequence 6 63 AminoAcid Linker sequence 7 64 Amino Acid Linker sequence 8 65 AminoAcid Linker sequence 9 66 Amino Acid 3xFlag 67 Amino Acid Ty1 NLS68 Amino Acid Ty2 NLS 69 Amino Acid MAK11 70 Amino Acid 1xSV40 71Amino Acid 3xSV40 72 Amino Acid NPM 73 Amino Acid STH1 74 AminoAcid INO4 75 Amino Acid Nuclear Export Signal (NES) 76 Amino AcidNuclear Export Signal (NES) 77 Amino Acid N-terminal 1xMitochondrial Targeting Sequence 78 Amino Acid N-terminal 4xMitochondrial Targeting Sequence 79 Amino Acid N-terminal SecretorySignal Sequence (IL-2) 80 Amino Acid N-terminal Myristoylation(Membrane Targeting Sequence) 81 Amino Acid ER Localization -N-terminal Calsequestrin leader sequence 82 Amino Acid ERLocalization - C-terminal KDEL retention signal 83 Amino AcidC-terminal Peroxisome Targeting Sequence 84 Amino Acid HlightRGreen (Ty1) 85 Amino Acid HlightR Green (Ty2) 86 Amino Acid HlightRGreen (NES) 87 Amino Acid HlightR Green (NES) 88 Amino Acid HlightRGreen (N-terminal 1x Mitochondrial Targeting Sequence) 89 AminoAcid HlightR Green (N-terminal 4x Mitochondrial Targeting Sequence)90 Amino Acid HlightR Green (N-terminal Secretory Signal Sequence(IL-2)) 91 Amino Acid HlightR Green (N-terminal Myristoylation(Membrane Targeting Sequence)) 92 Amino Acid HlightR Green (ERLocalization - N-terminal Calsequestrin leader sequence) 93 AminoAcid HlightR Green (ER Localization - C-terminal KDEL retentionsignal) 94 Amino Acid HlightR Green (C-terminal PeroxisomeTargeting Sequence) 95 Amino Acid HlightR Green (Ty1) - short 96Amino Acid HlightR Green (Ty2) - short 97 Amino Acid HlightR Green(NES) - short 98 Amino Acid HlightR Green (NES) - short 99 AminoAcid HlightR Green (N-terminal 1x Mitochondrial Targeting Sequence)- short 100 Amino Acid HlightR Green (N-terminal 4x MitochondrialTargeting Sequence) - short 101 Amino Acid HlightR Green(N-terminal Secretory Signal Sequence (IL-2) - short 102 Amino AcidHlightR Green (N-terminal Myristoylation (Membrane TargetingSequence) - short 103 Amino Acid HlightR Green (ER Localization -N-terminal Calsequestrin leader sequence) - short 104 Amino AcidHlightR Green (ER Localization - C-terminal KDEL retention signal)- short 105 Amino Acid HlightR Green (C-terminal PeroxisomeTargeting Sequence) - short 106 Amino Acid HlightR Red 107 AminoAcid HlightR Red (Ty2) 108 Amino Acid HlightR Red (NES) 109 AminoAcid HlightR Red (NES) 110 Amino Acid HlightR Red (N-terminal 1xMitochondrial Targeting Sequence) 111 Amino Acid HlightR Red(N-terminal 4x Mitochondrial Targeting Sequence) 112 Amino AcidHlightR Red (N-terminal Secretory Signal Sequence (IL-2)) 113 AminoAcid HlightR Red (N-terminal Myristoylation (Membrane TargetingSequence)) 114 Amino Acid HlightR Red (ER Localization - N-terminalCalsequestrin leader sequence) 115 Amino Acid HlightR Red (ERLocalization - C-terminal KDEL retention signal) 116 Amino AcidHlightR Red (C-terminal Peroxisome Targeting Sequence) 117 AminoAcid HlightR Red (Ty1) - short 118 Amino Acid HlightR Red (Ty2) -short 119 Amino Acid HlightR Red (NES) - short 120 Amino AcidHlightR Red (NES) - short 121 Amino Acid HlightR Red (N-terminal 1xMitochondrial Targeting Sequence) - short 122 Amino Acid HlightRRed (N-terminal 4x Mitochondrial Targeting Sequence) - short 123Amino Acid HlightR Red (N-terminal Secretory Signal Sequence (IL-2)- short 124 Amino Acid HlightR Red (N-terminal Myristoylation(Membrane Targeting Sequence) - short 125 Amino Acid HlightR Red(ER Localization - N-terminal Calsequestrin leader sequence) -short 126 Amino Acid HlightR Red (ER Localization - C-terminal KDELretention signal) - short 127 Amino Acid HlightR Red (C-terminalPeroxisome Targeting Sequence) - short 128 Amino Acid HiLightR-S11129 Amino Acid HlightR-S11 (Ty2) 130 Amino Acid HlightR-S11 (NES)131 Amino Acid HlightR-S11 (NES) 132 Amino Acid HlightR-S11(N-terminal 1x Mitochondrial Targeting Sequence) 133 Amino AcidHlightR-S11 (N-terminal 4x Mitochondrial Targeting Sequence) 134Amino Acid HlightR-S11 (N-terminal Secretory Signal Sequence(IL-2)) 135 Amino Acid HlightR-S11 (N-terminal Myristoylation(Membrane Targeting Sequence)) 136 Amino Acid HlightR-S11 (ERLocalization - N-terminal Calsequestrin leader sequence) 137 AminoAcid HlightR-S11 (ER Localization - C-terminal KDEL retentionsignal) 138 Amino Acid HlightR-S11 (C-terminal Peroxisome TargetingSequence) 139 Amino Acid HiLightR-S11 (Ty1) - short 140 Amino AcidHlightR-S11 (Ty2) - short 141 Amino Acid HlightR-S11 (NES) - short142 Amino Acid HlightR-S11 (NES) - short 143 Amino Acid HlightR-S11(N-terminal 1x Mitochondrial Targeting Sequence) - short 144 AminoAcid HlightR-S11 (N-terminal 4x Mitochondrial Targeting Sequence) -short 145 Amino Acid HlightR-S11 (N-terminal Secretory SignalSequence (IL-2) - short 146 Amino Acid HlightR-S11 (N-terminalMyristoylation (Membrane Targeting Sequence) - short 147 Amino AcidHlightR-S11 (ER Localization - N-terminal Calsequestrin leadersequence) - short 148 Amino Acid HlightR-S11 (ER Localization -C-terminal KDEL retention signal) - short 149 Amino AcidHlightR-S11 (C-terminal Peroxisome Targeting Sequence) - short 150Amino Acid EraseR 151 Amino Acid EraseR (Ty2) 152 Amino Acid EraseR(NES) 153 Amino Acid EraseR (NES) 154 Amino Acid EraseR (N-terminal1x Mitochondrial Targeting Sequence) 155 Amino Acid EraseR(N-terminal 4x Mitochondrial Targeting Sequence) 156 Amino AcidEraseR (N-terminal Secretory Signal Sequence (IL-2)) 157 Amino AcidEraseR (N-terminal Myristoylation (Membrane Targeting Sequence))158 Amino Acid EraseR (ER Localization - N-terminal Calsequestrinleader sequence) 159 Amino Acid EraseR (ER Localization -C-terminal KDEL retention signal) 160 Amino Acid EraseR (C-terminalPeroxisome Targeting Sequence) 161 Amino Acid EraseR - Short 162Amino Acid EraseR (Ty2) - Short 163 Amino Acid EraseR (NES) - Short164 Amino Acid EraseR (NES) - Short 165 Amino Acid EraseR(N-terminal 1x Mitochondrial Targeting Sequence) - Short 166 AminoAcid EraseR (N-terminal 4x Mitochondrial Targeting Sequence) -Short 167 Amino Acid EraseR (N-terminal Secretory Signal Sequence(IL-2)) - Short 168 Amino Acid EraseR (N-terminal Myristoylation(Membrane Targeting Sequence)) - Short 169 Amino Acid EraseR (ERLocalization - N-terminal Calsequestrin leader sequence) - Short170 Amino Acid EraseR (ER Localization - C-terminal KDEL retentionsignal) - Short 171 Amino Acid EraseR (C-terminal PeroxisomeTargeting Sequence) - Short 172 Amino Acid SARS-CoV-2 Spike ProteinWild Type sequence 173 Amino Acid SARS-CoV-2 Spike Protein withC-terminal 27 aa deletion) 174 Amino Acid SARS-CoV-2 Spike Proteinwith HIV envelope membrane proximal sequence (S-H2) 175 Amino AcidSARS-CoV-2 Spike Protein with VSV-G envelope protein cytoplasmictail sequence 176 Amino Acid SARS-CoV-2 Spike Protein with HIVenvelope protein cytoplasmic tail 177 Amino Acid SARS-CoV-2 SpikeProtein with HIV transmembrane and cytoplasmic tail 178 Amino AcidSARS-CoV-2 Spike Protein with VSV-G transmembrane and cytoplasmictail sequence 179 Amino Acid SARS-CoV-1 Spike Protein (WT) 180Amino Acid SARS-CoV-1 Spike Protein N-term SP(CD5) and C-termtruncation (aka SARS-CoV- 1 4LV) 181 Amino Acid SARS-CoV-1 SpikeProtein N-term SP(CD5) and VSV-G transmembrane and cytoplasmic tail182 Amino Acid SARS-CoV-2 Spike Protein N-term SP(CD5) and C-termtruncation (aka SARS-CoV- 2 4LV) 183 Amino Acid SARS-CoV-2 SpikeProtein N-term SP(CD5) and VSV-G transmembrane and cytoplasmic tail184 Amino Acid VSV-G envelope protein for broad cell typetransduction 185 Amino Acid MBNL1

186 Amino Acid mCherry-MBNL 1 187 Amino Acid High SensitivityLuciferase Expression Cassette Contains protein degradationsequence (hCl1-pest fusion) at C-terminus 188 Nucleic AcidPspCas13b 189 Nucleic Acid PspCas13b Truncation 190 Nucleic AciddPspCas13b 191 Nucleic Acid dPspCas13b truncation 192 Nucleic AcideGFP 193 Nucleic Acid mCherry 194 Nucleic Acid 7xS11 195 NucleicAcid sfGFP 196 Nucleic Acid Linker sequence 1 197 Nucleic AcidLinker sequence 1 198 Nucleic Acid Linker sequence 2 199 NucleicAcid Linker sequence 3 200 Nucleic Acid 3xFlag 201 Nucleic Acid Ty1NLS 202 Nucleic Acid NES 203 Nucleic Acid Nuclear Export Signal(NES) 204 Nucleic Acid N-terminal 1x Mitochondrial TargetingSequence 205 Nucleic Acid N-terminal 4x Mitochondrial TargetingSequence 206 Nucleic Acid N-terminal Secretory Signal Sequence(IL-2) 207 Nucleic Acid N-terminal Myristoylation (MembraneTargeting Sequence) 208 Nucleic Acid ER Localization - N-terminalCalsequestrin leader sequence 209 Nucleic Acid ER Localization -C-terminal KDEL retention signal 210 Nucleic Acid C-terminalPeroxisome Targeting Sequence 211 Nucleic Acid HlightR Green (Ty1)212 Nucleic Acid HlightR Green (NES) 213 Nucleic Acid HlightR Green(NES) 214 Nucleic Acid HlightR Green (N-terminal 1x MitochondrialTargeting Sequence) 215 Nucleic Acid HlightR Green (N-terminal 4xMitochondrial Targeting Sequence) 216 Nucleic Acid HlightR Green(N-terminal Secretory Signal Sequence (IL-2)) 217 Nucleic AcidHlightR Green (N-terminal Myristoylation (Membrane TargetingSequence)) 218 Nucleic Acid HlightR Green (ER Localization -N-terminal Calsequestrin leader sequence) 219 Nucleic Acid HlightRGreen (ER Localization - C-terminal KDEL retention signal) 220Nucleic Acid HlightR Green (C-terminal Peroxisome TargetingSequence) 221 Nucleic Acid HlightR Green (Ty1) - short 222 NucleicAcid HlightR Green (NES) - short 223 Nucleic Acid HlightR Green(NES) - short 224 Nucleic Acid HlightR Green (N-terminal 1xMitochondrial Targeting Sequence) - short 225 Nucleic Acid HlightRGreen (N-terminal 4x Mitochondrial Targeting Sequence) - short 226Nucleic Acid HlightR Green (N-terminal Secretory Signal Sequence(IL-2) - short 227 Nucleic Acid HlightR Green (N-terminalMyristoylation (Membrane Targeting Sequence) - short 228 NucleicAcid HlightR Green (ER Localization - N-terminal Calsequestrinleader sequence) - short 229 Nucleic Acid HlightR Green (ERLocalization - C-terminal KDEL retention signal) - short 230Nucleic Acid HlightR Green (C-terminal Peroxisome TargetingSequence) - short 231 Nucleic Acid HlightR Red (Ty1) 232 NucleicAcid HlightR Red (NES) 233 Nucleic Acid HlightR Red (NES) 234Nucleic Acid HlightR Red (N-terminal 1x Mitochondrial TargetingSequence) 235 Nucleic Acid HlightR Red (N-terminal 4x MitochondrialTargeting Sequence) 236 Nucleic Acid HlightR Red (N-terminalSecretory Signal Sequence (IL-2)) 237 Nucleic Acid HlightR Red(N-terminal Myristoylation (Membrane Targeting Sequence)) 238Nucleic Acid HlightR Red (ER Localization - N-terminalCalsequestrin leader sequence) 239 Nucleic Acid HlightR Red (ERLocalization - C-terminal KDEL retention signal) 240 Nucleic AcidHlightR Red (C-terminal Peroxisome Targeting Sequence) 241 NucleicAcid HlightR Red (Ty1) - short 242 Nucleic Acid HlightR Red (NES) -short 243 Nucleic Acid HlightR Red (NES) - short 244 Nucleic AcidHlightR Red (N-terminal 1x Mitochondrial Targeting Sequence) -short 245 Nucleic Acid HlightR Red (N-terminal 4x MitochondrialTargeting Sequence) - short 246 Nucleic Acid HlightR Red(N-terminal Secretory Signal Sequence (IL-2) - short 247 NucleicAcid HlightR Red (N-terminal Myristoylation (Membrane TargetingSequence) - short 248 Nucleic Acid HlightR Red (ER Localization -N-terminal Calsequestrin leader sequence) - short 249 Nucleic AcidHlightR Red (ER Localization - C-terminal KDEL retention signal) -short 250 Nucleic Acid HlightR Red (C-terminal Peroxisome TargetingSequence) - short 251 Nucleic Acid HiLightR-S11 (Ty1) 252 NucleicAcid HlightR-S11 (NES) 253 Nucleic Acid HlightR-S11 (NES) 254Nucleic Acid HlightR-S11 (N-terminal 1x Mitochondrial TargetingSequence) 255 Nucleic Acid HlightR-S11 (N-terminal 4x MitochondrialTargeting Sequence) 256 Nucleic Acid HlightR-S11 (N-terminalSecretory Signal Sequence (IL-2)) 257 Nucleic Acid HlightR-S11(N-terminal Myristoylation (Membrane Targeting Sequence)) 258Nucleic Acid HlightR-S11 (ER Localization - N-terminalCalsequestrin leader sequence) 259 Nucleic Acid HlightR-S11 (ERLocalization - C-terminal KDEL retention signal) 260 Nucleic AcidHlightR-S11 (C-terminal Peroxisome Targeting Sequence) 261 NucleicAcid HiLightR-S11 (Ty1) - short 262 Nucleic Acid HlightR-S11 (NES)- short 263 Nucleic Acid HlightR-S11 (NES) - short 264 Nucleic AcidHlightR-S11 (N-terminal 1x Mitochondrial Targeting Sequence) -short 265 Nucleic Acid HlightR-S11 (N-terminal 4x MitochondrialTargeting Sequence) - short 266 Nucleic Acid HlightR-S11(N-terminal Secretory Signal Sequence (IL-2) - short 267 NucleicAcid HlightR-S11 (N-terminal Myristoylation (Membrane TargetingSequence) - short 268 Nucleic Acid HlightR-S11 (ER Localization -N-terminal Calsequestrin leader sequence) - short 269 Nucleic AcidHlightR-S11 (ER Localization - C-terminal KDEL retention signal) -short 270 Nucleic Acid HlightR-S11 (C-terminal Peroxisome TargetingSequence) - short 271 Nucleic Acid EraseR (Ty1) 272 Nucleic AcidEraseR (NES) 273 Nucleic Acid EraseR (NES) 274 Nucleic Acid EraseR(N-terminal 1x Mitochondrial Targeting Sequence) 275 Nucleic AcidEraseR (N-terminal 4x Mitochondrial Targeting Sequence) 276 NucleicAcid EraseR (N-terminal Secretory Signal Sequence (IL-2)) 277Nucleic Acid EraseR (N-terminal Myristoylation (Membrane TargetingSequence)) 278 Nucleic Acid EraseR (ER Localization - N-terminalCalsequestrin leader sequence) 279 Nucleic Acid EraseR (ERLocalization - C-terminal KDEL retention signal) 280 Nucleic AcidEraseR (C-terminal Peroxisome Targeting Sequence) 281 Nucleic AcidEraseR (Ty1) - short 282 Nucleic Acid EraseR (NES) - short 283Nucleic Acid EraseR (NES) - short 284 Nucleic Acid EraseR(N-terminal 1x Mitochondrial Targeting Sequence) - short 285Nucleic Acid EraseR (N-terminal 4x Mitochondrial TargetingSequence) - short 286 Nucleic Acid EraseR (N-terminal SecretorySignal Sequence (IL-2) - short 287 Nucleic Acid EraseR (N-terminalMyristoylation (Membrane Targeting Sequence) - short 288 NucleicAcid EraseR (ER Localization - N-terminal Calsequestrin leadersequence) - short 289 Nucleic Acid EraseR (ER Localization -C-terminal KDEL retention signal) - short 290 Nucleic Acid EraseR(C-terminal Peroxisome Targeting Sequence) - short 291 Nucleic AcidBzoCas13b crRNA direct repeat sequence 292 Nucleic Acid PbTCas13bcrRNA direct repeat sequence 293 Nucleic Acid PspCas13b crRNAdirect repeat sequence 294 Nucleic Acid PspCas13b crRNA directrepeat sequence T17C 295 Nucleic Acid PspCas13b crRNA direct repeatsequence T17A 296 Nucleic Acid PspCas13b crRNA direct repeatsequence TI7G 297 Nucleic Acid PspCas13b crRNA direct repeatsequence T18C 298 Nucleic Acid PspCas13b crRNA direct repeatsequence T18A 299 Nucleic Acid PspCas13b crRNA direct repeatsequence T18G 300 Nucleic Acid PspCas13b crRNA direct repeatsequence T19C 301 Nucleic Acid PspCas13b crRNA target sequenceCASx9 302 Nucleic Acid PspCas13b crRNA target sequence CASx9-f2 303Nucleic Acid PspCas13b crRNA target sequence CASx9-f3 304 NucleicAcid DMPK CUG Exp 305 Nucleic Acid CUG exp 306 Nucleic Acid CUGx17307 Nucleic Acid SARS-CoV-2 Leader Sequence 308 Nucleic AcidSARS-CoV-2 Leader crRNA Target A 309 Nucleic Acid SARS-CoV-2 LeadercrRNA Target B 310 Nucleic Acid SARS-CoV-2 Leader crRNA Target C311 Nucleic Acid SARS-CoV-2 Leader crRNA Target D 312 Nucleic AcidSARS-CoV-2 Leader crRNA Target E 313 Nucleic Acid SARS-CoV-2 LeadercrRNA Target F 314 Nucleic Acid SARS-CoV-2 Leader crRNA Target G315 Nucleic Acid SARS-2-CoV S2M sequence 316 Nucleic AcidSARS-2-CoV S2M crRNA Target A 317 Nucleic Acid SARS-2-CoV S2M crRNATarget B 318 Nucleic Acid SARS-2-CoV S2M crRNA Target C 319 NucleicAcid SARS-2-CoV S2M crRNA Target D 320 Nucleic Acid SARS-2-CoV S2McrRNA Target E 321 Nucleic Acid SARS-2-CoV S2M crRNA Target F 322Nucleic Acid Bovine Coronavirus Leader Sequence 323 Nucleic AcidSARS-CoV-2 3' Stem-loop II-like (S2M) Sequence 324 Nucleic AcidSARS-CoV-2 Nucleocapsid (N) Site A 325 Nucleic Acid SARS-CoV-2Nucleocapsid (N) Site B 326 Nucleic Acid SARS-CoV-2 Nucleocapsid(N) Site A Target 327 Nucleic Acid SARS-CoV-2 Nucleocapsid (N) SiteB Target 328 Nucleic Acid H1N1 Segment 1 crRNA target 329 NucleicAcid H3N2 Segment 1 crRNA target 330 Nucleic Acid H7N9 Segment 1crRNA target 331 Nucleic Acid H2N2 Segment 1 crRNA target 332Nucleic Acid H1N1 Segment 2 crRNA target 333 Nucleic Acid H3N2Segment 2 crRNA target 334 Nucleic Acid H7N9 Segment 2 crRNA target335 Nucleic Acid H2N2 Segment 2 crRNA target 336 Nucleic Acid H1N1Segment 3 crRNA target 337 Nucleic Acid H3N2 Segment 3 crRNA target338 Nucleic Acid H7N9 Segment 3 crRNA target 339 Nucleic Acid H2N2Segment 3 crRNA target 340 Nucleic Acid H1N1 Segment 5 crRNA target341 Nucleic Acid H3N2 Segment 5 crRNA target 342 Nucleic Acid H7N9Segment 5 crRNA target 343 Nucleic Acid H2N2 Segment 5 crRNA target344 Nucleic Acid H1N1 Segment 7 crRNA target 345 Nucleic Acid H3N2Segment 7 crRNA target 346 Nucleic Acid H7N9 Segment 7 crRNA target347 Nucleic Acid H2N2 Segment 7 crRNA target 348 Nucleic Acid CAGx9crRNA 349 Nucleic Acid LwCas13a CAG-F1 350 Nucleic Acid LwCas13aCAG-F2 351 Nucleic Acid LwCas13a CAG-F3 352 Nucleic Acid RfxCas13dCAG-F1 353 Nucleic Acid RfxCas13d CAG-F2 354 Nucleic Acid RfxCas13dCAG-F3 355 Nucleic Acid SARS-CoV-2 Leader Sequence 356 Nucleic AcidSARS-CoV-2 Leader crRNA A 357 Nucleic Acid SARS-CoV-2 Leader crRNAB 358 Nucleic Acid SARS-CoV-2 Leader crRNA C 359 Nucleic AcidSARS-CoV-2 Leader crRNA D 360 Nucleic Acid SARS-CoV-2 Leader crRNAE 361 Nucleic Acid SARS-CoV-2 Leader crRNA F 362 Nucleic AcidSARS-CoV-2 Leader crRNA G 363 Nucleic Acid SARS-CoV-2 S2M crRNA A364 Nucleic Acid SARS-CoV-2 S2M crRNA B 365 Nucleic Acid SARS-CoV-2S2M crRNA C 366 Nucleic Acid SARS-CoV-2 S2M crRNA D 367 NucleicAcid SARS-CoV-2 S2M crRNA E 368 Nucleic Acid SARS-CoV-2 S2M crRNA F369 Nucleic Acid SARS-CoV-2 Leader crRNA A 370 Nucleic AcidSARS-CoV-2 Leader crRNA B 371 Nucleic Acid SARS-CoV-2 Leader crRNAC 372 Nucleic Acid SARS-CoV-2 Leader crRNA D 373 Nucleic AcidSARS-CoV-2 Leader crRNA E 374 Nucleic Acid SARS-CoV-2 Leader crRNAF 375 Nucleic Acid SARS-CoV-2 Leader crRNA G 376 Nucleic Acid BCVLeader crRNA A 377 Nucleic Acid BCV Leader crRNA B 378 Nucleic AcidBCV Leader crRNA C 379 Nucleic Acid BCV Leader crRNA D 380 NucleicAcid BCV Leader crRNA E 381 Nucleic Acid BCV Leader crRNA F 382Nucleic Acid BCV Leader crRNA G 383 Nucleic Acid SARS-CoV-2 S2McrRNA A 384 Nucleic Acid SARS-CoV-2 S2M crRNA B

385 Nucleic Acid SARS-CoV-2 S2M crRNA C 386 Nucleic Acid SARS-CoV-2S2M crRNA D 387 Nucleic Acid SARS-CoV-2 S2M crRNA E 388 NucleicAcid SARS-CoV-2 S2M crRNA F 389 Nucleic Acid SARS-CoV-2 S2M crRNA G390 Nucleic Acid SARS-CoV-2 N crRNA A 391 Nucleic Acid SARS-CoV-2 NcrRNA B 392 Nucleic Acid Flu + sense vRNA Segment 1 crRNA 393Nucleic Acid Flu + sense vRNA Segment 2 crRNA 394 Nucleic Acid Flu+ sense vRNA Segment 3 crRNA 395 Nucleic Acid Flu + sense vRNASegment 5 crRNA 396 Nucleic Acid Flu + sense vRNA Segment 7 crRNA397 Nucleic Acid Flu (-) sense vRNA Segment 1 crRNA 398 NucleicAcid Flu (-) sense vRNA Segment 2 crRNA 399 Nucleic Acid Flu (-)sense vRNA Segment 3 crRNA 400 Nucleic Acid Flu (-) sense vRNASegment 5 crRNA 401 Nucleic Acid Flu (-) sense vRNA Segment 7 crRNA402 Nucleic Acid LDR-D/N-B/S2M-D crRNA array with DR loop mutations403 Nucleic Acid Positive-sense Five-crRNA Array sequence (Segmentorder 1-2-3-5-7) 404 Nucleic Acid Negative-sense Five-crRNA Arraysequence (Segment order: 2-1-3-5-7) 405 Nucleic Acid LentiviralTransfer Plasmid encoding Cytoplasmic PspCas13b and crRNA (hU6-crRNA cassette-EF1a core promoter-3xFlag-NES-PspCas13b-WPRE) 406Nucleic Acid Lentiviral Transfer Plasmid encoding Nuclear PspCas13band crRNA (hU6-crRNA cassette-EF1a corepromoter-3xFlag-TY1NLS-PspCas13b-WPRE) 407 Nucleic Acid Singleguide Lentiviral Gene Transfer Vector (LDR-D) 5'LTR-hU6-crRNA-CBH-3xFLAG-NES-PspCas13b-WPRE-3'SINLTR 408 Nucleic Acid Triple GuideLentiviral Gene Transfer Vector (LDR-D, N-B, S2M-D) 5'LTR-hU6-crRNAarray-CBH-3xFLAG-NES-PspCas13b-WPRE-3'SINLTR 409 Nucleic AcidTriple Guide AAV Viral Vector (LDR-D, N-B, S2M-D) 410 Nucleic AcidLuciferase Expression Cassette (SV40-5'UTR-Luc codingsequence-3'UTR-SV40 poly(A)) 411 Nucleic Acid Enhanced LuciferaseExpression Cassette (SV40 Promoter-5'UTR-Luciferase codingsequence-3'UTR-SV40 poly(A)-SV40 Enhancer) 412 Nucleic Acid SV40Promoter-5'UTR-Luciferase coding sequence-hCl1-PestUTR-SV40poly(A)- SV40 Enhancer 413 Nucleic Acid PspCas13b Luc-A 414 NucleicAcid PspCas13b Luc-B 415 Nucleic Acid LwCas13a Non-targeting crRNA416 Nucleic Acid LwCas13a Luc-A crRNA 417 Nucleic Acid LwCas13aLuc-B crRNA 418 Nucleic Acid RfxCas13d Non-targeting crRNA 419Nucleic Acid RfxCas13d Luc-A crRNA 420 Nucleic Acid RfxCas13d Luc-BcrRNA 421 Nucleic Acid Luciferase Reporter containing multipleSARS-CoV-2 Target Sequences (SV40promoter-5'UTR SARS-CoV-2 LeaderSequence-Luciferase hCl1-Pest-3'UTR SARS-CoV-2 N targetsequence-pA-SV40Enhancer) 422 Nucleic Acid MBNL1 423 Nucleic AcidmCherry-MBNL 1 424 Nucleic Acid pGL3P-DT12 Vector Sequence(SV40pro-Luciferase-human DMPK 3'UTR containing CUGx12) 425 NucleicAcid pGL3P-DT960 Vector Sequence (SV40pro-Luciferase-human DMPK3'UTR containing CUGx960) 426 Nucleic Acid EF1a-hACE2-Blast(EF1a-hACE2-BGHpA-SV40pro-Blasticidin-SV40pA) 427 Amino AcidTy1-like NLS O28090-0 428 Amino Acid Ty1-like NLS O50087-0 429Amino Acid Ty1-like NLS O58353-0 430 Amino Acid Ty1-like NLSQ57602-0 431 Amino Acid Ty1-like NLS Q6L1X9-0 432 Amino AcidTy1-like NLS A0K3M1-0 433 Amino Acid Ty1-like NLS A0LYZ1-0 434Amino Acid Ty1-like NLS A1B022-0 435 Amino Acid Ty1-like NLSA1V8A7-0 436 Amino Acid Ty1-like NLS AlVIP6-0 437 Amino AcidTy1-like NLS A2RDW6-0 438 Amino Acid Ty1-like NLS A2S7H2-0 439Amino Acid Ty1-like NLS A3MRV0-0 440 Amino Acid Ty1-like NLSA3NEI3-0 441 Amino Acid Ty1-like NLS A3P0B7-0 442 Amino AcidTy1-like NLS A4JAN6-0 443 Amino Acid Ty1-like NLS A4SUV7-0 444Amino Acid Ty1-like NLS A5FP03-0 445 Amino Acid Ty1-like NLSA5ILZ2-0 446 Amino Acid Ty1-like NLS A6GY20-0 447 Amino AcidTy1-like NLS A6LLI5-0 448 Amino Acid Ty1-like NLS A6LQX4-0 449Amino Acid Ty1-like NLS A8F6X2-0 450 Amino Acid Ty1-like NLSA8G6B7-0 451 Amino Acid Ty1-like NLS A9ADI9-0 452 Amino AcidTy1-like NLS A9IJ08-0 453 Amino Acid Ty1-like NLS A9IXA1-0 454Amino Acid Ty1-like NLS A9NEN2-0 455 Amino Acid Ty1-like NLSB0S140-0 456 Amino Acid Ty1-like NLS B1JU18-0 457 Amino AcidTy1-like NLS B1LBA1-0 458 Amino Acid Ty1-like NLS B1W354-0 459Amino Acid Ty1-like NLS B1XSP7-0 460 Amino Acid Ty1-like NLSB1YRC6-0 461 Amino Acid Ty1-like NLS B2JIH0-0 462 Amino AcidTy1-like NLS B2T755-0 463 Amino Acid Ty1-like NLS B2UEM3-0 464Amino Acid Ty1-like NLS B3PLU0-0 465 Amino Acid Ty1-like NLSB3R7T2-0 466 Amino Acid Ty1-like NLS B4E5B6-0 467 Amino AcidTy1-like NLS B4S3C9-0 468 Amino Acid Ty1-like NLS B7IHT4-0 469Amino Acid Ty1-like NLS B8E0X6-0 470 Amino Acid Ty1-like NLSB9K7W0-0 471 Amino Acid Ty1-like NLS C1A494-0 472 Amino AcidTy1-like NLS C5CE41-0 473 Amino Acid Ty1-like NLS O88058-0 474Amino Acid Ty1-like NLS P0DG92-0 475 Amino Acid Ty1-like NLSP0DG93-0 476 Amino Acid Ty1-like NLS P60554-0 477 Amino AcidTy1-like NLS P67354-0 478 Amino Acid Ty1-like NLS P75311-0 479Amino Acid Ty1-like NLS P75471-0 480 Amino Acid Ty1-like NLSP94372-0 481 Amino Acid Ty1-like NLS Q056Y0-0 482 Amino AcidTy1-like NLS Q057D7-0 483 Amino Acid Ty1-like NLS Q0AYB7-0 484Amino Acid Ty1-like NLS Q0BJ50-0 485 Amino Acid Ty1-like NLSQ0K610-0 486 Amino Acid Ty1-like NLS Q0STA4-0 487 Amino AcidTy1-like NLS Q0STL9-0 488 Amino Acid Ty1-like NLS Q0TQV7-0 489Amino Acid Ty1-like NLS Q0TR88-0 490 Amino Acid Ty1-like NLSQ12GX5-0 491 Amino Acid Ty1-like NLS Q13TG6-0 492 Amino AcidTy1-like NLS Q1AWG1-0 493 Amino Acid Ty1-like NLS Q1BRU4-0 494Amino Acid Ty1-like NLS Q1J5X5-0 495 Amino Acid Ty1-like NLSQ1JAY8-0 496 Amino Acid Ty1-like NLS QIJG57-0 497 Amino AcidTy1-like NLS Q1JL34-0 498 Amino Acid Ty1-like NLS Q1LI28-0 499Amino Acid Ty1-like NLS Q2L2H3-0 500 Amino Acid Ty1-like NLSQ2NIH1-0 501 Amino Acid Ty1-like NLS Q2SU23-0 502 Amino AcidTy1-like NLS Q39KH1-0 503 Amino Acid Ty1-like NLS Q3JMQ8-0 504Amino Acid Ty1-like NLS Q3YRL8-0 505 Amino Acid Ty1-like NLSQ46WD9-0 506 Amino Acid Ty1-like NLS Q48SQ4-0 507 Amino AcidTy1-like NLS Q49418-0 508 Amino Acid Ty1-like NLS Q56307-0 509Amino Acid Ty1-like NLS Q5LEQ4-0 510 Amino Acid Ty1-like NLSQ5WEJ7-0 511 Amino Acid Ty1-like NLS Q5XBA0-0 512 Amino AcidTy1-like NLS Q62GK1-0 513 Amino Acid Ty1-like NLS Q63Q07-0 514Amino Acid Ty1-like NLS Q64VP0-0 515 Amino Acid Ty1-like NLSQ6G3V1-0 516 Amino Acid Ty1-like NLS Q6G5M0-0 517 Amino AcidTy1-like NLS Q6LLQ8-0 518 Amino Acid Ty1-like NLS Q6MDC1-0 519Amino Acid Ty1-like NLS Q6MDH4-0 520 Amino Acid Ty1-like NLSQ6ME08-0 521 Amino Acid Ty1-like NLS Q73PH4-0 522 Amino AcidTy1-like NLS Q7MAD1-0 523 Amino Acid Ty1-like NLS Q7UP72-0 524Amino Acid Ty1-like NLS Q7VTD6-0 525 Amino Acid Ty1-like NLSQ7W2F9-0 526 Amino Acid Ty1-like NLS Q7WRC8-0 527 Amino AcidTy1-like NLS Q828D0-0 528 Amino Acid Ty1-like NLS Q895M9-0 529Amino Acid Ty1-like NLS Q8AAP0-0 530 Amino Acid Ty1-like NLSQ8D1X2-0 531 Amino Acid Ty1-like NLS Q8K908-0 532 Amino AcidTy1-like NLS Q8P0C9-0 533 Amino Acid Ty1-like NLS Q8XKR1-0 534Amino Acid Ty1-like NLS Q8XL46-0 535 Amino Acid Ty1-like NLSQ8XV09-0 536 Amino Acid Ty1-like NLS Q93Q47-0 537 Amino AcidTy1-like NLS Q9L0Q6-0 538 Amino Acid Ty1-like NLS Q9L0Q6-1 539Amino Acid Ty1-like NLS Q9L0Q6-2 540 Amino Acid Ty1-like NLSQ9L0Q6-3 541 Amino Acid Ty1-like NLS Q9L0Q6-4 542 Amino AcidTy1-like NLS Q9L0Q6-5 543 Amino Acid Ty1-like NLS Q9L0Q6-6 544Amino Acid Ty1-like NLS Q9X1S8-0 545 Amino Acid Ty1-like NLSA1CNV8-0 546 Amino Acid Ty1-like NLS A1D1R8-0 547 Amino AcidTy1-like NLS A1D731-0 548 Amino Acid Ty1-like NLS A2QAX7-0 549Amino Acid Ty1-like NLS A3LQ55-0 550 Amino Acid Ty1-like NLSA5DGY0-0 551 Amino Acid Ty1-like NLS A5DKW3-0 552 Amino AcidTy1-like NLS A5DLG8-0 553 Amino Acid Ty1-like NLS A5DY34-0 554Amino Acid Ty1-like NLS A6RBB0-0 555 Amino Acid Ty1-like NLSA6RMZ2-0 556 Amino Acid Ty1-like NLS A6ZL85-0 557 Amino AcidTy1-like NLS A6ZZJ1-0 558 Amino Acid Ty1-like NLS A7E4K0-0 559Amino Acid Ty1-like NLS G0S8I1-0 560 Amino Acid Ty1-like NLSO13527-0 561 Amino Acid Ty1-like NLS O13535-0 562 Amino AcidTy1-like NLS O13658-0 563 Amino Acid Ty1-like NLS O14064-0 564Amino Acid Ty1-like NLS O14076-0 565 Amino Acid Ty1-like NLSO42668-0 566 Amino Acid Ty1-like NLS O43068-0 567 Amino AcidTy1-like NLS O74777-0 568 Amino Acid Ty1-like NLS O74862-0 569Amino Acid Ty1-like NLS O94383-0 570 Amino Acid Ty1-like NLSO94487-0 571 Amino Acid Ty1-like NLS O94585-0 572 Amino AcidTy1-like NLS O94652-0 573 Amino Acid Ty1-like NLS P0C2I2-0 574Amino Acid Ty1-like NLS P0C2I3-0 575 Amino Acid Ty1-like NLSP0C2I5-0 576 Amino Acid Ty1-like NLS P0C2I6-0 577 Amino AcidTy1-like NLS P0C2I7-0 578 Amino Acid Ty1-like NLS P0C2I9-0 579Amino Acid Ty1-like NLS P0C2J0-0 580 Amino Acid Ty1-like NLSP0C2J1-0 581 Amino Acid Ty1-like NLS P0C2J3-0 582 Amino AcidTy1-like NLS P0C2J5-0 583 Amino Acid Ty1-like NLS P0CM98-0 584Amino Acid Ty1-like NLS P0CM99-0 585 Amino Acid Ty1-like NLSP0CX63-0 586 Amino Acid Ty1-like NLS P0CX64-0 587 Amino AcidTy1-like NLS P13902-0 588 Amino Acid Ty1-like NLS P14746-0 589Amino Acid Ty1-like NLS P20484-0 590 Amino Acid Ty1-like NLSP22936-0 591 Amino Acid Ty1-like NLS P25384-0 592 Amino AcidTy1-like NLS P32597-0 593 Amino Acid Ty1-like NLS P36006-0 594Amino Acid Ty1-like NLS P36080-0 595 Amino Acid Ty1-like NLSP38112-0 596 Amino Acid Ty1-like NLS P47098-0 597 Amino AcidTy1-like NLS P47100-0 598 Amino Acid Ty1-like NLS P51599-0 599Amino Acid Ty1-like NLS P53119-0 600 Amino Acid Ty1-like NLSP53123-0 601 Amino Acid Ty1-like NLS P53125-0 602 Amino AcidTy1-like NLS Q01301-0 603 Amino Acid Ty1-like NLS Q03434-0 604Amino Acid Ty1-like NLS Q03494-0 605 Amino Acid Ty1-like NLSQ03612-0 606 Amino Acid Ty1-like NLS Q03619-0 607 Amino AcidTy1-like NLS Q03707-0 608 Amino Acid Ty1-like NLS Q03855-0 609Amino Acid Ty1-like NLS Q04214-0 610 Amino Acid Ty1-like NLSQ04500-0

611 Amino Acid Ty1-like NLS Q04670-0 612 Amino Acid Ty1-like NLSQ04711-0 613 Amino Acid Ty1-like NLS Q06132-0 614 Amino AcidTy1-like NLS Q07163-0 615 Amino Acid Ty1-like NLS Q07509-0 616Amino Acid Ty1-like NLS Q07791-0 617 Amino Acid Ty1-like NLSQ07793-0 618 Amino Acid Ty1-like NLS Q09094-0 619 Amino AcidTy1-like NLS Q09180-0 620 Amino Acid Ty1-like NLS Q09180-1 621Amino Acid Ty1-like NLS Q09180-2 622 Amino Acid Ty1-like NLSQ09863-0 623 Amino Acid Ty1-like NLS Q0U8V9-0 624 Amino AcidTy1-like NLS Q12088-0 625 Amino Acid Ty1-like NLS Q12112-0 626Amino Acid Ty1-like NLS Q12113-0 627 Amino Acid Ty1-like NLSQ12141-0 628 Amino Acid Ty1-like NLS Q12193-0 629 Amino AcidTy1-like NLS Q12269-0 630 Amino Acid Ty1-like NLS Q12273-0 631Amino Acid Ty1-like NLS Q12316-0 632 Amino Acid Ty1-like NLSQ12337-0 633 Amino Acid Ty1-like NLS Q12339-0 634 Amino AcidTy1-like NLS Q12414-0 635 Amino Acid Ty1-like NLS Q12472-0 636Amino Acid Ty1-like NLS Q12490-0 637 Amino Acid Ty1-like NLSQ12491-0 638 Amino Acid Ty1-like NLS Q12501-0 639 Amino AcidTy1-like NLS Q1DNW5-0 640 Amino Acid Ty1-like NLS Q1EA54-0 641Amino Acid Ty1-like NLS Q2HFA6-0 642 Amino Acid Ty1-like NLSQ2HFA6-1 643 Amino Acid Ty1-like NLS Q2UQI6-0 644 Amino AcidTy1-like NLS Q4HZ42-0 645 Amino Acid Ty1-like NLS Q4P6I3-0 646Amino Acid Ty1-like NLS Q4WHF8-0 647 Amino Acid Ty1-like NLSQ4WRV2-0 648 Amino Acid Ty1-like NLS Q4WXQ7-0 649 Amino AcidTy1-like NLS Q5A2K0-0 650 Amino Acid Ty1-like NLS Q5A310-0 651Amino Acid Ty1-like NLS Q5ACW8-0 652 Amino Acid Ty1-like NLSQ5B6K3-0 653 Amino Acid Ty1-like NLS Q6BXL7-0 654 Amino AcidTy1-like NLS Q6C1L3-0 655 Amino Acid Ty1-like NLS Q6C233-0 656Amino Acid Ty1-like NLS Q6C2J1-0 657 Amino Acid Ty1-like NLSQ6C7C0-0 658 Amino Acid Ty1-like NLS Q6CJY0-0 659 Amino AcidTy1-like NLS Q6CJY0-1 660 Amino Acid Ty1-like NLS Q6FML5-0 661Amino Acid Ty1-like NLS Q75F02-0 662 Amino Acid Ty1-like NLSQ7S2A9-0 663 Amino Acid Ty1-like NLS Q7S9J4-0 664 Amino AcidTy1-like NLS Q7SFJ3-0 665 Amino Acid Ty1-like NLS Q875K1-0 666Amino Acid Ty1-like NLS Q8SUT1-0 667 Amino Acid Ty1-like NLSQ8SVI7-0 668 Amino Acid Ty1-like NLS Q8SVI7-1 669 Amino AcidTy1-like NLS Q92393-0 670 Amino Acid Ty1-like NLS Q99109-0 671Amino Acid Ty1-like NLS Q99231-0 672 Amino Acid Ty1-like NLSQ99337-0 673 Amino Acid Ty1-like NLS Q9USK2-0 674 Amino AcidTy1-like NLS Q9UTQ5-0 675 Amino Acid Ty1-like NLS A7MD48-0 676Amino Acid Ty1-like NLS O15446-0 677 Amino Acid Ty1-like NLSO15446-1 678 Amino Acid Ty1-like NLS O15446-2 679 Amino AcidTy1-like NLS O43148-0 680 Amino Acid Ty1-like NLS O60271-0 681Amino Acid Ty1-like NLS O75128-0 682 Amino Acid Ty1-like NLSO75400-0 683 Amino Acid Ty1-like NLS O75691-0 684 Amino AcidTy1-like NLS O75937-0 685 Amino Acid Ty1-like NLS O76021-0 686Amino Acid Ty1-like NLS O94964-0 687 Amino Acid Ty1-like NLSP23497-0 688 Amino Acid Ty1-like NLS P30414-0 689 Amino AcidTy1-like NLS P42081-0 690 Amino Acid Ty1-like NLS P46100-0 691Amino Acid Ty1-like NLS P51608-0 692 Amino Acid Ty1-like NLSP59797-0 693 Amino Acid Ty1-like NLS P82979-0 694 Amino AcidTy1-like NLS Q12830-0 695 Amino Acid Ty1-like NLS Q13409-0 696Amino Acid Ty1-like NLS Q13427-0 697 Amino Acid Ty1-like NLSQ15361-0 698 Amino Acid Ty1-like NLS Q15361-1 699 Amino AcidTy1-like NLS Q53SF7-0 700 Amino Acid Ty1-like NLS Q5M9Q1-0 701Amino Acid Ty1-like NLS Q5T3I0-0 702 Amino Acid Ty1-like NLSQ5T3I0-1 703 Amino Acid Ty1-like NLS Q68D10-0 704 Amino AcidTy1-like NLS Q6IPR3-0 705 Amino Acid Ty1-like NLS Q6PD62-0 706Amino Acid Ty1-like NLS Q6PD62-1 707 Amino Acid Ty1-like NLSQ6PD62-2 708 Amino Acid Ty1-like NLS Q6S8J7-0 709 Amino AcidTy1-like NLS Q6ZU65-0 710 Amino Acid Ty1-like NLS Q7Z7B0-0 711Amino Acid Ty1-like NLS Q8N9E0-0 712 Amino Acid Ty1-like NLSQ8NCU4-0 713 Amino Acid Ty1-like NLS Q8NFU7-0 714 Amino AcidTy1-like NLS Q96DY2-0 715 Amino Acid Ty1-like NLS Q96GD3-0 716Amino Acid Ty1-like NLS Q96P65-0 717 Amino Acid Ty1-like NLSQ96QC0-0 718 Amino Acid Ty1-like NLS Q9BQG0-0 719 Amino AcidTy1-like NLS Q9BQG0-1 720 Amino Acid Ty1-like NLS Q9BRU9-0 721Amino Acid Ty1-like NLS Q9H0S4-0 722 Amino Acid Ty1-like NLSQ9H6F5-0 723 Amino Acid Ty1-like NLS Q9HCK1-0 724 Amino AcidTy1-like NLS Q9HCK8-0 725 Amino Acid Ty1-like NLS Q9NPI1-0 726Amino Acid Ty1-like NLS Q9NSV4-0 727 Amino Acid Ty1-like NLSQ9NUL3-0 728 Amino Acid Ty1-like NLS Q9NWT1-0 729 Amino AcidTy1-like NLS Q9NX58-0 730 Amino Acid Ty1-like NLS Q9UGU5-0 731Amino Acid Ty1-like NLS Q9UNS1-0 732 Amino Acid Ty1-like NLSQ9Y2X3-0 733 Amino Acid Ty1-like NLS Q9Y6X0-0 734 Amino AcidTy1-like NLS A0A1I8M2I8-0 735 Amino Acid Ty1-like NLS A1XDC0-0 736Amino Acid Ty1-like NLS A7S6A5-0 737 Amino Acid Ty1-like NLSA8XI07-0 738 Amino Acid Ty1-like NLS A8XI07-1 739 Amino AcidTy1-like NLS C0HKU9-0 740 Amino Acid Ty1-like NLS C6KTD2-0 741Amino Acid Ty1-like NLS O16140-0 742 Amino Acid Ty1-like NLSO17828-0 743 Amino Acid Ty1-like NLS O17966-0 744 Amino AcidTy1-like NLS O44410-0 745 Amino Acid Ty1-like NLS O44410-1 746Amino Acid Ty1-like NLS O45244-0 747 Amino Acid Ty1-like NLSP0DP78-0 748 Amino Acid Ty1-like NLS P0DP78-1 749 Amino AcidTy1-like NLS P0DP79-0 750 Amino Acid Ty1-like NLS P0DP79-1 751Amino Acid Ty1-like NLS P0DP80-0 752 Amino Acid Ty1-like NLSP0DP80-1 753 Amino Acid Ty1-like NLS P0DP81-0 754 Amino AcidTy1-like NLS P0DP81-1 755 Amino Acid Ty1-like NLS P14196-0 756Amino Acid Ty1-like NLS P22058-0 757 Amino Acid Ty1-like NLSP26023-0 758 Amino Acid Ty1-like NLS P26991-0 759 Amino AcidTy1-like NLS P35978-0 760 Amino Acid Ty1-like NLS P46758-0 761Amino Acid Ty1-like NLS P46758-1 762 Amino Acid Ty1-like NLSP46867-0 763 Amino Acid Ty1-like NLS P54644-0 764 Amino AcidTy1-like NLS P54812-0 765 Amino Acid Ty1-like NLS P83212-0 766Amino Acid Ty1-like NLS Q04621-0 767 Amino Acid Ty1-like NLSQ08696-0 768 Amino Acid Ty1-like NLS Q08696-1 769 Amino AcidTy1-like NLS Q08696-2 770 Amino Acid Ty1-like NLS Q08696-3 771Amino Acid Ty1-like NLS Q08696-4 772 Amino Acid Ty1-like NLSQ08696-5 773 Amino Acid Ty1-like NLS Q08696-6 774 Amino AcidTy1-like NLS Q09223-0 775 Amino Acid Ty1-like NLS Q09595-0 776Amino Acid Ty1-like NLS Q1ELU8-0 777 Amino Acid Ty1-like NLSQ23120-0 778 Amino Acid Ty1-like NLS Q23272-0 779 Amino AcidTy1-like NLS Q24537-0 780 Amino Acid Ty1-like NLS Q27450-0 781Amino Acid Ty1-like NLS Q29DY1-0 782 Amino Acid Ty1-like NLSQ4N4T9-0 783 Amino Acid Ty1-like NLS Q54QQ2-0 784 Amino AcidTy1-like NLS Q54QQ2-1 785 Amino Acid Ty1-like NLS Q54S20-0 786Amino Acid Ty1-like NLS Q54US6-0 787 Amino Acid Ty1-like NLSQ54VU4-0 788 Amino Acid Ty1-like NLS Q54XP6-0 789 Amino AcidTy1-like NLS Q551H0-0 790 Amino Acid Ty1-like NLS Q557G1-0 791Amino Acid Ty1-like NLS Q55CE0-0 792 Amino Acid Ty1-like NLSQ61R02-0 793 Amino Acid Ty1-like NLS Q75JP5-0 794 Amino AcidTy1-like NLS Q8I5P7-0 795 Amino Acid Ty1-like NLS Q8I5P7-1 796Amino Acid Ty1-like NLS Q8IBP1-0 797 Amino Acid Ty1-like NLSQ8ILR9-0 798 Amino Acid Ty1-like NLS Q93591-0 799 Amino AcidTy1-like NLS Q95Y36-0 800 Amino Acid Ty1-like NLS Q9NBL2-0 801Amino Acid Ty1-like NLS Q9NDE8-0 802 Amino Acid Ty1-like NLSQ9NDE8-1 803 Amino Acid Ty1-like NLS Q9NDE8-2 804 Amino AcidTy1-like NLS Q9V5P6-0 805 Amino Acid Ty1-like NLS Q9VDS6-0 806Amino Acid Ty1-like NLS Q9VGW1-0 807 Amino Acid Ty1-like NLSQ9VH89-0 808 Amino Acid Ty1-like NLS Q9VKM6-0 809 Amino AcidTy1-like NLS Q9VNH1-0 810 Amino Acid Ty1-like NLS Q9W261-0 811Amino Acid Ty1-like NLS E1B7L7-0 812 Amino Acid Ty1-like NLSQ08DU1-0 813 Amino Acid Ty1-like NLS Q0III3-0 814 Amino AcidTy1-like NLS Q17QH9-0 815 Amino Acid Ty1-like NLS Q29S22-0 816Amino Acid Ty1-like NLS Q2KIQ2-0 817 Amino Acid Ty1-like NLSQ2KJE1-0 818 Amino Acid Ty1-like NLS Q2KJE1-1 819 Amino AcidTy1-like NLS Q2TBX7-0 820 Amino Acid Ty1-like NLS Q4R7K1-0 821Amino Acid Ty1-like NLS Q4R8Y5-0 822 Amino Acid Ty1-like NLSQ58DE2-0 823 Amino Acid Ty1-like NLS Q58DU0-0 824 Amino AcidTy1-like NLS Q5E9U4-0 825 Amino Acid Ty1-like NLS Q5NVM2-0 826Amino Acid Ty1-like NLS Q5R4V4-0 827 Amino Acid Ty1-like NLSQ5R8B0-0 828 Amino Acid Ty1-like NLS Q5RB69-0 829 Amino AcidTy1-like NLS Q5RCE6-0 830 Amino Acid Ty1-like NLS Q5TM61-0 831Amino Acid Ty1-like NLS Q767K9-0 832 Amino Acid Ty1-like NLSQ7YQM3-0 833 Amino Acid Ty1-like NLS Q7YQM4-0 834 Amino AcidTy1-like NLS Q7YR38-0 835 Amino Acid Ty1-like NLS Q95KD7-0 836Amino Acid Ty1-like NLS Q95LG8-0 837 Amino Acid Ty1-like NLSQ9N1Q7-0 838 Amino Acid Ty1-like NLS A2WSD3-0 839 Amino AcidTy1-like NLS A2XVF7-0 840 Amino Acid Ty1-like NLS A2XVF7-1 841Amino Acid Ty1-like NLS A2XVF7-2 842 Amino Acid Ty1-like NLSA2XVF7-3 843 Amino Acid Ty1-like NLS A3AVH5-0 844 Amino AcidTy1-like NLS A3AVH5-1 845 Amino Acid Ty1-like NLS A3AVH5-2 846Amino Acid Ty1-like NLS A3AVH5-3 847 Amino Acid Ty1-like NLSA4QJZ0-0 848 Amino Acid Ty1-like NLS A4QK78-0 849 Amino AcidTy1-like NLS A4QKG5-0 850 Amino Acid Ty1-like NLS A4QKQ3-0 851Amino Acid Ty1-like NLS A6MN03-0 852 Amino Acid Ty1-like NLSA8MS85-0 853 Amino Acid Ty1-like NLS A9XMT3-0 854 Amino AcidTy1-like NLS B8YIE8-0 855 Amino Acid Ty1-like NLS F4HVZ5-0 856Amino Acid Ty1-like NLS F4IQK5-0 857 Amino Acid Ty1-like NLSF4IQK5-1 858 Amino Acid Ty1-like NLS O22812-0 859 Amino AcidTy1-like NLS O49323-0 860 Amino Acid Ty1-like NLS O64571-0 861Amino Acid Ty1-like NLS O64639-0

862 Amino Acid Ty1-like NLS O64639-1 863 Amino Acid Ty1-like NLSO64639-2 864 Amino Acid Ty1-like NLS O65743-0 865 Amino AcidTy1-like NLS O81072-0 866 Amino Acid Ty1-like NLS P09975-0 867Amino Acid Ty1-like NLS P0C262-0 868 Amino Acid Ty1-like NLSP29345-0 869 Amino Acid Ty1-like NLS P50888-0 870 Amino AcidTy1-like NLS P51269-0 871 Amino Acid Ty1-like NLS P51430-0 872Amino Acid Ty1-like NLS Q06FP6-0 873 Amino Acid Ty1-like NLSQ06FP6-1 874 Amino Acid Ty1-like NLS Q06FP6-2 875 Amino AcidTy1-like NLS Q06R72-0 876 Amino Acid Ty1-like NLS Q06R98-0 877Amino Acid Ty1-like NLS Q1KVQ9-0 878 Amino Acid Ty1-like NLSQ1XDL7-0 879 Amino Acid Ty1-like NLS Q38873-0 880 Amino AcidTy1-like NLS Q3E8X3-0 881 Amino Acid Ty1-like NLS Q3ZJ77-0 882Amino Acid Ty1-like NLS Q42438-0 883 Amino Acid Ty1-like NLSQ4V3E0-0 884 Amino Acid Ty1-like NLS Q66GN2-0 885 Amino AcidTy1-like NLS Q6K5K2-0 886 Amino Acid Ty1-like NLS Q6YS30-0 887Amino Acid Ty1-like NLS Q84WK0-0 888 Amino Acid Ty1-like NLSQ84Y18-0 889 Amino Acid Ty1-like NLS Q8H991-0 890 Amino AcidTy1-like NLS Q8RWY7-0 891 Amino Acid Ty1-like NLS Q8RWY7-1 892Amino Acid Ty1-like NLS Q8VZ67-0 893 Amino Acid Ty1-like NLSQ8VZN4-0 894 Amino Acid Ty1-like NLS Q8W0K2-0 895 Amino AcidTy1-like NLS Q8W490-0 896 Amino Acid Ty1-like NLS Q9CAE4-0 897Amino Acid Ty1-like NLS Q9FMZ4-0 898 Amino Acid Ty1-like NLSQ9FMZ4-1 899 Amino Acid Ty1-like NLS Q9FRI0-0 900 Amino AcidTy1-like NLS Q9LKI5-0 901 Amino Acid Ty1-like NLS Q9LUJ5-0 902Amino Acid Ty1-like NLS Q9LUR0-0 903 Amino Acid Ty1-like NLSQ9LVU8-0 904 Amino Acid Ty1-like NLS Q9LVU8-1 905 Amino AcidTy1-like NLS Q9LYK7-0 906 Amino Acid Ty1-like NLS Q9M020-0 907Amino Acid Ty1-like NLS Q9M1L7-0 908 Amino Acid Ty1-like NLSQ9M3V8-0 909 Amino Acid Ty1-like NLS Q9SRQ3-0 910 Amino AcidTy1-like NLS Q9ZPV5-0 911 Amino Acid Ty1-like NLS B1AQJ2-0 912Amino Acid Ty1-like NLS D3ZUI5-0 913 Amino Acid Ty1-like NLSD4A666-0 914 Amino Acid Ty1-like NLS E1U8D0-0 915 Amino AcidTy1-like NLS G3V8T1-0 916 Amino Acid Ty1-like NLS O35821-0 917Amino Acid Ty1-like NLS O88487-0 918 Amino Acid Ty1-like NLSO88665-0 919 Amino Acid Ty1-like NLS P61364-0 920 Amino AcidTy1-like NLS P61365-0 921 Amino Acid Ty1-like NLS P83858-0 922Amino Acid Ty1-like NLS P83861-0 923 Amino Acid Ty1-like NLSQ00566-0 924 Amino Acid Ty1-like NLS Q05CL8-0 925 Amino AcidTy1-like NLS Q09XV5-0 926 Amino Acid Ty1-like NLS Q3TFK5-0 927Amino Acid Ty1-like NLS Q3TFK5-1 928 Amino Acid Ty1-like NLSQ3TFK5-2 929 Amino Acid Ty1-like NLS Q3TYA6-0 930 Amino AcidTy1-like NLS Q3UMF0-0 931 Amino Acid Ty1-like NLS Q498U4-0 932Amino Acid Ty1-like NLS Q4V7C4-0 933 Amino Acid Ty1-like NLSQ4V8G7-0 934 Amino Acid Ty1-like NLS Q505I5-0 935 Amino AcidTy1-like NLS Q562C7-0 936 Amino Acid Ty1-like NLS Q566R3-0 937Amino Acid Ty1-like NLS Q566R3-1 938 Amino Acid Ty1-like NLSQ566R3-2 939 Amino Acid Ty1-like NLS Q58A65-0 940 Amino AcidTy1-like NLS Q5NBX1-0 941 Amino Acid Ty1-like NLS Q5XG71-0 942Amino Acid Ty1-like NLS Q5XI01-0 943 Amino Acid Ty1-like NLSQ5XIB5-0 944 Amino Acid Ty1-like NLS Q5XIR6-0 945 Amino AcidTy1-like NLS Q60848-0 946 Amino Acid Ty1-like NLS Q62018-0 947Amino Acid Ty1-like NLS Q62018-1 948 Amino Acid Ty1-like NLSQ62187-0 949 Amino Acid Ty1-like NLS Q62871-0 950 Amino AcidTy1-like NLS Q63520-0 951 Amino Acid Ty1-like NLS Q642C0-0 952Amino Acid Ty1-like NLS Q68SB1-0 953 Amino Acid Ty1-like NLSQ6AYK5-0 954 Amino Acid Ty1-like NLS Q6NZB0-0 955 Amino AcidTy1-like NLS Q76KJ5-0 956 Amino Acid Ty1-like NLS Q76KJ5-1 957Amino Acid Ty1-like NLS Q76KJ5-2 958 Amino Acid Ty1-like NLSQ78WZ7-0 959 Amino Acid Ty1-like NLS Q78WZ7-1 960 Amino AcidTy1-like NLS Q7TNB4-0 961 Amino Acid Ty1-like NLS Q7TPV4-0 962Amino Acid Ty1-like NLS Q80WC1-0 963 Amino Acid Ty1-like NLSQ80Z37-0 964 Amino Acid Ty1-like NLS Q811R2-0 965 Amino AcidTy1-like NLS Q8BKA3-0 966 Amino Acid Ty1-like NLS Q8CJ67-0 967Amino Acid Ty1-like NLS Q8K214-0 968 Amino Acid Ty1-like NLSQ8K4T4-0 969 Amino Acid Ty1-like NLS Q8R5F3-0 970 Amino AcidTy1-like NLS Q91X13-0 971 Amino Acid Ty1-like NLS Q9CS72-0 972Amino Acid Ty1-like NLS Q9CVI2-0 973 Amino Acid Ty1-like NLSQ9CWX9-0 974 Amino Acid Ty1-like NLS Q9CZX5-0 975 Amino AcidTy1-like NLS Q9D1J3-0 976 Amino Acid Ty1-like NLS Q9D3V1-0 977Amino Acid Ty1-like NLS Q9DBQ9-0 978 Amino Acid Ty1-like NLSQ9JIX5-0 979 Amino Acid Ty1-like NLS Q9JJ80-0 980 Amino AcidTy1-like NLS Q9JJ89-0 981 Amino Acid Ty1-like NLS Q9R1C7-0 982Amino Acid Ty1-like NLS Q9R1X4-0 983 Amino Acid Ty1-like NLSQ9Z180-0 984 Amino Acid Ty1-like NLS Q9Z207-0 985 Amino AcidTy1-like NLS Q9Z2D6-0 986 Amino Acid Ty1-like NLS A0A1L8GSA2-0 987Amino Acid Ty1-like NLS A0JP82-0 988 Amino Acid Ty1-like NLSA1A5I1-0 989 Amino Acid Ty1-like NLS A1L2T6-0 990 Amino AcidTy1-like NLS A2RUV0-0 991 Amino Acid Ty1-like NLS A9JRD8-0 992Amino Acid Ty1-like NLS E7F568-0 993 Amino Acid Ty1-like NLSF1QFU0-0 994 Amino Acid Ty1-like NLS F1QWK4-0 995 Amino AcidTy1-like NLS K9JHZ4-0 996 Amino Acid Ty1-like NLS P07193-0 997Amino Acid Ty1-like NLS P0CB65-0 998 Amino Acid Ty1-like NLSP12957-0 999 Amino Acid Ty1-like NLS P13505-0 1000 Amino AcidTy1-like NLS P21783-0 1001 Amino Acid Ty1-like NLS Q28BS0-0 1002Amino Acid Ty1-like NLS Q28BS0-1 1003 Amino Acid Ty1-like NLSQ28G05-0 1004 Amino Acid Ty1-like NLS Q32N87-0 1005 Amino AcidTy1-like NLS Q3KPW4-0 1006 Amino Acid Ty1-like NLS Q4QR29-0 1007Amino Acid Ty1-like NLS Q4QR29-1 1008 Amino Acid Ty1-like NLSQ5BL56-0 1009 Amino Acid Ty1-like NLS Q5XJK9-0 1010 Amino AcidTy1-like NLS Q5ZIJ0-0 1011 Amino Acid Ty1-like NLS Q640I9-0 1012Amino Acid Ty1-like NLS Q6DEU9-0 1013 Amino Acid Ty1-like NLSQ6DEU9-1 1014 Amino Acid Ty1-like NLS Q6DEU9-2 1015 Amino AcidTy1-like NLS Q6DK85-0 1016 Amino Acid Ty1-like NLS Q6DRI7-0 1017Amino Acid Ty1-like NLS Q6DRL5-0 1018 Amino Acid Ty1-like NLSQ6NV26-0 1019 Amino Acid Ty1-like NLS Q6NWI1-0 1020 Amino AcidTy1-like NLS Q6NYJ3-0 1021 Amino Acid Ty1-like NLS Q6P4K1-0 1022Amino Acid Ty1-like NLS Q6WKW9-0 1023 Amino Acid Ty1-like NLSQ7ZUF2-0 1024 Amino Acid Ty1-like NLS Q7ZW47-0 1025 Amino AcidTy1-like NLS Q7ZXZ0-0 1026 Amino Acid Ty1-like NLS Q7ZXZ0-1 1027Amino Acid Ty1-like NLS Q7ZYR8-0 1028 Amino Acid Ty1-like NLSQ8AVQ6-0 1029 Amino Acid Ty1-like NLS Q9DE07-0 1030 Amino AcidTy1-like NLS P03086-0 1031 Amino Acid Ty1-like NLS P09814-0 1032Amino Acid Ty1-like NLS P0CK10-0 1033 Amino Acid Ty1-like NLSP15075-0 1034 Amino Acid Ty1-like NLS P51724-0 1035 Amino AcidTy1-like NLS P52344-0 1036 Amino Acid Ty1-like NLS P52531-0 1037Amino Acid Ty1-like NLS Q5UP41-0 1038 Amino Acid Ty1-like NLSQ9DUC0-0 1039 Amino Acid Ty1-like NLS Q9XJS3-0

EXPERIMENTAL EXAMPLES

[0419] The invention is further described in detail by reference tothe following experimental examples. These examples are providedfor purposes of illustration only and are not intended to belimiting unless otherwise specified. Thus, the invention should inno way be construed as being limited to the following examples, butrather, should be construed to encompass any and all variationswhich become evident as a result of the teaching providedherein.

[0420] Without further description, it is believed that one ofordinary skill in the art can, using the preceding description andthe following illustrative examples, make and utilize the presentinvention and practice the claimed methods. The following workingexamples, therefore, specifically point out certain embodiments ofthe present invention, and are not to be construed as limiting inany way the remainder of the disclosure.

Example 1: Targeting Toxic Nuclear RNA Foci by CRISPR-Cas13

[0421] The data presented herein demonstrates that RNA-bindingCRISPR-Cas13, with a robust non-classical nuclear localizationsignal, can be efficiently targeted to toxic nuclear RNA foci foreither visualization or cleavage, approaches termed herein hilightRand eraseR, respectively. HilightR combines catalytically deadCas13b (dCas13) with a fluorescent protein to directly visualizeCUG repeat RNA foci in the nucleus of live cells, allowing forquantification of foci number and observation of foci dynamics.EraseR utilizes the intrinsic endoribonuclease activity of Cas13b,targeted to nuclear CUG repeat RNA, to disrupt nuclear foci. Thesestudies demonstrate the potential for targeting toxic nuclear RNAfoci directly with CRISPR-Cas13 for either the identification ortreatment of Myotonic Dystrophy Type 1. The efficient and sequenceprogrammable nature of CRISPR-Cas13 systems allows for rapidtargeting and manipulation of other human nuclear RNA disorders,without the associated risks of genome editing.

[0422] Bacterial derived CRISPR-Cas13 systems bind specifically toRNA and function as endoribonucleases to cleave RNA, bypassing therisk of germline editing that is associated with DNA-bindingCRISPR-Cas endonucleases. Single residue mutations within the twonuclease domains of Cas13 generate a catalytically deactivatedenzyme (dCas13), which retains programmable RNA binding affinity inmammalian systems without the requirement for PAM sequences forefficient targeting. Due to their large size and lack of intrinsiclocalization signals, both Cas9 and Cas13 fusion proteins areinefficiently localized to the mammalian nucleus. In our recentpre-print manuscript describing a novel adaptation of CRISPR-Cas13for inducing targeted cleavage and polyadenylation of RNA, anon-classical nuclear localization signal (NLS) derived from theyeast Ty1 retrotransposon was identified which promotes robustnuclear localization of Cas13. The powerful activity of the Ty1 NLSsuggested that efficient targeting of nuclear RNAs could beachieved for both visualization and cleavage with CRISPR-Cas13.

[0423] Toxic RNA foci are the cellular hallmark of DM1. Tovisualize nuclear RNAs using CRISPR-Cas13, a fusion protein wasdesigned combining the catalytically dead Type VI-B Cas13b enzymefrom Prevotella sp. P5-125 (dPspCas13b) with either a C-terminalenhanced Green Fluorescent Protein (eGFP) or red fluorescentprotein, mCherry (FIG. 1A). A 3.times.FLAG epitope tag (F) and Ty1nuclear localization sequence (Ty1 NLS) were added to theN-terminus of the dPspCas13b fusion proteins to promote efficientnuclear localization, hereinafter referred to as hilightR green orhilightR red (FIG. 1A). Toxic RNA foci are the cellular hallmark ofDM1 and can be induced in many cell types by the expression oftransgenes expressing expanded CUG repeats. To mimic the nuclearRNA foci found in patients with DM1, a vector containing 960 CUGrepeats in the human DMPK 3' UTR (DT960) was utilized (FIG. 1B).The DT960 construct is sufficient to recapitulate RNA fociformation in cells and can be detected by Fluorescent In SituHybridization (FISH) using an antisense (CAG) repeat probe or withan mCherry-MBNL1 fusion protein (FIG. 1A and FIG. 1B). To targethilightR fusion proteins to CUG repeats, a PspCas13b-compatiblecrRNA containing an antisense CAG repeat target sequence (CAGx9)was designed, which is predicted to hybridize with 9 CUG repeats(FIG. 1C). Guided by the CAGx9 repeat crRNA, hilightR green and redwere completely nuclear localized and highlighted nuclear RNA focigenerated by the DT960 vector (FIG. 1D and FIG. 4). In contrast,co-expression of hilightR constructs with a non-targeting crRNAresulted in broad, un-localized nuclear fluorescence (FIG. 1D andFIG. 1C).

[0424] Nuclear foci labeled with hilightR green co-localized withan Alexa Fluor 488-conjugated CAG oligonucleotide probe(AF488-CAGx7), detected using FISH (FIG. 2A). Consistent withprevious reports, nuclear foci labeled with hilightR greenco-localized with MBNL1 protein, detected using an mCherry-MBNL1fusion protein, and partially co-localized with splicing speckles,detected with an antibody specific for SC-35 (FIG. 2B and FIG. 5).These results demonstrate that hilightR accurately detectsCUG.sup.exp RNA foci.

[0425] CUG.sup.exp RNA foci suggested it could be a useful fortargeted cleavage of toxic CUG.sup.exp RNA, using its inherentendoribonuclease activity. Cas13 has been shown to be useful forspecific cleavage of mRNA transcripts in mammalian and plant cells.To determine if Cas13 endoribonuclease activity is sufficient tocleave CUG.sup.exp RNA foci, the hilightR green fusion protein wasmodified by reactivating PspCas13b's catalytic mutations using sitedirected mutagenesis. Surprisingly, activated hilightR green didnot significantly reduce the number of RNA foci using the CAGx9targeting crRNA, compared with a non-targeting guide-RNA. However,activated PspCas13b containing the N-terminal Ty1 NLS, but lackingthe C-terminal eGFP (herein referred to as eraseR), resulted in asignificant reduction in the number and intensity of RNA foci,quantified using an mCherry-MNBL1 fusion protein (FIG. 3A and FIG.3B). Since target site flanking sequences can influence Cas13nuclease activation, CAGx9 crRNAs were tested in two other readingframes (CAGx9-f2 and CAGx9-f3). EraseR guided by all three CAGx9crRNAs resulted in significant reduction in the number andintensity of RNA foci per cell, compared to a non-targeting crRNA(FIG. 3A and FIG. 3B). Additionally, catalytically dead PspCas13bcontaining an N-terminal Ty1 NLS and lacking the C-terminal eGFPdid not significantly reduce the number and intensity of RNA foci,quantified using an mCherry-MNBL1 fusion protein (FIG. 6). Thesedate demonstrate for the first time that CRISPR-Cas13 is sufficientto degrade CUG.sup.exp RNA foci.

[0426] While there are currently no available therapeutictreatments for Myotonic Dystrophies or other human RNA repeatexpansion disorders, the rapid progression of RNA-targetingCRISPR-Cas systems offer hope that targeted approaches to treat DM1will soon be achievable. While ASOs are highly efficient fordisrupting the binding between splicing factors and toxic RNA foci,these approaches are currently limited by inadequate deliverymethods. Additionally, gene therapy approaches to restore DMPK orMBNL expression are insufficient to rescue the dominant cytotoxicgain of function deficits which occur as the result of CUG.sup.expRNAs. Thus, targeted disruption of CUG RNAs is a promising strategyto reduce or prevent RNA induced disease. It is demonstrated hereinthat CRISPR-Cas13, localized by a powerful non-classical Ty1 NLS,can be used to efficiently target CUG.sup.exp RNA foci for bothvisualization and targeted degradation. The Ty1 NLS is derived froma yeast LTR-retrotransposon, which uses reverse transcription of anRNA intermediate in the cytoplasm followed by integration of aproviral DNA copy in the nucleus for genome replication. As opposedto higher eukaryotes which undergo open mitosis during celldivision, yeast undergo closed mitosis, during which the nuclearenvelope remains intact. During Ty1 biogenesis, nuclear import ofthe retrotransposon genome complex requires active nuclear importand thus contains a robust NLS which is required forretrotransposition. Interestingly, in the quiescent mammalian cellswhich retain a nuclear envelope, the Ty1 NLS may be similarlyrequired for efficient targeting of nuclear RNAs by Casproteins.

[0427] The programmable nature of CRISPR-Cas13, through simplemodification of crRNA target sequences, allow hilightR and eraseRto be easily adapted for the study and cleavage of other nuclearRNAs, or other repeat expansion disorders such as MyotonicDystrophy type 2 (DM2), Amyotrophic lateral sclerosis (ALS),Huntington's disease-like 2 (HDL2), Spinocerebellar ataxias 8, 31and 10 (SCAB, -31, -10) and fragile X-associated tremor ataxiasyndrome (FXTAS). As with other systems (ASO or CRISPR-Cas) whichdirectly target short tandem repeat sequences, there remainspotential for off-target cleavage of other human mRNA transcriptswhich contain non-pathogenic short repeat motifs. Alternatively,targeting unique DMPK sequences for degradation or by other formsof RNA manipulation of microsatellite RNAs with CRISPR-Cas13 fusionproteins may offer additional approaches for the treatment of toxicRNA diseases.

[0428] The materials and methods are now described.

[0429] Synthetic DNA and Cloning

[0430] The mammalian expression vector containing an N-terminal3.times.FLAG and Ty1 NLS fused to dPspCas13b was modified to encodea C-terminal enhanced Green Fluorescent Protein (eGFP) or mCherryred fluorescent protein. All crRNAs were designed to be 30nucleotides in length and start with a 5' G for efficienttranscription from the hU6 promoter in pC00043. The negativecontrol non-targeting crRNA has been previous described. Togenerate the mCherry-MBNL expression plasmid, the coding sequenceof human MBNL1 was designed and synthesized for assembly as agBlock (IDT, Integrated DNA Technologies) and cloned into theCS2mCherry mammalian expression plasmid.

[0431] Cell Culture and Immunohistochemistry

[0432] The COS7 cell line was maintained in DMEM supplemented with10% Fetal Bovine Serum (FBS) with penicillin/streptomycin at37.degree. C. in an atmosphere of 5% CO.sub.2. Cells were seeded onglass coverslips in 6-well plates and transiently transfected usingFugene6 (Promega) according to manufacturer's protocol. Transientlytransfected COS7 cells were fixed in 4% formaldehyde in DPBS for 15minutes, blocked in 3% Bovine Serum Albumin (BSA) and incubatedwith primary antibodies in 1% BSA for 4 hours at room temperature.Primary antibodies used were anti-FLAG (Sigma, F1864) at 1:1000 andanti-SC-35 (Abcam, ab11826) at 1:1000. Cells were subsequentlyincubated with an Alexa Fluor 488 or 594 conjugated secondaryantibody (Thermofisher) in 1% BSA for 30 minutes at roomtemperature. Coverslips were mounted using anti-fade fluorescentmounting medium containing DAPI (Vector Biolabs, H-1200) and imagedusing confocal microscopy.

[0433] Fluorescent In Situ Hybridization (FISH)

[0434] Post-transfection, cells were fixed in ice cold 100%Methanol for 10 minutes at -20.degree. C., then washed 2 times withDPBS and 1 time with Wash Buffer [2.times.SSC pH 7.0, 10%Formamide]. Cells were subsequently hybridized with probe inHybridization Buffer [10% Dextran Sulfate, 2.times.SSC pH7.0, 10%Formamide] with a final probe concentration of 100 nM. Cells werehybridized overnight at 37.degree. C. Cells were then washed onetime in Wash Buffer at 37.degree. C. for 30 minutes, then mountedwith VectaShield with DAPI (Vector Biolabs) on slides and imagedusing confocal microscopy. The probe was a 21-mer DNAoligonucleotide (CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO:303)) conjugatedwith a 5' Alexa Fluor 488 dye and purified using HPLC (IDT,Integrated DNA Technologies).

Example 2: Targeted Degradation of CUGexp RNA with Eraser

[0435] Myotonic dystrophy type 1 (DM1) is an inheritedmulti-system, progressively debilitating disease occurring in 1 in8,000 individuals, with an incidence as high as 1 in 500 inspecific populations Cardiac complications develop in .about.80% ofDM1 patients and is the primary cause of death. DM1 arises from theexpansion and expression of a CUG trinucleotide repeat in thenoncoding 3' untranslated region of the human Dystrophia myotonicaprotein kinase (DMPK) gene (FIG. 8). Mutant DMPK mRNAs with greaterthan .about.50 CUG repeats form toxic nuclear RNA foci, whichprevent normal DMPK expression and induce widespread defects inalternative splicing by sequestering members of themuscleblind-like (MBNL) family of RNA binding proteins (FIG. 8).Due to the multitude of disrupted muscle genes underlying DM1pathogenesis, patients often present with a variety of clinicalcardiac phenotypes, including atrial and ventricular arrhythmias,dilated cardiomyopathy, and myocardial fibrosis. There arecurrently no approved therapies to treat DM1, and previousapproaches to target repeat foci using anti-sense oligonucleotides(ASOs) remain challenging due to inefficient delivery to adulthuman cardiac and skeletal muscle.

[0436] As demonstrated in Example 1 RNA binding CRISPR-Cas13, whenlocalized with a robust non-classical nuclear localization signal,can be used to visualize and degrade toxic nuclear RNA foci incells, tools named hilightR and eraseR (FIG. 8). CRISPR-Castechnologies offer hope that targeted therapeutics can be developedfor treatment of human RNA diseases, which cannot be correctedusing traditional gene therapy replacement strategies. However, itremains unclear if degradation of toxic RNA foci is sufficient toprevent DM1 pathogenesis in the heart or if DM1-associated cellularand electrical remodeling is reversible. Targeted degradation oftoxic RNA foci with eraseR in a mouse cardiac model of DM1 improvescardiac gene expression and pump function by restoring normal RNAsplicing (FIG. 8). As described herein eraseR is developed as anefficient and specific tool for disrupting CUG.sup.exp RNA in vivoand determine the therapeutic outcomes using eraseR in a mousecardiac model of DM1.

[0437] Toxic Nuclear Foci can be Targeted by Cas13

[0438] CRISPR-Cas13 systems bind only to RNA and function asspecific endoribonucleases to cleave target RNAs, bypassing therisk of germline editing that is associated with DNA-bindingCRISPR-Cas endonucleases. However, due to their large size and lackof intrinsic localization signals, Cas13 fusion proteins areinefficiently localized to the mammalian nucleus. We recentlyidentified a non-classical nuclear localization signal (NLS)derived from the yeast Ty1 retrotransposon which promotes robustnuclear localization of Cas13. The powerful activity of the Ty1 NLSsuggested that efficient targeting of nuclear RNAs could beachieved for either visualization or cleavage usingCRISPR-Cas13.

[0439] To determine nuclear repeat RNAs could be visualized in livecells, a fusion protein was designed using the catalytically deadType VI-B Cas13b enzyme from Prevotella sp. P5-125 (dPspCas13b)with a C-terminal enhanced Green Fluorescent Protein (eGFP) (FIG.1A). To mimic the nuclear RNA foci found in patients with DM1,transient expression of a vector containing 960 CUG repeats in thehuman DMPK 3' UTR (DT960) was used (FIG. 1B). To target thedPspCas13b-eGFP fusion protein to CUG repeats, a PspCas13bcompatible crRNA containing a CAG repeat target sequence wasdesigned, which is predicted to hybridize with 9 CUG repeats (FIG.1C). Guided by the CAG repeat crRNA, co-transfection of thedPspCas13b-eGFP was completely nuclear localized and highlightednuclear RNA foci generated specifically from the expression ofDT960 (FIG. 1D). In contrast, co-expression with a non-targetingcrRNA resulted in broad, un-localized nuclear fluorescence (FIG.1D). The efficient nuclear targeting of Cas13 to CUG RNA focisuggested it could be a useful tool for targeted cleavage ofCUG.sup.exp RNA using its inherent endoribonuclease activity.

[0440] EraseR can Degrade Toxic RNA Foci In Vitro

[0441] Activated PspCas13b, containing the Ty1 NLS, resulted in asignificant reduction in the number of RNA foci and intensity, asdetected using mCherry-MNBL1 (FIG. 3A and FIG. 3B). Becausesurrounding target sequences can influence Cas13 nuclease activity,crRNAs were tested in all three reading frames and all CAGx9 crRNAsresulted in significant reduction in the number of RNA foci percell (FIG. 3). These data show that eraseR efficiently reducestoxic RNA foci induced by CUG.sup.exp in the human DMPK gene invitro.

[0442] These studies are the first to demonstrate that CRISPR-Cas13are sufficient to target and degrade CUG.sup.exp RNA, which offersa clear path towards the development of novel therapeuticapproaches for treating DM1. Additional studies are rigorouslydesigned and controlled to determine the parameters which enhanceeraseR cleavage of toxic RNA foci and efficacy in a cardiachumanized mouse model of DM1. Importantly, the tools developed andtested herein are identical to those which could be delivered tohuman DM1 patients.

[0443] Targeted Degradation of CUG.sup.exp RNA with eraseR

[0444] Multiple variables can impact the cleavage efficiency ofCRISPR-Cas13 endoribonuclease activation, which ultimately willunderscore the efficiency of cleavage and therapeutic potential oferaseR for treating DM1. While the data presented herein showedthat eraseR can already significantly degrade RNA foci, it isdetermined herein if cleavage efficiency can be further enhanced bymodifications to the Cas13 protein, crRNA guide and/or targetsequences. Reduction of RNA foci in cells is analyzed usingfluorescent in situ hybridization (FISH), fluorescence using anmCherry-tagged MBNL1, and quantitative realtime-PCR using primersspecific to the DT960 transcript.

[0445] Different Cas13 family members. EraseR utilizes Cas13b fromPrevotella sp. P5-125 (PspCas13b), which was previously shown to bethe most robust Cas13 member for RNA base editing. However, Cas13systems are comprised by 4 major families (Cas13A-D), which mayprovide different cleavage activities for degrading CUG.sup.exp RNAfoci. Therefore, representative Cas13 proteins are cloned with Nterminal Ty1 NLS fusions into the CSX expression vector and theirrelative cleavage efficiencies are determined compared toPspCas13b.

[0446] Guide RNA length. Every naturally occurring Cas13 CRISPRarray has a specific spacer and direct repeat length, with thespacer length corresponding to the size of the RNA target sequence.Initial studies with PspCas13 utilized a spacer length of 30nucleotides, which matches the endogenous spacer size. However,spacer length can influence target sequence recognition, cleavageactivation, or packing of Cas13 enzymes onto tandem repeatsequences. Therefore, it is tested whether spacer length influencesdegradation of foci by testing crRNAs with shorter (25nt), andlonger (35, 40, 45, 50, 55 and 60nts) in length.

[0447] Activation by CRISPR cleavage activity by AccessoryProteins. Some CRISPR-Cas13 families are clustered with smallerCRISPR associated proteins, which serve to either inhibit orenhance cleavage efficiency. It is determined if co-expression ofCsx28, which has been previously shown to enhance Cas13b cleavageactivity, enhances the degradation of RNA foci using our cell basedassays.

[0448] Determination of Whether Reduction of RNA Foci by eraseRAmeliorates DM1 Cardiovascular Phenotypes In Vivo.

[0449] A cardiac DM1 mouse model with a Tet inducible transgeneencoding the human DMPK gene with 960 CUG repeats (CUG960) is usedand is induced using a cardiac specific tTA transgene (Myh6-tTA)(FIG. 9). Expression of this construct has previously been shown toinduce MBNL-associated RNA foci formation, splicing defects, andcardiac dysfunction, including dilated cardiomyopathy, arrhythmiasand contractile defects. Briefly, CUG960 homozygous mice arecrossed with a hemizygous tTA mouse to generate bi-transgenicoffspring (CUG960 and Myh6-tTA) and single transgenic (CUG960)controls (FIG. 9A and FIG. 9B).

[0450] Cardiomyocyte-specific gene delivery using AAV9 virus inmice. AAV9 serotype virus is a promising therapeutic vector fordelivery and expression of genes in the heart. EraseR and guide-RNAexpression cassettes are subcloned into an AAV9 viral packagingplasmid and high titer virus is generated (FIG. 9C). For thesestudies, eraseR using the PspCas13b and CAGx9 guide RNA is used.AAV9 virus encoding Luciferase driven by the chicken cardiacTroponin T promoter (cTnT) for cardiomyocyte-specific expression(pAAV:cTNT::Luciferase), showed robust cardiac specific expression,when injected intraperitoneally in postnatal day 10 (P10) neonatesand visualized using 150 .mu.g/g Luciferin after 10 weeks (FIG.9D). At P10, 3.75e11 gc/ml of AAV is injected via the superficialtemporal vein in 6 male and 6 female CUG960:tTA bi-transgenic mice,and an equal number of male and female single transgenic controls.Measurements (see below) are made at 12 weeks post injection.EraseR treated mice show improved cardiac function (FIG. 9E).

[0451] Determination of whether eraseR treatment ameliorates heartfunction by echocardiography and electrocardiography. Serialechocardiography is performed at 12 weeks following AAV-mediatederaseR injection by two-dimensional echocardiography using the SIGVisual Sonics Vevo 2100. Measurements of heart rate (HR),fractional shortening (FS) and ejection fraction (EF), and leftventricular dimensions are recorded and compared. Fractionalshortening (% FS) are used to indicate impaired cardiac functionand a % FS below 40% is used to indicate cardiomyopathy. ECGmeasurements on anesthetized mice are measured using AdInstrumentsBioAmp ECG apparatus. ECG recordings are captured for 10 minutesfor each animal and analyzed using LabChart7 software. Specialattention is paid to the lengths of the PR and QRS intervals, asthis is prolonged in DM1.

[0452] Evaluation of cardiac histology and RNA foci ineraseR-treated DM1 hearts. Following echocardiography and ECGmeasurements, hearts are collected for histological analysis for byparaffin embedding. H&E staining is used to visualize anydifferences in gross anatomy and cardiomyocyte cell morphology. Toidentify changes in heart growth, morphometric measurements includeheart weight to body weight, heart weight to tibia length, leftventricular posterior wall thickness and interventricular septumthickness. At 12 weeks of age, after non-invasive cardiacmonitoring experiments are performed, hearts from half the mice areharvested for histology and half the hearts are analyzed usingqRT-PCR to determine knockdown of the CUG960 transgene and forrescue of splicing. Nuclear foci are examined at 12 weeks by FISHusing a 21-mer oligonucleotide conjugated with a 5' Alexa Fluor 488dye. Nuclei are counterstained with DAPI. EraseR treated mice havesignificantly reduced nuclear foci and decreased levels of toxicRNA.

[0453] Models which have been developed for DM1 can vary broadly intheir phonotypic severity and gender specific differences mayinterfere with outcomes of heart phenotype and cardiacelectrophysiology. Male DM1 patients are more likely to presentwith DM1 symptoms and more at risk for developing cardiacconduction defects than female patients. Given the importance ofgender specific differences, both genders are examined.

[0454] Statistical Methods. Students t-test is applied to comparesingle treatments. Multiple physiological and biochemical assaysare analyzed using one-way or repeated measures ANOVA. Post-hocanalysis (i.e. Newman-Keuls) is performed.

Example 3: Enhancing RNA Visualization and Fusion ProteinLocalization with dCas13

[0455] Fusion of dPspCas13b with enhanced GFP (eGFP), combined withthe Ty1 NLS, allowed for robust and specific visualization ofnuclear RNA foci (FIG. 10A). For visualization of microsatelliterepeat expanded RNA foci, target RNA signal intensity overbackground is aided by 1) multiple RNA target sequences within therepetitive RNA sequences, and 2) focal concentration of signalwithin a nuclear foci. Visualization applications targeting uniqueor low copy RNA sequences are traditionally hampered by lowsignal-to-noise ratios. Described herein is an approach for Cas13to enhance the 1) signal to noise ratio of dCas13 targeted RNAs orto increase the localization of a fusion protein to a target RNAsequence.

[0456] This approach relies on the fluorescent complementationinherent in superfolder GFP, which similar to GFP, is comprised ofa beta barrel structure of 11 beta strands. Deletion of the 11thbeta strand from sfGFP abolishes fluorescent activity, however, the11th beta strand can be delivered in cis or trans to restorefluorescence. Further, the 11th strand can serve as a small tag ona protein, which when co-expressed with sfGFP encoding the first 10beta strands, will reconstitute a GFP fusion protein (FIG. 10B).Tandem assembly of S11 strands has the potential to increase thesignal to noise ratio of dCas13 targeted RNAs (FIG. 10C). Further,this approach could be similarly useful for targeting a largernumber of fusion proteins (Protein X) when co-expressed with asfGFP 1-10 encoding a fusion to a protein of interested (FIG.10D).

Example 4: Targeted Destruction of Coronavirus RNA by CRISPR-Cas13Delivered with Integration Deficient Lentiviral Vectors

[0457] The data presented herein demonstrate the efficacy of usingRNA-targeting CRISPR-Cas13 platforms as an approach to 1) identifyeffective CRISPR-guide RNAs targeting essential and conservedcoronavirus RNA sequences, 2) identify the most robust guide-RNAand CRISPR-Cas13 platforms for robust coronavirus RNA cleavage, and3), harness non-integrating lentiviral vectors pseudotyped withcoronavirus Spike protein. These experiments represent a majorfirst step toward the development of a novel targeted therapeuticfor treating coronavirus infections. Notably, the rapidprogrammability and delivery of this approach could be adapted totarget diverse coronavirus strains or other infectious RNA viruses,such as influenza.

[0458] Coronavirus Lifecycle

[0459] Coronavirus genomes are encoded by a large (.about.30 kb),single-stranded mRNA, which is capped and polyadenylated, allowingfor translation by host proteins. Coronavirus genomes replicateentirely through RNA intermediates, generating both full-lengthgenomic mRNA and nested subgenomic mRNAs, allowing for expressionof numerous viral proteins.

[0460] Targeting

[0461] As a result of coronavirus replication and transcription, 5'sequences (Leader) and 3' sequences (S2M or Nucleocapsid ORF) arecommon to genomic and all subgenomic RNAs (FIG. 11). Thesesequences provide the opportunity for design of guide-RNAs whichhave the capacity for broad efficacy. Tiling CRISPR RNAs (crRNAs)are tested in cell-based luciferase reporter assays using aluciferase reporter mRNA containing coronavirus target sequences in5' UTR or 3'UTR regions.

[0462] Cleavage

[0463] RNA cleavage efficacy and specificity of coronavirus targetsequences are determined in the above assays utilizing novelCRISPR-Cas13 systems (eraseR platforms), with enhanced guide-RNAexpression constructs and/or CRISPR arrays (FIG. 12).

[0464] Delivery

[0465] Lentiviral vectors are enveloped and can be pseudotyped withdifferent viral envelope proteins to alter viral tropism (FIG. 13).The efficacy and stability of lentiviral vectors pseudotyped withcoronavirus envelope spike protein to transduce ACE2-expressingcell types is determined. Nonintegrating, 3rd generation lentiviralvectors, produced using catalytically inactive Integrase, offer asafe and transient expression approach for viral RNA clearance,without permanent expression.

[0466] Lentiviral constructs encoding CRISPR-Cas13 components canbe packaged into non-integrating lentiviral particles pseudotypedwith viral envelope proteins. For example, the lentiviral particlecan be pseudotyped with the Spike glycoprotein from SARS-CoV-2coronavirus, which provides specificity for entry into ACE2receptor expressing cells. (FIG. 14B). This allows for specifictargeting of `coronavirus-targeted` cell types. Post-transduction,the processing and formation of non-integrating lentiviral episomesallows for transient expression of CRISPR-Cas13 components foracute targeted degradation of CoV genomic and subgenomic viralmRNAs (FIG. 14C).

[0467] A Luciferase reporter containing the SARS-2-CoV S2M sequencewas used. (FIG. 17A). Seven crRNAs were designed targeting the CoVleader sequence. (FIG. 17B). Cell-based luciferase assaysdemonstrate robust knockdown of CoV Leader Luc reporter activity incells with crRNAs targeting SARS-CoV-2 leader sequence (crRNAs Athrough G) or Luciferase coding sequence (Luc), relative to anon-targeting crRNA (FIG. 17C).

[0468] Additionally, a Luciferase reporter containing theSARS-2-CoV S2M sequence was used. (FIG. 18A). Six crRNAs weredesigned targeting the SARS-2-CoV S2M sequence. (FIG. 18B).Cell-based luciferase assays demonstrate robust knockdown of CoVS2M Luc reporter activity in cells with crRNAs targeting SARS-CoV-2S2M sequence (crRNAs A through F) or Luciferase coding sequence(Luc), relative to a non-targeting crRNA (FIG. 18C).

Example 5: One-Step Directional Assembly of CRISPR-Cas13 crRNAArrays

[0469] The data provided herein demonstrates the design andvalidation of an approach to generate crRNA arrays by directligation of multiple annealed oligo pairs containing nucleotidesubstitutions within DR sequences (FIG. 19D). This rapid assemblyapproach was used to efficiently generate tandem ordered arrays for3 spacer sequences, which notably, do not contain poly T stretcheswithin the DR sequence, thereby promoting full-length arraytranscription. Given other potential nucleotide substitutions inthese positions, arrays of up to 7 crRNAs lacking a DR T stretchcould be assembled in a single-step, or arrays up to 8 crRNAs if aDR T stretch is included (FIG. 19E).

[0470] CRISPR-Cas13 guide RNAs occur naturally in bacterial speciesin tandem arrays, which are subsequently processed into singleguides by Cas13-mediated cleavage (FIG. 19A). This cleavageactivity is separable from target RNA cleavage activity, thus`catalytically dead` (dCas13) retains this crRNA processingability. Many CRISPR-Cas13 direct repeats contain poly T sequencesof 4-5 nucleotides which have the potential to inhibit single ortandem full-length crRNA expression from commonly used Pol IIIpromoters, such as hU6, in mammalian cells (FIG. 19B).Crystallography studies have revealed that the poly T stretchesoccur in the loop region of the direct repeat (DR), and that atleast one T nucleotide projects into space, suggesting it doesn'tplay an important role in CRISPR-Cas13 binding or cleavage. Asshown herein, mutation of two positions within this T stretch, T17Cor T18C, does not inhibit dCas13 or Cas13-mediated activity. Thus,these changes can be harnessed to generate diversity within the DRsequence to allow for multiplex, directional cloning.

[0471] Mammalian guide-RNA expression cassettes are generallycreated by cloning annealed oligonucleotides comprising the spacersequence into a cassette comprised of a mammalian Pol III promoter,a Direct Repeat and a terminator of 6 or more Ts (FIG. 19C).Commonly, multiple guide-RNAs are expressed by adding addition PolIII promoter cassettes, however this can significantly increase thecomplexity and size of the vector. Generation of tandem crRNAarrays would significantly decrease the size requirements of thevector; however, nucleotide synthesis of long arrays is prohibiteddue to size and the repeat nature of DR sequences.

Example 6: Enhanced Knockdown of SARS-CoV-2 Viral Sequences with aCRISPR crRNA Array

[0472] Example 4 demonstrates the design and validation of CRISPRguide-RNAs capable of robust knockdown of a luciferase reporterencoding SARS-CoV-2 viral sequences. Example 5 demonstrates thedevelopment of a cloning strategy for the directional assembly oftandem crRNA arrays, which take advantage of base substitutions innon-essential residues within the loop region of Cas13b DirectRepeat (FIG. 19E and FIG. 20A). The data presented hereindemonstrates that all possible base mutations within these two loopresidues (T17 and T18) do not negatively affect guide RNA targetingand knockdown of a luciferase reporter mRNA for two independentguide RNAs targeting luciferase coding sequence (Luc-a and Luc-b)(FIG. 20B).

[0473] Lentiviral gene transfer vectors encoding CRISPR-Cas13 withsingle or triple crRNA arrays targeting SARS-CoV-2 viral sequenceswere developed. (FIG. 21A). A luciferase reporter was constructedcontaining Leader and N protein SARS-CoV-2 viral target sequences,encoded in both the 5' and 3' UTR regions of a Luciferase reportermRNA (FIG. 21B). The data presented herein shows that expression ofmultiple guide-RNAs from a single promoter, encoded in a lentiviraltransfer vector, results in greater luciferase activity knockdowncompared with expression of a single guide RNA (FIG. 21C). Theseresults demonstrate greater efficacy for using multiple guide-RNAstargeting a single viral genome, with the added benefit thatmultiple guide RNAs may further prevent viral `escape,` which mayoccur through random mutagenesis or by therapeutic selection.

[0474] Additionally, the CRISPR-Cas13 expression cassette encodingthe tripe guide array is small enough to be packaged within an AAVvector, which may be a useful alternative viral gene therapydelivery method (FIG. 22).

Example 7: Targeting Influenza Virus Subtypes with CRISPR-Cas13

[0475] Examples 4 and 6 demonstrate that CRISPR-Cas13 canefficiently knockdown the expression of a luciferase reporterencoding coronavirus SARS-CoV-2 viral sequences. Based on thereplication characteristics, single guide RNAs can be designed totarget all coronavirus genomic and subgenomic RNAs. Additionally,expression of multiple guide RNAs in an array, expressed from asingle promoter, resulted in enhanced viral reporter knockdown.

[0476] Similar to coronavirus, Influenza viruses are enveloped, RNAviruses which infect both animals and humans and have significantpotential for becoming global pandemics. In contrast tocoronavirus, influenza virus is composed of 8 independent viral RNAsegments, which localize and replicate within the vertebratenucleus (FIG. 23A). Viral RNA (vRNA) segments encode at least 10proteins, which encode viral replication enzymes, structuralproteins and envelope glycoproteins required for host cell bindingand fusion. The multi-segment viral RNA genome allows for rapidmutation and viral selection; as viral segments can be readilyswitched between viral subtypes within infected cells. This has ledto a diverse number of Influenza subtypes, which are categorized byenvelope proteins Hemagglutinin (HA) and Neuraminidase (NA). Thesefeatures present a unique challenge for the targeted degradation ofInfluenza viral RNA by CRISPR-Cas13.

[0477] The data presented herein presents the design of crRNAswhich could target the 4 major Influenza A viral subtypes whichhave cause significant human disease in the recent past, and retainsignificant potential for becoming global pandemics (H1N1, H2N2,H3N2 and H7N9). Using multiple sequence alignment of viral proteincoding sequences across these four subtypes, conserved segmentswere identified for five of the 8 viral segments (Table 3). Largeconserved viral sequences across subtypes for HA and NA genes werenot identified, consistent with their rapid evolution which enablesevasion to host immunity. For these five regions, guide RNAs weredesigned to target either the negative-sense viral RNA (vRNA) orpositive-sense viral protein coding mRNA. Guide-RNA arrays weredesigned to express all five crRNAs from a single Pol IIIpromoter.

[0478] Encoding CRISPR guide arrays and Cas13 expression cassetteswithin a lentiviral gene transfer vector (or alternative genetherapy vector, such as AAV), would allow for the generation of asingle particle for delivery and expression of CRISPR-Cas13components to vertebrate cells (FIG. 14). Pseudotyping lentiviralvectors with NA and HA envelope proteins could be utilized totarget specific cell types infected by Influenza virus, such asairway epithelia.

TABLE-US-00003 TABLE 3 Sequence alignment and identification ofconserved coding sequences among Influenza A Segments from H1N1,H2N2, H3N2, H7N9. SEQ ID NO SEGMENT 1 H1N1GTGTTGGTAATGAAACGAAAACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACC 3282253 H3N2GTGTTGGTAATGAAACGAAAACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACC 3292280 H7N9GTGTTGGTGATGAAACGGAAACGGGACTCTAGCATACTTACTGACAGTCAGACAGCGACC 3302253 H2N2GTGTTGGTAATGAAACGAAAACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACC 3312280 ********.********.*****************************************SEGMENT 2 H1N1GGACGGATCAAGAAAGAAGAGTTCTCTGAGATCATGAAGATCTGTTCCACCATTGAAGAA 3322256 H3N2GGACGGATTAAGAAGGAAGAGTTCTCTGAGATCATGAAGATCTGTTCCACCATTGAAGAA 3332280 H7N9GGAAGGATTAAGAAAGAAGAGTTTGCTGAGATCATGAAGATCTGTTCCACCATTGAAGAG 3342256 H2N2GGACGGATTAAGAAAGAGGAGTTCGCTGAGATCATGAAGATCTGTTCCACCATTGAAGAG 3352280 ***.*********.**.***** **********************************.SEGMENT 3 H1N1AATCGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTTAATGCATCTTGGTTCAACTCC 3362135 H3N2AATTGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTCAATGCATCTTGGTTCAACTCC 3372160 H7N9AATCGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTTAATGCATCTTGGTTCAACTCC 3382136 H2N2AATTGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTTAATGCGTCTTGGTTCAACTCC 3392160 ******************************************.**************SEGMENT 5 H1N1TTGACATGAGTAATGAAGGGTCTTATTTCTTCGGAGACAATGCAGAGGAGTATGACAGTT 3401476 H3N2TTGATATGAGTAATGAAGGATCTTATTTCTTCGGAGACAATGCAGAAGAGTACGACAATT 3411540 H7N9TTGACATGAATAATGAAGGATCTTATTTCTTCGGAGACAATGCAGAGGAGTATGACAATT 3421486 H2N2TTGACATGAGTAATGAAGGATCTTATTTCTTCGGAGACAATGCAGAGGAGTACGACAATT 3431477 ********.*********.**************************.***** ****.**SEGMENT 7 H1N1TTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTGGAAAGTGTCTT 95 344H3N2 CTCTATCGTTCCATCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTCTT345 120 H7N9CTCTATCATTCCATCAGGCCCCCTCAAAGCCGAGATCGCACAGAGACTTGAGGATGTTTT 95 346H2N2 CTCTATCGTCCCGTCAGGCCCCCTCAAAGCCGAGATCGCACAGAGACTTGAAGATGTCTT347 120 ******.***.**************************.******** **...*****

Example 8: Relative Knockdown of Toxic Nuclear RNA Foci byDifferent CRISPR-Cas13 Subtypes

[0479] Currently, four CRISPR-Cas13 subtypes have been identifiedin bacteria (Cas13a, Cas13b, Cas13c and Cas13d), which areclassified according to protein sequence similarity and subtypespecific locus features. All CRISPR-Cas13 subtypes are guided bysmall CRISPR RNAs (crRNAs) and contain two HEPN domains which arerequired for their catalytic RNase activity. CRISPR-RNAs for eachsubtype are composed of a unique direct repeat (DR) sequence, whichfunctions as a handle for Cas13 binding, and different optimalspacer sequence lengths for target RNA recognition (for example, 30nt for PspCas13b, 22 nt for RfxCas13d, and 28 nt for LwCas13a). Aswell, the relative orientation of Spacer and DR sequences areunique for each subtype (for example, Cas13b encodes a 3' DR,whereas Cas13a, Cas13c and Cas13d encode a 5' DR). Currently,family members from three CRISPR-Cas13 subtypes (Cas13a, Cas13b andCas13d) have been shown to be effective for RNA knockdown whenexpressed in mammalian cells, however, can display differentknockdown efficiencies, which may be due to guide-RNA targetingefficiencies, or Cas13 protein stability. For the latter,CRISPR-Cas13a subtypes have been shown to be less stable inmammalian cells unless fused to superfolder GFP, and some Cas13dfamily members, such as RfxCas13d, cleave less efficiently whenlocalized in the cytoplasm.

[0480] To determine the relative cleavage efficiencies forCRISPR-Cas13 subtypes (Cas13a,-b and -d) in degrading toxic nuclearRNA foci, guide RNAs were designed specific for each subtype totarget a luciferase reporter containing an expanded CUG RNA repeatlocated in the 3' UTR (pGL3P-DT960) (FIG. 25A). Expanded CUGrepeats, a hallmark of human Myotonic Dystrophies, induce nuclearRNA foci which sequester essential MBNL splicing factors. Wedesigned guide RNAs for each subtype to target both the luciferasecoding sequence (Luc-A and --B), as well as guides to target allthree frames of the CUG repeat (CAG F1, -2, and -3). Interestingly,PspCas13b fused with the robust Ty1 NLS (eraseR) and RfxCas13dfused with two copies of the SV40 NLS (CasRx-NLS) showed robustknockdown of pGL3P-DT960 reporter when targeted with eitherLuciferase- or CUG-targeting crRNAs. LwCas13a showed the leastamount of reporter activity knockdown. The smaller size of Cas13dsubtypes allows for their localization by classical nuclearlocalization sequences in dividing cells, however, the addition therobust Ty1 NLS may further enhance nuclear localization andcleavage efficiencies of Cas13d (or Cas13a), for targeting nuclearRNAs. Together, these data demonstrate that nuclear localizedCRISPR-Cas13b and -Cas13d subtypes are effective for knocking downtoxic nuclear repeat RNAs.

[0481] To directly assess if CRISPR-Cas13 subtypes can degradetoxic nuclear RNA foci, we co-expressed CRISPR-Cas13 subtypes witha plasmid expressing 960 copies of a CUG expanded RNA repeat in thecontext of the human DMPK RNA (DT960), which induces robustformation of nuclear RNA foci in mammalian cells. Consistent withour previous results, PspCas13b fused with the robust Ty1 NLS(eraseR) and RfxCas13d fused with two copies of the SV40 NLS(CasRx-NLS) resulted in a significant decrease in the number offoci per cell when targeted using crRNAs specific to the CUG repeat(CAG-F1, -2, -3), relative to a non-targeting crRNA (NT) (FIGS. 26Aand 26B). Interestingly, LwCas13a showed no significant decrease inthe number of nuclear foci compared to a non-targeting guide (FIG.26C). Thus, CRISPR-Cas13b and -d subtypes can efficiently degradetoxic nuclear foci in mammalian cells.

Example 9: CoV Spike Modifications to Enhance Pseudotyping ofLentiviral Vectors

[0482] Coronavirus and lentivirus are both enveloped RNA viruseswhich encode a membrane bound Spike envelope protein which providesboth host cell specificity and fusion between virus and host cellmembranes during transduction. Remarkably, lentiviruses have thepotential to utilize envelope proteins from other viruses, forexample Influenza virus, Ebola virus, Baculovirus and Coronavirus,to provide altered host cell tropism. However, viral envelopeproteins from Coronaviruses (CoVs) are not efficient forpseudotyping of lentiviral vectors without N and C-terminalmodifications (FIG. 27A), likely due to the fact that these virusesare generated through different host cell secretory pathways. Thedata presented herein demonstrates that modification of both N- andC-termini of the Spike protein from SARS-CoV-1 is necessary forefficient transduction of pseudotyped lentiviral vectors into humancells, which also depends on the expression of the viral hostreceptor, ACE2 (FIG. 27B). Similarly, N- and C-terminalmodifications are also required for ACE2-dependent transduction oflentiviral vectors pseudotyped with SARS-CoV-2 Spike protein (FIG.27B). These include the addition of the Signal peptide from humanCD5 and 27 amino acid trunctation of the SARS-CoV-2 cytoplasmictail.

[0483] Pseudotyped lentiviral vectors can be used for the deliveryCRISPR-Cas13 to specific therapeutic cell types targeted byinfectious agents. Perhaps the most utilized viral envelopeprotein, VSV-G, which allows robust entry into diverse cell typesin culture, independent of ACE2 expression, is less efficient fortransduction of many cell types in vivo, due to the location of theVSV-G host receptor on the basal vs apical cell surface. Theremarkably infectious nature of SARS-CoV-2 and its stronginteraction with the ACE2 receptor, suggest that utilizing CoVSpike proteins may offer a unique ability to transducetherapeutically beneficial tissues in humans, includingrespiratory, vascular, renal, and cardiovascular cell types

[0484] Generation of ACE2-HEK293T Stable Cell Lines

[0485] Stable ACE2 expressing cells were generated using transienttransfection and antibiotic selection of a human ACE2 expressioncassette, modified to carrying a Blasticidin resistance gene andexpress ACE2 with the EF1a promoter (EF1a-hACE2-Blast). To furthereliminate non-ACE2 expressing cells after selection,Blasticidin-selected cells were transduced with lentivirus encodinga Puromycin antibiotic resistance gene pseudotyped with themodified SARS-CoV-2 spike envelope protein (4LV). For thisapproach, transduction of puromycin encoding lentivirus is onlypermissible to ACE2 expressing cells due to the specificity of theSARS-CoV-2 Spike protein, which allowed for subsequent stableselection with Blasticidin and Puromycin and cloned using serialdilution

[0486] The disclosures of each and every patent, patentapplication, and publication cited herein are hereby incorporatedherein by reference in their entirety. While this invention hasbeen disclosed with reference to specific embodiments, it isapparent that other embodiments and variations of this inventionmay be devised by others skilled in the art without departing fromthe true spirit and scope of the invention. The appended claims areintended to be construed to include all such embodiments andequivalent variations.

* * * * *

References

• novocraft.com
• talk.ictvonline.org/files/master-species-lists/m/msl/9601
• seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20220267773A1